EZ ഓൺലൈൻ രോഗിയുടെ ഫോം

എടുക്കുക അല്ലെങ്കിൽ പങ്കിടുക നമ്മുടെ ഓൺലൈൻ പ്രാഥമിക ചരിത്രം & രോഗി രജിസ്ട്രേഷൻ ഫോം. നമുക്ക് സൗകര്യപ്രദമാണ് അച്ചടിക്കാവുന്ന പതിപ്പുകൾ. ഇന്ന് ഞങ്ങളെ വിളിക്കുക: 915-850-0900

ഇപ്പോൾ പങ്കു വയ്ക്കുക *

ഫംഗ്ഷണൽ മെഡിസിൻ ®

ശ്രദ്ധിക്കുക: ഞങ്ങളുടെ ഭാഗമായി കടുത്ത പരിക്കുള്ള ചികിത്സ പ്രാക്ടീസ് ചെയ്യുകഞങ്ങൾ ഇപ്പോൾ വാഗ്ദാനം ചെയ്യുന്നു ഫംഗ്ഷണൽ മെഡിസിൻ ഇന്റഗ്രേറ്റീവ് വിലയിരുത്തലുകളും ചികിത്സകളും * നമ്മുടെ ഉള്ളിൽ ക്ലിനിക്കൽ സ്കോപ്പ് വിട്ടുമാറാത്ത കുറവുള്ള അസുഖങ്ങൾക്കായി. കൂടുതലറിവ് നേടുക* ഇന്ന് ഞങ്ങളെ വിളിക്കുക: 915-850-0900

പ്രവർത്തനം ഔഷധ പഠനം

സുൽഫോപ്രഫെയ്ൻ ബ്രോക്കോളി, കാബേജ്, കോളിഫ്ളവർ, ബ്രസ്സൽസ് മുളപ്പിക്കൽ തുടങ്ങിയ cruciferous പച്ചക്കറികളിൽ അടങ്ങിയിരിക്കുന്ന അർനോസോൾഫർ സംയുക്തങ്ങളുടെ ഇസോഷ്യിയോസൈന്യേറ്റ് ഗ്രൂപ്പിലുള്ള ഒരു ഫൈറ്റോകെക്കമെമിക്കൽ ആണ്. ഇത് ബോക്ക് ചോയി, കാൾ, കോൾഡ്സ്, കടുക് പച്ചിലകൾ, വാട്ടർ ക്രെസ് എന്നിവയിലും കാണാവുന്നതാണ്. വിവിധ തരത്തിലുള്ള ക്യാൻസർ തടയാൻ സൾഫോഫോഫീൻ സഹായിക്കുമെന്ന് ഗവേഷണ പഠനങ്ങൾ തെളിയിച്ചിട്ടുണ്ട് Nrf2 ഉൽപ്പാദനം സജീവമാക്കുന്നു, അല്ലെങ്കിൽ ആണവ വസ്തുത erythroid 2- ബന്ധപ്പെട്ട ഘടകം, ഓക്സിഡൻറുകൾ ലേക്കുള്ള സെൽ പ്രതികരണം നിയന്ത്രിക്കുന്ന സംരക്ഷണ ആന്റിഓക്സിഡന്റ് സംവിധാനങ്ങൾ നിയന്ത്രിക്കുന്ന ഒരു ട്രാൻസ്ക്രിപ്ഷൻ ഘടകം. സുൽഫോപ്പാപാനിന്റെ പ്രവർത്തനത്തെ വിവരിക്കുക എന്നതാണ് അടുത്ത ലേഖനത്തിന്റെ ഉദ്ദേശ്യം.


KEAP1-Nrf2 -A ആന്റിഓക്സിഡന്റ് സിസ്റ്റമാണ് ഓക്സീഡിറ്റീവ് ആൻഡ് xenobiotic സമ്മർദ്ദങ്ങൾക്ക് കോശങ്ങളോട് പ്രതികരിക്കുന്ന ഒരു പ്രധാന മാർഗ്ഗമാണ്. Cruciferous പച്ചക്കറികളിൽ നിന്നും ഒരു ഇലക്ട്രോഫിലിക് ഐസോഷ്യിയോസൈന്യത്തിന്റെ സൾഫോരോഫാനീൻ (SFN), കെഇഎക്സ്എക്സ്എക്സ്എക്സ്എക്സ്എക്സ്എക്സ്എക്സ്എക്സ് -എ-പാത്ത്വേ പ്രവർത്തനത്തെ പ്രോത്സാഹിപ്പിക്കുകയും ദീർഘനാളത്തെ ഓക്സിഡേഷൻ സമ്മർദ്ദം ഒരു പ്രധാന ഊർജ്ജപരമായ പങ്ക് വഹിക്കുന്ന രോഗങ്ങളുടെ ചികിത്സയിൽ ഒരു തന്മാത്രയുടെ താൽപര്യം വളർത്തുകയും ചെയ്യുന്നു. SFN നടുത്ത് സംസ്ക്കരിച്ച സംസ്ക്കരിച്ച, മനുഷ്യ റെറ്റിനൽ പിഗ്മെന്റ് എപിടെഹിലിയൽ (RPE-1) സെല്ലുകളുടെ മൈമോൺക്രൊണ്ഡം NFF2, അതിന്റെ സൈറ്റോപ്ലാസ്മസ് ഇൻഹെബിറ്റർ KEAP1 എന്നിവയിൽ നിന്നും സ്വതന്ത്രമായി ഹൈഫർഫ്യൂഷനുമായി ചേർന്ന് ഞങ്ങൾ തെളിയിക്കുന്നു. അയോപോപ്റ്റസിസ് സമയത്ത് മൈറ്റോകോണ്ട്രിയയിലെ പോർ രൂപമെടുത്തുകൊണ്ട് മിത്തോകോണ്ട്രിയൽ ഫ്യൂഷൻ സൈറ്റോപ്രൊറ്ററ്റീവ് ആണെന്ന് റിപ്പോർട്ടു ചെയ്യപ്പെട്ടിരിക്കുന്നു. കൂടാതെ, അപ്പോപ്പോസിസ്-ഇൻുഡീഷ്യർ, സ്റ്റോർരോസ്പോരിൻ എന്നിവയ്ക്ക് വിധേയമാക്കിയ എസ്.എഫ്.എൻ-ചികിത്സിച്ച സെല്ലുകളുടെ സ്രോതസ്സായ NRF2- സ്വതന്ത്രവും ഞങ്ങൾ കാണിക്കുന്നു. മെറ്റീരിയലിസമായി എസ്എഫ്എൻ, മിശ്ചോൻഡിയ, മയോകോർന്ഡ്രിയ തുടങ്ങിയ മലിനീകരണ അഴിച്ചുവിടൽ വസ്തുക്കളുടെ റിക്രൂട്ട്മെന്റ് / അല്ലെങ്കിൽ നിലനിർത്തൽ ലഘൂകരിക്കപ്പെടുന്നു. ഈ ഡാറ്റ തെളിയിക്കുന്നത് SFN ന്റെ ഗുണം, KEAP1-Nrf2-AR സിസ്റ്റം സജീവമാക്കുന്നതിന് അപ്പുറം, വിവിധ ഏജന്റുമാരുടെ പരീക്ഷകളിൽ ഈ ഏജന്റെ നിലവിലെ ഉപയോഗം കണക്കിലെടുത്ത് കൂടുതൽ ചോദ്യം ചെയ്യൽ വാറൻറ് നൽകുന്നു.

അടയാളവാക്കുകൾ: സുൽഫോപ്പാപേൻ, Nrf2, Drp1, മൈറ്റോകോണ്ട്രിയ, ഫിക്ഷൻ, ഫ്യൂഷൻ, അപ്പോപ്പോനോസിസ്


മിതോചോൻട്രിറിയൽ വിഭജനത്തിന്റെ Nrf2- ഇൻഡിപെൻഡൻറ് ഇൻഹെബിറ്റർ ആണ് സുൾഫോഫോഫെയ്ൻ

സുൽഫോപ്പാപാനെ (എസ്.എഫ്.എൻ) എന്നറിയപ്പെടുന്ന ഒരു ഐസോത്തോസിയോനറ്റ് സംയുക്തം. ഇത് സാധാരണയായി cruciferous പച്ചക്കറികളിൽ നിന്നുള്ളതാണ്. നശിച്ച സെല്ലുകളിൽ നിന്നുള്ള ഹൈഡ്രോലിറ്റിക് എൻസൈം മൈറോസിനാസിസിന്റെ വെസ്റ്റ്യൂക്കറുകളുടെ പ്രകാശനം മുഖേന ഉത്തേജനം ഒരു സീനബോട്ടിക് പ്രതികരണമായി സസ്യങ്ങളിൽ ഉൽപാദിപ്പിക്കപ്പെടുന്നു. ഈ എൻസൈം ഗ്ലൂക്കോസിനോളേറ്റുകളെ ഐസോതോയോസൈറ്റന്റ്സ് (56) ആയി പരിവർത്തനം ചെയ്യുന്നു. കഴിഞ്ഞ രണ്ട് ദശാബ്ദങ്ങളിൽ, SFN ന്റെ റിപ്പോർട്ട്, ആൻറിഓക്സിഡൻറും, ആൻറിഓക്സിഡൻറും, ആൻറിക് ക്രോബിയൽ വസ്തുക്കളും റിപ്പോർട്ട് ചെയ്തിട്ടുണ്ട്. ഈ ഫലപ്രാപ്തി വളരെ കൂടുതലായതിനാൽ SIPN ന്റെ ശേഷിക്ക് KEAP42-Nrf57-ആന്റിഓക്സിഡന്റ് പ്രതികരണ ഘടകം (ARE) സിഗ്നലിങ് പാത്ത്വേ മോഡുലാർഡിനെ ആധാരമാക്കിയുള്ളതായിരുന്നു, എന്നിരുന്നാലും കൂടുതൽ പ്രവർത്തനങ്ങൾ ഹിസ്റ്റോൺ ഡീസെറ്റിലൈസ് പ്രവർത്തനം, സെൽ സൈക്കിൾ പുരോഗമനത്തിനിടയാക്കൽ എന്നിവ ഉൾപ്പെടെയുള്ള പ്രവർത്തനങ്ങൾ കണ്ടെത്തുകയുണ്ടായി [ 1]. Nrf2 മാസ്റ്റര് ആന്റിഓക്സിഡന്റ് ട്രാന്സ്ക്രിപ്ഷന് കോര്പ്പറേറ്റും ഹോംസ്റ്റാസിസിനുണ്ടാകുന്ന അവസ്ഥകളുമാണ്, Culin29KEAP2 ubiquitin ലിഗേയ്സ് കോംപ്ലക്സില് [3] സൈറ്റിപ്ലാസ്മാസിക് പ്രവര്ത്തനത്തിലൂടെ അതിന്റെ സുസ്ഥിരത നിരുത്സാഹപ്പെടുത്തുന്നു. വ്യക്തമായും, ഡീമർഡിക് ഉപരിതല അഡാപ്റ്ററായ KEAP1 ലേക്ക് ബന്ധിപ്പിച്ചുകൊണ്ട് Nrf20, Cullin2KEAP3 ligase- ലേക്ക് റിക്രൂട്ട് ചെയ്യുന്നു, കൂടാതെ പ്രോട്ടോമാമിയം-മധ്യേയുള്ള ഡഗ്റാഡേഷനായുള്ള ട്രാൻസ്ക്രിപ്ഷൻ ഘടകം ലക്ഷ്യമാക്കിയുള്ള polyUb chains ഉപയോഗിച്ച് പരിഷ്കരിക്കപ്പെടുന്നു. ഈ കോൺട്രിബ്യൂട്ടിലെ വിറ്റുവരവ്, അൺസ്ട്റേഡഡ് സെല്ലുകളിലെ NRF1 ന്റെ അർദ്ധായുസ്സ് ~ 1 മിനിറ്റ് [2], [15], [30], [33] ആയി പരിമിതപ്പെടുത്തുന്നു. സമ്മർദ്ദം, ഏറ്റവും പ്രധാനപ്പെട്ടത് ഒക്സിദതിവെ സമ്മർദ്ദം നിരവധി തരം പ്രതികരണമായി, കെഅപ്ക്സനുമ്ക്സ, ഒരു മെത്തിയോണിൻ-സമ്പന്നമായ പ്രോട്ടീൻ, ഒരു രെദൊക്സ സെൻസർ പ്രവർത്തിക്കുന്നു, ഗുരുതരമായ ച്യ്സ്തെഇനെസ് എന്ന ഒക്സിദതിവെ പരിഷ്കരണത്തിന്, പ്രത്യേകിച്ച് ച്ക്സനുമ്ക്സ, കെഅപ്ക്സനുമ്ക്സ മൂലം ംര്ഫ്ക്സനുമ്ക്സ ശോഷണ തടയുന്നു ചുല്ക്സനുമ്ക്സ നിന്നും ംര്ഫ്ക്സനുമ്ക്സ-കെഅപ്ക്സനുമ്ക്സ ദിഷൊചിഅതെസ് [ 46], [55], [1]. പ്രത്യേകിച്ച്, SFN, കൂടാതെ മറ്റ് NFF151 ആക്റ്റിവേറ്റർമാർ, ഉദാഹരണത്തിന് KXAPXMLXXXXXXXX [1] മാറ്റുന്നതിലൂടെ ഓക്സിഡേറ്റീവ് സ്ട്രെസ്സ് അനുകരിക്കുകയാണ്. Nrf2- ന്റെ സ്ഥിരത അതിന്റെ അഡ്രസ്സിനെ ന്യൂക്ലിയസിന് സഹായിക്കുന്നു, ഇത് ഘട്ടം II ആന്റിഓക്സിഡന്റ്, ഡീലോക്സിഫിക്കേഷൻ ജീനുകളുടെ ഒരു ബാറ്ററി വെളിപ്പെടുത്തുന്നു. NFF1 ചെറിയ MAF പ്രോട്ടീനുകളുമായി heterodimerization വഴി അതിന്റെ തിരിച്ചറിഞ്ഞ ടാർഗെറ്റ് ജീൻസിന്റെ ആന്റിഓക്സിഡന്റ് പ്രതികരണ പ്രൊമോട്ടർ ഘടകങ്ങൾ (എആർ) ബന്ധിപ്പിക്കുന്നു. ഈ സിസ്റ്റം SFN പോലെയുള്ള പരോക്ഷമായ ആന്റിഓക്സിഡന്റുകൾ, മൈറ്റോകോണ്ട്രിയ (3), അല്ലെങ്കിൽ ഓക്സിഡേറ്റീവ് സമ്മർദ്ദത്തിന്റെ മറ്റ് ഫിസിയോളജിക്കൽ സ്രോതസ്സുകൾ [2] എന്നിവ നിർമ്മിച്ച ഫ്രീ റാഡിക്കലുകളെ ഒരു ചലനാത്മകവും സെൻസിറ്റീവ് പ്രതികരണവും നൽകുന്നു.

എപിപി ഉൽപ്പാദനം, ഇൻട്രാസെല്യൂലർ കാത്സ്യം ബഫറിങ്, റെഡോക്സ് റെഗുലേഷൻ, അപ്പോപ്പോസിസ് [13], [49] എന്നിവയിലെ സെല്ലുലാർ പ്രവർത്തനങ്ങൾ നിയന്ത്രിക്കുന്ന ഡൈനാമിക്, ഉപസൗലാർ ഓർഗൻസുകളാണ് മൈറ്റോകോണ്ട്രിയ. കോശത്തിനുള്ളിൽ പ്രതിപ്രവർത്തക ഓക്സിജൻ (റോസ്) ന്റെ മുഖ്യ ഉറവിടവും മിറ്റോക്രൊൻഡ്യയെ പ്രതിനിധാനം ചെയ്യുന്നു. അമിതമായ ഫ്രീ റാഡിക്കൽ ഉൽപാദനത്തിന്റെ ദോഷകരമായ പ്രത്യാഘാതങ്ങളെ ലഘൂകരിക്കുന്നതിനിടയിൽ തന്നെ സെല്ലുലാർ ആവശ്യങ്ങൾ നിറവേറ്റുന്നതിനായി എ.ടി.പി. ഉൽപ്പാദനം മെച്ചപ്പെടുത്തുന്നതിന് മൈറ്റോകോണ്ട്രിയൽ പ്രവർത്തനത്തിന്റെ ശരിയായ നിയന്ത്രണം ആവശ്യമാണ്. മൈറ്റോകോണ്ട്രിയയുടെ മികച്ച മോഡുലേഷനു വേണ്ടി ഒരു നിർണ്ണായക ഘടകം മൈറ്റോകോണ്ട്രിയയ്ക്ക് സ്വതന്ത്രമാവുക, ബയോകെമിക്കൽ മെഷീനുകൾ പോലെ വിശാലവും പ്രതികരിക്കുന്നതുമായ ഒരു നെറ്റ് വർക്കിന്റെ ഭാഗമാണ്.

മിറ്റനോചോണ്ട്രൽ ശൃംഖലയുടെ രൂപവത്കരണവും പ്രവർത്തനവും അണുവിഭജനവും കൂടിച്ചേരലും തമ്മിലുള്ള ഒരു നിയന്ത്രിത ബാലൻസാണ്. സെൽ ഡിവിഷൻ [28] സമയത്ത് മൈറ്റോകോണ്ട്രിയ മകളുടെ സെല്ലിൽ മൈറ്റോകോണ്ട്രൈരിയൽ വിച്ഛേദനം നടത്തുന്നു. അതുപോലെ തന്നെ മൈടോപ്പൊണ്ടരിയയുടെ അവശിഷ്ടവസ്തുക്കളോ, നശിച്ചതോ ആയ മൈറ്റോകോണ്ട്രിയയുടെ തിരഞ്ഞെടുത്ത, സ്വയംഭ്രമ തകരാറുമൂലം, മൈമോഫോഗി [1] എന്നാണ് വിളിക്കുന്നത്. അതുപോലെ, mitochondrial genomes നിറയ്ക്കുകയും അയൺ മെക്കോൺഡ്ഡ്രറിയ [54] തമ്മിൽ ഇലക്ട്രോൺ ട്രാൻസ്പോർട്ട് ശൃംഖല ഘടകങ്ങൾ പങ്കുവയ്ക്കുകയും വേണം. തന്മാത്രയിൽ, mitochondrial fission, കൂടിച്ചേരലുകളെ വലിയ, ഡൈനാമിൻ പോലുള്ള GTPases നിയന്ത്രിക്കുന്നു. മൂന്ന് എൻസൈമുകൾ പ്രാഥമികമായി ഫ്യൂഷൻ നിയന്ത്രിക്കുന്ന: മിതൊഫുസിംസ് ക്സനുമ്ക്സ ആൻഡ് ക്സനുമ്ക്സ (മ്ഫ്ന്ക്സനുമ്ക്സ / ക്സനുമ്ക്സ) പുറം സ്തര ഫ്യൂഷൻ ഹെതെരൊത്യ്പിച് ഇടപെടലുകൾ വഴി,,, സമീപമുള്ള മൈറ്റോകോണ്ട്രിയകളില്ലാതെ തമ്മിലുള്ള മധ്യസ്ഥത വഹിക്കാൻ ആ [ക്സനുമ്ക്സ] [ക്സനുമ്ക്സ] ഒപക്സനുമ്ക്സ ഒരു ആന്തരിക തന്നെ [ക്സനുമ്ക്സ] രണ്ട്-പാസ് പുറത്തെ സ്തര പ്രോട്ടീൻ ആകുന്നു മെംബ്രെൻ പ്രോട്ടീൻ ആന്തരിക ചക്രത്തിന്റെ melding നിയന്ത്രിക്കുന്നതിലൂടെ മാട്രിക്സ് കണക്റ്റിവിറ്റി ഉറപ്പാക്കുന്നു [1]. പ്രോട്ടീനുകൾ OMA2 [1], PARL [2], YME15 [25] എന്നിവ ഉപയോഗിച്ച് mitochondrial inner membrane ൽ സങ്കീർണ്ണ പ്രോട്ടൊളിസിക്കും കൂടുതൽ പ്രോട്ടീനുകൾക്കായി മൂന്ന് പ്രോട്ടീനുകളുടെ GTPase പ്രവർത്തനം ആവശ്യമാണ്. ]. നാശമുണ്ടാക്കുന്നതും ആരോഗ്യമുള്ളതുമായ മൈറ്റോകോണ്ട്രിയ [37] സംയോജിപ്പിച്ച് അടച്ചുപൂട്ടുന്നതിനായി കാര്യക്ഷമമായ മിനുട്ടുകൾക്ക് പ്രധാനമായും മൈറ്റോകോണ്ട്രിയൽ മെംബ്രൻ സാധ്യത ആവശ്യമാണ്.

ഡൈമിയം സംബന്ധിയായ പ്രോട്ടീൻ 1 (Drp1 / DNM1L) എന്ന സൈടോസോളിക് പ്രോട്ടീന്റെ മിറ്റോചോൻട്രിറിയൽ വിഘടനം പ്രധാനമായും ഉൽപ്രേരകമായിരിക്കുന്നു. സൈറ്റോസോൾ മുതൽ മൈറ്റോകോണ്ട്രിയൽ സ്പ്രേ മെംബറേൻ [1] ന് വിഘടിപ്പിക്കാനുള്ള സാധ്യതയുള്ള സൈറ്റുകളിലേക്ക് Drp43 റിക്രൂട്ട് ചെയ്യുന്നു. പുറം പാളികളിൽ ഡോക്സ്.എക്സ്.എൻ.എൻ.എക്സ്.എസിന്റെ പ്രധാന വാതകം മൈറ്റോകോണ്ട്രിയൽ വിഘടകം ഘടകം (MFF) [1], ഒരു പരിധി വരെ, ഫിക്ഷൻ 32 (Fis1) [1]. കൂടാതെ, ഒരു ഡ്രോയ്ലോ റിസപ്റ്റർ, MIEF51 / MiD1, സാധ്യതയുള്ള വിള്ളൽ സൈറ്റുകളിൽ Drp51 പ്രോട്ടീൻ പ്രവർത്തനം കൂടുതൽ പരിമിതപ്പെടുത്താൻ പ്രവർത്തിക്കുന്നു [1]. Mitochondrial extern membrane ൽ വലിച്ചെടുത്തു കഴിഞ്ഞാൽ, mitochondrion ശരീരത്തിനു ചുറ്റുമുള്ള സർപ്പിളാകൃതിയുള്ള ഘടനകളിലേക്ക് Drp58 ഒളിഗോ നൽകി, തുടർന്ന് Mitochondrial exterior and inner membranes [1] ന്റെ ശാരീരിക വിസർജ്ജനം മധ്യസ്ഥമാക്കാൻ ജിടിപി ജലവൈദ്യുതത്തിൽ നിന്ന് ഊർജ്ജം പ്രയോജനപ്പെടുത്തുന്നു. Endoplasmic reticulum-derived tubules Drp17 oligomerization മുൻപ് mitochondria ഒരു പ്രാരംഭ കോൺട്രാക്ടറായി പ്രവർത്തിക്കുന്നു, ഒരു പൂർണ്ണമായ Drp1 സർപ്പിളാകൃതിയിലുള്ള [1] എന്ന പെർസിസീവ് ചുറ്റളവിൽ കൂടുതൽ സങ്കീർണ്ണമല്ലാത്ത മൈറ്റോകോണ്ട്രിയ വെളിപാടിനെ അടിവരയിടുന്നു. മൈക്കോൺ ഓണ്ടോർറിയൽ വിച്ഛേദത്തിനു മുമ്പുള്ള ER-mitochondria പരസ്പര പ്രവർത്തനങ്ങൾക്ക് ആക്ടിൻ ഡൈനാമിക്സും പ്രാധാന്യമുണ്ട്. മൈറ്റോകോണ്ട്രിയൽ വിഘടത്തിൽ ഇതിന് പുറമേ, Drx12 പെറോക്സിസോമുകളുടെ അണുവിഭജനം [24] ഉത്തേജിപ്പിക്കുന്നു.

ഡിപ്പാർഎൻഎൻഎൻഎക്സ്എക്സ് വളരെ നന്നായി അറിയപ്പെടുന്ന ഡൈനാമിൻ പ്രോട്ടീനിനോട് വളരെ സാമ്യമുള്ളതാണ്. പ്രോട്ടീനുകളിൽ ഒരു എൻ-ടെർമിനൽ GTPase ഡൊമെയിൻ, സ്വയം-ഒളിഗോമേസറൈസേഷൻ നിർണയിക്കുന്ന ഒരു മധ്യ ഡൊമെയിൻ, ഒരു C- ടെർമിനൽ GTPase ഫലപ്രാപ്തി ഡൊമെയ്ൻ [1] എന്നിവ അടങ്ങിയിട്ടുണ്ട്. മരുന്നുകണ്ട് പ്രോട്ടീൻ Mff, FXXXX എന്നിവയുമായുള്ള ആശയവിനിമയത്തിലൂടെയും മൈറ്റോകോണ്ട്രിയ-പ്രത്യേക ഫോസ്ഫോലൈപ്പിഡ് കാർഡിലൈപിപിന് പ്രത്യേകതയായ Drp31 [1] ന്റെ ബി-ഇൻസൈറ്റ് ഡൊമൈൻസിലൂടെയും മൈറ്റോകോണ്ട്രിയൽ ചർമ്മത്തിന് മിശ്രണം ചെയ്യാൻ സാധിക്കുന്നു. സൈലപ്പൊലിമത്തിൽ ഹോർമോട്രേമറായും സാധാരണയായി Drp1 നിലവിലുണ്ട്. മിറ്റോക്രൊഡിയൽ വിള്ളൽ സൈറ്റുകളിൽ ഉയർന്ന ഓർഡർ സമ്മേളനം മധ്യസ്ഥത വഹിക്കുന്നത് Drp1 [2].

Mitochondrial ഫംഗ്ഷനും KEAP1-Nrf2-path pathway- ഉം തമ്മിലുള്ള ഊഷ്മള ബന്ധം ഞങ്ങൾ mitochondrial ഘടനയിലും പ്രവർത്തനത്തിലും Nrf2 സജീവമാക്കൽ ഫലങ്ങൾ അന്വേഷിച്ചു. SFN mtrchondrial hyperfusion പ്രോത്സാഹിപ്പിക്കുന്നതായി ഞങ്ങൾ ഇവിടെ തെളിയിക്കുന്നു, അത് അപ്രതീക്ഷിതമായി, NRF2, KEAP1 എന്നിവയിൽ നിന്ന് സ്വതന്ത്രമാണ്. SFN ന്റെ ഈ പ്രഭാവം, Drp1 ഫംഗ്ഷന്റെ ഒരു തടസ്സം ആണ്. ഞങ്ങൾ കൂടുതൽ SFN Nrf2- സ്വതന്ത്ര അപ്പോളോടോസിസ് പ്രതിരോധം നൽകുന്നു തെളിയിക്കുന്നു Drp1 ന്റെ ചോർന്നു സെല്ലുകളിൽ നിരീക്ഷിച്ച അനുയായികളും. Nrf2 സ്ഥിരപ്പെടുത്തുന്നതിനും ആക്ടിവേറ്റ് ചെയ്യുന്നതിനും പുറമെ, SFN mitochondrial dynamics മോഡുലേറ്റ് ചെയ്യുന്നു, ഒപ്പം സെല്ലുലാർ ഫിറ്റ്നസും നിലനിൽപ്പിനെ സംരക്ഷിക്കുന്നുവെന്നും ഈ ഡാറ്റ കൂട്ടിച്ചേർക്കുന്നു.


മൗണ്ട്ചോണ്ട്രറിയയുടെ സുൽഫോ പോപ്പാന ഇൻസുഷ്യൻസ് Nrf2 / KEAP1- സ്വതന്ത്ര-ഹൈപ്പർഫ്യൂഷൻ

Mitochondrial network dynamics ന് Nrf2 ആക്റ്റിവേഷന്റെ പ്രഭാവം പഠിക്കുന്ന കാലത്ത്, സൾഫോറഫാൻ (എസ്എഫ്എൻ) ഉപയോഗിച്ച് അനശ്വരമായ മനുഷ്യ റെറ്റിനൽ പിഗ്മെന്റ് എപിടെൽഹൽ (ആർപിഎഫ്എൻഎൻഎക്സ്) സെല്ലുകളുടെ ചികിത്സ, Nrf1 സിഗ്നലിംഗിന്റെ ശക്തമായ ഒരു ആക്റ്റേറ്റർ, വാഹന ചികിത്സ നിയന്ത്രിക്കുന്ന സെല്ലുകളുമായി താരതമ്യം ചെയ്യുമ്പോൾ മൈറ്റോകോണ്ട്രിയൽ ശൃംഖല (ചിത്രം, 2A, B). ഈ കോശങ്ങളിലെ മൈറ്റോകോണ്ട്രിയയുടെ രൂപവൽക്കരണം, മൈറ്റോകോണ്ട്രിയയിലെ മൈറ്റോകോണ്ട്രിയയിൽ നിന്നുണ്ടായ ആകർഷണീയതയാണ്. മൈറ്റോകോൺട്രിറിയൽ വിഘടകം മൂലകമാണ് (ചിത്രം ചിത്രം). ഈ ഫലകം mitochondrial fission ആൻഡ് fusion നില നേരിട്ട് സെല്ലിൽ Nrf1 നിലകളോട് പ്രതികരിക്കുന്നതെന്ന് മനസിലാക്കുന്ന ആശയം ഉയർത്തി. എന്നിരുന്നാലും, മറ്റ് Nrf1 സ്റ്റെബിലൈസറുകൾക്കും സെല്ലുകൾ പ്രോമിസോം ഇൻഹൈടൈറ്റർ MG1, പ്രോ-ഓക്സീഡിന്റ് TBHQ, അല്ലെങ്കിൽ Nrf2 ഇൻഹിനിറ്റർ കെഎപിഎക്സ്എക്സ്എക്സ്എക്സ് എന്ന നോക്ക്ഡൗണും മൈറ്റോകോണ്ട്രിയൽ ഫ്യൂഷൻ (ചിത്രം, 2A, B) ഉൾപ്പെടുത്തിയില്ല. എൻറോഫ്എൻഎൻഎൻഎക്സ്എക്സ്എക്സ്എക്സ്എക്സ്എക്സ്എൻഎക്സ്എക്സ്എക്സ് പാശ്ചാത്യപ്രയോഗത്തിലൂടെ ഈ എൻക്രിപ്ഷനുകൾ വഴി Nrf132 എന്ന സ്ഥിരത ഉറപ്പിക്കപ്പെട്ടു. Nrf2 (ചിത്രം 1C). ഇതിനുപുറമെ, SFN- ഇന്ധന മൈറ്റോകോണ്ട്റാരിയൽ ഫ്യൂഷൻ (NFF1) ഉപയോഗിച്ച് എൻറോഫ്നസ് എൻർഫ്എക്സ്എൻഎക്സ്എക്സ് എന്ന എൻക്യാഡൻഡിനെ siRNA ഉപയോഗിച്ച് പരാജയപ്പെടുത്തിയതിനാൽ Nrf2 എന്ന പ്രയോഗം അനുവദിക്കാതിരുന്നത് (ചിത്രം 2D-F). SFN കെഅപ്ക്സനുമ്ക്സ [ക്സനുമ്ക്സ] എന്ന മെത്തിയോണിൻ ശേഷിപ്പുകൾ ചൊവലെംത്ല്യ് മാറ്റം കെഅപ്ക്സനുമ്ക്സ-ംര്ഫ്ക്സനുമ്ക്സ-ആകുന്നു പാതയോരങ്ങൾ ഉത്തേജിപ്പിക്കുന്നു, ഞങ്ങൾ SFN വ്യതിയാനം മൈറ്റോകോൺട്രിയൽ ഹ്യ്പെര്ഫുസിഒന് ഒരു കെഅപ്ക്സനുമ്ക്സ-ആശ്രിത വഴി ഉത്തേജിതനായി എന്ന് അഭിസംബോധന കെഅപ്ക്സനുമ്ക്സ മറിഞ്ഞ് എന്നാൽ ംര്ഫ്ക്സനുമ്ക്സ സ്വതന്ത്ര ശിഷ്യത്വത്തിന്റെ. എന്നിരുന്നാലും, കെഎഎപിഎക്സ്എൻഎക്സ്എക്സിൻറെ അപദ്രവും എസ്.എഫ്.ഇ.-ഉദ്വമന മൈറ്റോകോണ്ട്രിയൽ ഫ്യൂഷൻ (ചിത്രം. 1G-I) റദ്ദാക്കാൻ പരാജയപ്പെട്ടു. വാസ്തവത്തിൽ, SFN, KEAP2 ന്റെ തകരാറിലായ പ്രോ-ഫൈഷൻ പദാർത്ഥത്തെ തിരുത്തി (ചിത്രം, 2G, പാനൽ ബ്യൂട്ട് പാനൽ ഡി). ഈ ഫലങ്ങൾ സൂചിപ്പിക്കുന്നത് SFN ചികിത്സ കാനോനിക്കൽ KEAP1-Nrf1- ന്റെ പാതയിലൂടെ സ്വതന്ത്രമായി മൈറ്റോകോണ്ട്രിയൽ ഫ്യൂഷൻ ഉണ്ടാക്കുന്നു എന്ന് മാത്രമല്ല, mitochondrial fission അല്ലെങ്കിൽ fusion യന്ത്രങ്ങളുടെ ഘടകങ്ങളെ SFN നേരിട്ട് ബാധിക്കുമോ എന്ന് ചോദ്യം ചെയ്യാൻ നമ്മെ പ്രേരിപ്പിച്ചു.

ചിത്രം 1 SFN Nrf2 / KEAP1- സ്വതന്ത്ര മൈറ്റോകോണ്ട്റാരിയൽ സംയോജനം നൽകുന്നു. (എ) RPE-1 സെല്ലുകൾ സൂചിപ്പിച്ച siRNA- കൾ ഉപയോഗിച്ച് ട്രാൻസ്ഫോർഡ് ചെയ്തു, കൂടാതെ DNSO അല്ലെങ്കിൽ NFF3 ആക്റ്റേറ്റർമാർ SFN (2 μM), MG50 (132 മമ്മീ), അല്ലെങ്കിൽ TBHQ (10 μM) 100 മണിക്കൂർ വേണ്ടി ചികിത്സിക്കുകയും ചെയ്തു. മൈറ്റോകോണ്ട്രിയ (ചുവപ്പ്) ഒരു ടോമിക്സ് ആന്റി-ആന്റിബോഡി ലേബൽ ചെയ്തിരിക്കുന്നു, അണുകേന്ദ്രം (നീല) DAPI മായി പ്രതിബന്ധം ഉള്ളവയാണ്. (ബി) (എ) യിൽ നിന്നുള്ള മൈറ്റോകോൺഡിയൽ മോർഫോളജി സ്കോറിംഗ് അളവ് കാണിക്കുന്ന ഗ്രാഫ്. > ഒരു അവസ്ഥയായുള്ള 4 സെല്ലുകൾ അന്ധനായ ഒരു ഫാഷനിൽ വിലയിരുത്തപ്പെട്ടു. (സി) പ്രതിനിധിയുടെ പടിഞ്ഞാറൻ ഭാഗങ്ങൾ (എ). (ഡി) RPE-20 സെല്ലുകൾ 50 nM siRNA നും 1 ദിവസങ്ങൾക്കു ശേഷം (എ) നിശ്ചിത സമയത്തിന് മുമ്പായി 10 മണിക്കൂർ SFN നും ചികിത്സിക്കുകയും ചെയ്തു. (ഇ) (എം) ൽ നിന്ന് മൈോമോചോന്ദ്റിയൽ ഫിനോറ്റിപ് സ്കോറിംഗ് അളവ് കാണിക്കുന്ന ഗ്രാഫ്. > ഒരു അവസ്ഥയായുള്ള 3 സെല്ലുകൾ അന്ധനായ ഒരു ഫാഷനിൽ വിലയിരുത്തപ്പെട്ടു. (എഫ്) പ്രതിനിധി പടിഞ്ഞാറൻ ബ്ലോക്കുകൾ (ഡി). (ജി) സെല്ലുകൾ ട്രാൻസ്ഫർ ചെയ്തു, (ഡി) siCON അല്ലെങ്കിൽ siKEAP4 ഉപയോഗിച്ചാണ് കൈകാര്യം ചെയ്തത്. (എച്ച്) സെൽ (ജി) മുതൽ സെൽ (ബി), (ഇ) മുതലായവ മൈറ്റ് ടോണ്ടിയൽ മോർഫോളജി അടിസ്ഥാനമാക്കി. (I) പ്രതിനിധി പടിഞ്ഞാറൻ ബ്ലോക്കുകൾ (ജി). (ബി), (ഇ), (എച്ച്) എന്നിവയിലെ ഡാറ്റ ഓരോ നൂതന പരീക്ഷണങ്ങളിൽ നിന്നും സമാഹരിച്ചതാണ്, കൂടാതെ സ്റ്റാറ്റിസ്റ്റിക്കൽ പ്രാധാന്യം രണ്ടു-ടെയിൽ വിദ്യാർത്ഥിയുടെ ടി-ടെസ്റ്റ് നിർണ്ണയിപ്പിച്ചു. പിശക് ബാറുകൾ പ്രതിഫലിപ്പിക്കുന്നത് +/- SD (ഈ ചിത്രം ലെജൻഡിൽ വർണ്ണത്തെ പരാമർശിക്കുന്നതിന്റെ വ്യാഖ്യാനത്തിനായി വായനക്കാരൻ ഈ ലേഖനത്തിന്റെ വെബ് വേർഷനായി പരാമർശിക്കുന്നു).

സുൽഫോരോഫെയ്ൻ അപകടം കാരണം മൈറ്റോകോണ്ട്രിയൽ അസോസിയേഷൻ Drp1

SFN- ചികിത്സ മൈറ്റ് ടോണ്ടിയൽ ഹൈപ്പർഫ്യൂഷനെ ഉദ്ദീപിപ്പിക്കുമെന്ന് കണ്ടെത്തിയതിനെ അടിസ്ഥാനപ്പെടുത്തിയുള്ളതിനാൽ, ഈ പ്രകടനം ഒന്നുകിൽ അമിതമായ ഫ്യൂഷൻ പ്രവർത്തനത്തിന്റെ ഫലമോ അല്ലെങ്കിൽ ഉത്തേജക പ്രവർത്തനങ്ങളുടെ തടസ്സമോ ആയിരുന്നെന്ന് ഞങ്ങൾ വിശദീകരിച്ചു. ഈ രണ്ടു സാധ്യതകൾ തമ്മിലുള്ള വിവേചനത്തിന്, SFN ന്റെ സാന്നിധ്യത്തിലും അഭാവത്തിലും പെറോക്സിസ്മോമുകളുടെ രൂപവത്കരണത്തെ ഞങ്ങൾ താരതമ്യപ്പെടുത്തി. മൈറ്റോകോണ്ട്രിയയ്ക്ക് സമാനമാണ് പെറോക്സിസോമുകൾ. ചലനാത്മക അവയവങ്ങളുടെ ആകൃതിയും നീളവും നിരന്തരം [JNUMX] ആയിരിക്കും. പെക്പോസിസോമുകളിൽ FIS44 ഉം MFF ഉം അവയുടെ പുറം പാളികളിൽ അടങ്ങിയിട്ടുണ്ട്, അതിന്റെ ഫലമായി, Drp1- മധ്യസ്ഥിത വലയത്തിനുള്ള [1], [22] ലക്ഷ്യം. എന്നിരുന്നാലും, പെറോക്സിസോம்கள் മൈറ്റ്ചോണ്ട്രൽ ശൃംഖലയുടെ ഫ്യൂഷൻ യന്ത്രത്തെ പ്രയോജനപ്പെടുത്തുന്നുമില്ല, അതിനാൽ, കോശങ്ങൾ നശിക്കുന്നു [23]. പകരം, പെറോക്സിസോമോസിന്റെ ദീർഘവീക്ഷണത്തോടൊപ്പം സ്കോറോസ് പ്രോട്ടീനുകൾക്കും പ്രോട്ടീനുകൾക്കും പുറമേ, പെറോക്സൈസോമൽ വിഘടനം എതിർക്കുന്നു. പെൻസോസോമുകളിൽ Mfn39 / 44 ഉം OPAXNUM ഉം കുറവുള്ളതിനാൽ, FF യന്ത്രത്തെ തടയുന്നതിനേക്കാൾ SFN ഫ്യൂഷൻ യന്ത്രത്തെ സജീവമാക്കുന്നുവെങ്കിൽ, പെറോക്സിസോം ദൈർഘ്യം ബാധിക്കില്ല. വാഹകരെ ചികിത്സിക്കുന്ന സെല്ലുകളിൽ പെറോക്സിസോമുകൾ ഹ്രസ്വ, റൗണ്ട്, പാൻഡിഫോം ഓർഗെനുകൾ (ചിത്രം 1, പാനലുകൾ ബി, ഡി) ആയി സൂക്ഷിക്കുന്നു. എന്നിരുന്നാലും SFN ചികിത്സ നിയന്ത്രിക്കുന്ന സെല്ലുകളെ അപേക്ഷിച്ച് ~ 2- മടങ്ങ് പെരോക്സിസോം ദൈർഘ്യം വർദ്ധിപ്പിച്ചു (ചിത്രം, 1, പാനലുകൾ എഫ്, എച്ച്). കൂടാതെ, നിരവധി പെറോക്സിസോമുകൾ കേന്ദ്രത്തിനു സമീപം നുണഞ്ഞിരുന്നു, ഇത് സാധ്യതയുള്ള സ്പിഷൻ ഡിസ്പ്ലേ (ചിത്രം 2, പാനൽ എച്ച്, അമ്പടയാളങ്ങൾ) സൂചിപ്പിക്കുന്നു. അതുപോലെതന്നെ, കോശങ്ങളിലെ പെറോക്സിസോമുകൾ അപര്യാപ്തമായി നീണ്ടുനിൽക്കുന്നതാണ് (ചിത്രം 2, പാനലുകൾ ജെ, എൽ), പെറോക്സൈസോമൽ വിഘടനത്തിന് Drp2 ആവശ്യമാണ്, എസ്.എഫ്.എൻ-ചികിത്സ മൈറ്റോകോൺട്രിറിയൽ ആൻഡ് പെറോക്സിസ്മോമൽ ഫിനോട്ടിപ്പുകൾക്ക് അണുവിഭജന സംവിധാനത്തെ തടസപ്പെടുത്തുന്നുവെന്നും നിർദേശിക്കുന്നു.

ചിത്രം 2 SFN, പെലോക്സൈസോമൽ നീണ്ട് നിർത്തുന്നു. (എ) RPE- 1 സെല്ലുകൾ സൂചിപ്പിക്കപ്പെട്ട siRNA ന്റെ 10 nM- നും 3 ദിവസങ്ങൾക്കു ശേഷം DMSO അല്ലെങ്കിൽ 50 μM SFN നും 4 h നും ചികിത്സിക്കാം. പെറോക്സിസോമുകൾ (പച്ച) ഒരു പിഎംഎക്സ്എക്സ്എക്സ്എക്സ്എക്സ് ആൻറിബോഡി, മൈറ്റോകോണ്ട്രിയ മൈടോ ട്രാക്കർ (ചുവപ്പ്), ഡി.എൻ.എ. SFN, Drp70 ഡിപ്രെഷൻ എന്നിവയിൽ ഉണ്ടാകുന്ന രൂപമാറ്റങ്ങളുടെ ദൃശ്യവൽക്കരണം സുഗമമാക്കുന്നതിനായി വലതുഭാഗത്ത് (പാനലുകൾ d, h, l) പെറോക്സിസോമെസിന്റെ വിപുലീകൃത ഇൻസെറ്റുകൾ കാണിക്കുന്നു. അമ്പടയാളങ്ങൾ ഹൈലൈറ്റ് കൺസ്ട്രക്ഷൻ പോയിന്റുകൾ ഹൈലൈറ്റ് ചെയ്യുന്നു. (ഈ ഐതിഹാസത്തിൽ നിറം സൂചിപ്പിക്കുന്ന വ്യാഖ്യാനങ്ങളുടെ വ്യാഖ്യാനത്തിനായി വായനക്കാരനെ ഈ ലേഖനത്തിന്റെ വെബ് വേർഷനായി പരാമർശിക്കുന്നു).

SFN എങ്ങനെയാണ് Drp1 ഫംഗ്ഷൻ നിയന്ത്രിക്കുന്നത് എന്ന് ഞങ്ങൾ അടുത്തതായി നിശ്ചയിച്ചു. സാധ്യതകൾ സൂചികയിൽ കുറവുണ്ടാകൽ, മൈറ്റോകോണ്ട്രിയയിലെ റിക്രൂട്ട്മെന്റ് / നിലനിർത്തൽ, ഒളിഗോമറൈസേഷൻ അല്ലെങ്കിൽ ജിടിപിസിയുടെ എൻസൈം പ്രവർത്തനം തുടങ്ങിയവ ഉൾപ്പെടുന്നു. ഇവയിൽ ഒരെണ്ണത്തിലോ ഉണ്ടാകുന്ന കുറവ് മൈറ്റോകോണ്ട്രിയൽ പിളിക്കലും ഹൈപ്പർഫ്യൂഷനും കുറയ്ക്കും. SFN ചികിത്സ (അത്തിപ്പഴം, 1C, 1A) ശേഷം DrpxNUMX പ്രോട്ടീൻ തലങ്ങളിൽ പുനരുൽപാദിപ്പിക്കുന്ന മാറ്റങ്ങൾ കണ്ടെത്താനായില്ല, അതിനാൽ SFN, Drp3 സ്ഥിരത അല്ലെങ്കിൽ എക്സ്പ്രഷനെ മാറ്റാൻ തയ്യാറായില്ല, ഞങ്ങളുടെ എസ്എഫ്എൻ ചികിത്സാരീതികൾ ചെറിയ കാലദൈർഘ്യമുള്ളതാണ്. അടുത്തതായി, എസ്.എഫ്.എൻ. എംപ്ലോൻട്രിയയിലേക്കുള്ള ഡ്രാഫ്റ്റ് 1 ന്റെ റിക്രൂട്ട്മെന്റ് അല്ലെങ്കിൽ നിലനിർത്തൽ ബാധിച്ചോ എന്ന് ഞങ്ങൾ അന്വേഷിച്ചു. Fractionation studies SFN mitochondrial അംശം (ചിത്രം, 1A, പാതകൾ, 10- 50, ചിത്രം, 1B) മുതൽ Drp1 നഷ്ടം ഉണ്ടാക്കി. മുൻപ് [3] റിപ്പോർട്ട് ചെയ്ത സൈറ്റോപ്ലാസ്മിലെ മിക്ക എൻസൈമുകളോടും സ്ഥിരസ്ഥിതി അവസ്ഥയിൽ മൈറ്റോകോണ്ട്രിയൽ നെറ്റ്വർക്കിന് (~ 7%) ഒരു ചെറിയ ഭാഗം മാത്രം ബന്ധപ്പെട്ടിരിക്കുന്നു. (ചിത്രം, ചൊവ്വാഴ്ച്ച, 8- 3 ). ഈ ഫ്രാബേസേഷൻ ഡാറ്റകൾ സഹ-ലോക്കലൈസേഷൻ വിശകലനം ഉപയോഗിച്ച് സ്ഥിരീകരിച്ചു, ഇത് എസ്.ടി.എൻ-ചികിത്സയ്ക്കു ശേഷം മൈടോൺചോണ്ട്ര-ലോക്കലൈസേഷൻ, പിങ്ക്റ്റേറ്റ് Drp43 foci (~ 1C, D) ശേഷം ~ 3% കുറവ് കാണിക്കുന്നു. ഈ കണക്കുകൾ സൂചിപ്പിക്കുന്നത് SFN പ്രേരണയായ mitochondrial ഫ്യൂഷൻ കുറഞ്ഞത് ഭാഗികമായെങ്കിലും, മൈറ്റോകോണ്ട്രിയയിലെ Drp3 ന്റെ attenuated association കാരണം. തൽസമയ സെൽ മൈക്രോസ്കോപി വഴി GTPase ദൃശ്യവത്ക്കരിക്കാനുള്ള എക്സോഗൻസസ് DRP5 അപര്യാപ്തമായതിനാൽ, SFN മൈറ്റോകോണ്ട്രൽ റിക്രൂട്ട്മെന്റും മൈറ്റോകോണ്ട്രിയൽ റിക്രൂട്ട്മെന്റിനും മൈറ്റോകോണ്ട്രൽ റിക്രൂട്ട്മെന്റിനും മൈറ്റോകോൺഡിരിയൽ നിലനിർത്തണോ എന്നതിനെക്കുറിച്ചും ഞങ്ങളുടെ ഡാറ്റ തിരിച്ചറിയുന്നില്ല.

ചിത്രം 3 SFN mitochondria നിന്ന് Drp1 ഒരു നഷ്ടം കാരണമാകുന്നു. (എ) DMSO അല്ലെങ്കിൽ SFN ന്റെ 1 h താഴെ പറയുന്ന RPE-4 സെല്ലുകളുടെ സബ്സില്ലൂൾ ശൃംഖല. പൂർണ്ണ-സെൽ lysates (WCL), ആണവ (Nuc), സൈറ്റോസോളിക് (സൈറ്റോ), ഒപ്പം ക്രൂഡ് മൈറ്റോക്രൊൻഡ്യൽ (മിറ്റോ) ഘടകങ്ങൾ SDS-PAGE വഴി പരിഹരിച്ചിരിക്കുന്നു, കൂടാതെ സൂചിപ്പിക്കപ്പെട്ട ആന്റിബോഡികളുമായി പാശ്ചാത്യ blotting പ്രോസസ്സ് ചെയ്തു. മോളിക്യുലാർ വെയ്റ്റ് മാർക്കറുകളുടെ മൈഗ്രേഷൻ ഇടതുവശത്ത് സൂചിപ്പിക്കുന്നു. (ബി) (എ) നിന്നുള്ള നിർദിഷ്ട ഘടകങ്ങളിൽ Drp1 densitometric അളവ് കാണിക്കുന്ന ഗ്രാഫുകൾ. (സി) RPE-1 സെല്ലുകൾ 10 nM siCON അല്ലെങ്കിൽ siDrp1, 3 ദിവസങ്ങൾക്ക് ശേഷം DMSO അല്ലെങ്കിൽ SFN ഉപയോഗിച്ച് 4 h വരെ ചികിത്സിച്ചു. Drp1 (പച്ച) ഒരു anti-Drp1 ആൻറിബോഡി, മൈടോട്രാക്കർ ഉപയോഗിച്ച് മൈറ്റോകോണ്ട്രിയ (ചുവപ്പ്), ഒപ്പം DAPI (നീല) ഉള്ള അണുകേന്ദ്രങ്ങളോടൊത്ത് ദൃശ്യമായിരുന്നു. (ഡി) (D) മുതൽ Drp1, MitoTracker സിഗ്നലിന്റെ ഓട്ടോമാറ്റിക് കോ-ലോക്കൽ വ്യാഖ്യാന വിശകലനം. (ബി), (ഡി) എന്നിവയിലെ ഡാറ്റ യഥാക്രമം, 3, 5 സ്വതന്ത്ര പരീക്ഷണങ്ങളിൽ നിന്നും സമാഹരിച്ചതാണ്, കൂടാതെ രണ്ട് തരത്തിലുള്ള വിദ്യാർത്ഥികളുടെ ടി-ടെസ്റ്റ് കണക്കുകൂട്ടുന്നു. പിശക് ബാറുകൾ +/- എസ്ഡികളും ആസ്റ്ററിക്സുകളും പ്രതിഫലിപ്പിക്കുന്നത് സ്റ്റാറ്റിസ്റ്റിക്കൽ പ്രാധാന്യത്തെ സൂചിപ്പിക്കുന്നു. (ഈ ഐതിഹാസത്തിൽ നിറം സൂചിപ്പിക്കുന്ന വ്യാഖ്യാനങ്ങളുടെ വ്യാഖ്യാനത്തിനായി വായനക്കാരനെ ഈ ലേഖനത്തിന്റെ വെബ് വേർഷനായി പരാമർശിക്കുന്നു).

സുൽഫോരോപ്പനെ കോൺഫെൻസ് പ്രൊട്ടക്ഷൻ എസ്റ്റാത്ത് സ്റ്റെറോസ്പോർടിൻ-ഇൻഡുഡ് അപ്പോപ്പോട്ടസിസ് ഇൻഡിപെൻഡന്റ് ഓഫ് എൻഫ്രക്സ്എക്സ്എക്സ്എക്സ്

അപ്പൂപ്പൊസിസ് [11] സമയത്ത് ബക്സസ് / ബാകിന്റെ ഉൽപാദിപ്പിക്കുന്ന പുറം മൈറ്റോകോണ്ട്രൽ മെംബറേൻസിലെ സോർ രൂപീകരണത്തിൽ മൈറ്റോകോണ്ട്രിയൽ പിളർപ്പ് അനുവദനീയമാണെന്ന് മുൻപ് പറഞ്ഞിരുന്നു. അപ്പ്റ്റോസിസ് [1] സമയത്ത് മൈറ്റോകോണ്ട്രിയയിലേക്ക് തിരഞ്ഞെടുക്കാനായി Drp11 കണ്ടെത്തിയിട്ടുണ്ട്, കൂടാതെ, ഇതുമായി പൊരുത്തപ്പെടുന്ന മൈമോൺഡോണ്ടരിയ പ്രക്രിയയുടെ ആരംഭത്തിൽ [27] നിരീക്ഷിക്കപ്പെട്ടിട്ടുണ്ട്. വിപരീതമായി, സൈനോക്രോം സി റിലീസിന് [53] അനുവദിക്കുന്ന പുറം മെംബ്രെൻ പോറകളുടെ രൂപീകരണം തടഞ്ഞുകൊണ്ട് അയോപോട്ടോസിസിനെ തടയുകയെന്നത് മൈറ്റ് ടോണ്ടിയൽ വിഘേഷണത്തെ തടയുന്നു എന്നാണ്. അതനുസരിച്ച്, മൈോട്ടൊകോണ്ട്രൽ ഫ്യൂഷൻ ഉത്തേജിപ്പിക്കൽ അപ്പാർട്ടൊസിസിന്റെ പുരോഗതിയിൽ സ്റ്റോറസ്പോർൻ (STS) [14] ഉൾപ്പെടെയുള്ള സംയുക്തങ്ങളിലൂടെ ഉണ്ടാകുന്നതാണ്. എസ്.റ്റി.എൻ.-മധ്യേയുള്ള അപ്പോപ്പോസിസിൻറെ SFN RPE-1 സെല്ലുകളെ സംരക്ഷിക്കണമോ എന്ന് നിർണ്ണയിക്കണമെങ്കിൽ, ഇത് Nrf2 ആവശ്യമാണോ എന്ന് വ്യക്തമാക്കുന്നത്, പോളി എ.ഡി.പി. ആർഗോ പോളിഷ്മെയ്സ് (PARP) cleavage, സജീവമായ caspase-3 ന്റെ അടിവര അപ്പോത്തോസിസ്. 1 μM ക്ക് 1 μM STS ഉള്ള RPE-6 സെല്ലുകളുടെ ചികിത്സ മാത്രമേ PARP- ന്റെ വളരെ ലളിതമായ വിടവുകൾക്ക് കാരണമാകുകയുള്ളൂ, ഇതു SFN കോ-ട്രീറ്റ്മെന്റ് വഴി തടഞ്ഞു (ഉദാഹരണത്തിന്, ചിത്രം, 4A, LINE 3, 4). ഈ ഘടനയുടെ കരുത്തുറ്റത വർദ്ധിപ്പിക്കുന്നതിനായി, എസ്.റ്റി.എസ്.ഡബ്ല്യുഡി അപ്പോപ്പോസിസിനു കൂടുതൽ സെല്ലുകൾ കോർണറൈസ് ചെയ്തു, അക്പ്പോട്ടോട്ടിക് ഘടകം, Bcl-XL ലക്ഷ്യം വച്ചുകൊണ്ടുള്ള siRNA കൊണ്ട് അവരെ ചികിത്സിക്കുന്നതിനു മുൻപ്. ഈ പ്രീട്രീറ്റ് Bcl-XL എന്ന പ്രക്രീയ കുറച്ചു, കൂടാതെ എസ്.റ്റി.സുമായി പരിചിതമായ സമയമായി PARP cleavage എന്നതിനെ പ്രോത്സാഹിപ്പിക്കുകയും ചെയ്തു (ചിത്രം, 4B, 2 പാത വരെ 4 മുതൽ 10 വരെ). പ്രധാനമായും, എസ്.എഫ്.എൻ. വിഘടിപ്പിച്ച സെല്ലുകളിലെ എസ്.എഫ്.എൻ. അതുപോലെ, CRISPR / Cas2 ൻറെ NFf4 ൻറെ കോശങ്ങൾ, SFN പ്രി- ചികിത്സയിലൂടെ എസ്.റ്റി.എൻ. നൈട്രേറ്റിൽ നിന്നും താരതമ്യേന പരിരക്ഷിക്കപ്പെട്ടിരിക്കുന്നു (ചിത്രം, 3, Lane 4, 5, Lane XXX, 6, ചിത്രം, 2D). ഈ സംരക്ഷണം പാരാപ് ക്ളേവേജും (ചിത്രം 9C ഉം D ഉം) സെല്ലുലാർ മോർഫോളജി (ചിത്രം 4E) ഉപയോഗിച്ച് വായനങ്ങളായി ഉപയോഗിച്ചു. CRISPR / Cas11 ഉപയോഗിച്ച് Nrf12 depletion ഫലപ്രാപ്തി പടിഞ്ഞാറൻ ചിരട്ടകൊണ്ട് (ചിത്രം 13C, Nrf14 blot) സ്ഥിരീകരിച്ചു. മുൻകൂട്ടിപ്പറഞ്ഞതുപോലെ, DRP4 ന്റെ സെല്ലുകൾ കുറയുന്നു, ഇത് ഒരു ഹൈപ്പർഫ്യൂഷൻ ഫൈനാറ്റെൈപ്പ് (ചിത്രം. 4A), കൂടാതെ എസ്.റ്റി.എൻ. (എസ്എക്സ്എൻഎഫ്, ജി തുടങ്ങിയവ) ഇൻകുബേറ്റഡ് നിയന്ത്രണ സെല്ലുകളെ അപേക്ഷിച്ച് എസ്.റ്റി.എസ്. ഈ കണ്ടെത്തലുകൾ, SFN- യുടെ അപര്യാപ്തതയിൽ, NRF4- ന്റെ സ്ഥിരതയ്ക്കും സജീവമാക്കുന്നതിനുമായി, അപര്യാപ്തതയായ Drp2 ഫംഗ്ഷൻ നിയന്ത്രിക്കാനുള്ള ശേഷി നൽകിക്കൊണ്ട് നിലകൊള്ളുന്നു.

വേണ്ടി ദ്മ്സൊ, ക്സനുമ്ക്സ ധൂളികൾ സ്തൌരൊസ്പൊരിനെ (എസ്.റ്റി.എസ്), അല്ലെങ്കിൽ ക്സനുമ്ക്സ ധൂളികൾ എതൊപൊസിദെ കൂടെ ചിത്രം ക്സനുമ്ക്സ SFN എന്ന ച്യ്തൊപ്രൊതെച്തിവെ ഇഫക്റ്റുകൾ ംര്ഫ്ക്സനുമ്ക്സ പദപ്രയോഗം വിഭിന്നമാണ് (എ) ര്പെ-ക്സനുമ്ക്സ കോശങ്ങൾ ചെയ്തു ദ്മ്സൊ അല്ലെങ്കിൽ ക്സനുമ്ക്സ ധൂളികൾ SFN കൂടെ ക്സനുമ്ക്സ പ്രതി പ്രീ-ചികിത്സ മുൻകൂർ ചികിത്സ എൺപതുകളിലെ എച്ച്. ആന്റി PARP പി.ഡബ്ല്യു.പി പാശ്ചാത്യ തട്ടിപ്പിന് വേണ്ടി പ്രോസസ് ചെയ്തു. (ബി) RPE-1 കളങ്ങൾ 2.5 nM siCON, 1 nM siBcl-XL, അല്ലെങ്കിൽ 2.5 nM siBcl-XL, കൂടാതെ 3, 1, അല്ലെങ്കിൽ 2 നും DMSO അല്ലെങ്കിൽ 4 μM STS മായി ചികിത്സിച്ചു. സംയുക്ത പാശ്ചാത്യ ചേരുവകൾ കാണിക്കുന്നു, കൂടാതെ മോളിക്യുലാർ വെയ്റ്റ് മാർക്കറുകളുടെ മൈഗ്രേഷൻ ഇടതുവശത്ത് സൂചിപ്പിക്കുന്നു. (സി) ച്രിസ്പ്ര് / ചസ്ക്സനുമ്ക്സ-സൃഷ്ടിച്ച കാട്ടു-തരം (ംര്ഫ്ക്സനുമ്ക്സവ്ത്) ഉം ംര്ഫ്ക്സനുമ്ക്സ നോക്കൗട്ട് (ംര്ഫ്ക്സനുമ്ക്സകൊ) ര്പെ-ക്സനുമ്ക്സ കോശങ്ങൾ ക്സനുമ്ക്സ NM സിബ്ച്ല്-എക്സ് ആൻഡ് ക്സനുമ്ക്സ ദിവസങ്ങൾക്ക് ശേഷം ക്സനുമ്ക്സ പ്രതി ദ്മ്സൊ അല്ലെങ്കിൽ ക്സനുമ്ക്സ ധൂളികൾ SFN പ്രീ-ചികിത്സ ചെയ്തു ത്രംസ്ഫെച്തെദ് ചെയ്തു. പിന്നീട്, കോശങ്ങൾ 6, 9, അല്ലെങ്കിൽ 2 ക്കായി 2 μM STS ഉപയോഗിച്ച് പരിഗണിച്ചിരുന്നു. സൂചിപ്പിക്കപ്പെട്ട ആന്റിബോഡികളുടെ പ്രതിനിധി പടിഞ്ഞാറൻ ഭാഗങ്ങൾ കാണിക്കുന്നു. (D) 2 സ്വതന്ത്ര പരീക്ഷണങ്ങളിൽ നിന്നുള്ള മൊത്തം PARP (ക്ലെയിം + മാൻവെവേഡ്) ഒരു ശതമാനമായി പിരിപി കുറഞ്ഞ അളവ്. പ്രധാനമായും, ക്ലോവ്ഡ് PARP ന്റെ അളവ് സെല്ലുകൾ Nrf1 സൂചിപ്പിച്ചിട്ടുണ്ടോ ഇല്ലയോ, STS ൽ നിന്നും SFN സംരക്ഷണം ട്രാൻസ്ക്രിപ്ഷൻ ഘടകം സ്വതന്ത്രമാണെന്ന് സൂചിപ്പിക്കുന്നു. (ഇ) X (C) ൽ നിന്നുള്ള ലൈസറുകളുടെ വിളവെടുപ്പിനു മുമ്പായി 1 ഘട്ടം ദൃശ്യതീവ്രത എടുക്കുന്നു. സ്കെയിൽ ബാർ = 3 μm. (എഫ്) SFN ചികിത്സയായി എസ്.റ്റി.എസിൽ നിന്നും അടുത്തു-താരതമ്യപ്പെടുത്താവുന്ന സംരക്ഷണത്തെ Drp50 കുറയ്ക്കുന്നതിന് പ്രതിനിധി ചെയ്യുന്ന പടിഞ്ഞാറൻ ഭാഗിക്കലുകൾ. RPE-2 സെല്ലുകൾ 1 nM siBcl-XL ഉപയോഗിച്ച് ട്രാൻസ്ഫോർഡുചെയ്യുന്നു, കൂടാതെ ഇത് 2 nM siCON അല്ലെങ്കിൽ 4 nM siDrp6 ഉപയോഗിച്ച് ട്രാൻസ്ഫോർഡുചെയ്യുന്നു. എൺപത് ദിവസം കഴിഞ്ഞ്, സികോൺ സെല്ലുകൾ (എ), (സി) എന്നിവയിൽ എസ്.എഫ്.നിക്കുള്ള മുൻകരുതലുകൾ നൽകി, അതിനുശേഷം ആൻറിബോഡികളുമായി പാശ്ചാത്യപ്രസരണത്തിന് വിളവെടുക്കാനും പ്രോസസ്സ് ചെയ്യാനും എസ്ടിഎസ്എൻഎൻ എസ്ടിഎസിന് വിധേയമായി. (ജി) 3 സ്വതന്ത്ര പരീക്ഷണങ്ങളിൽ നിന്ന് സമാഹരിച്ച ഡാറ്റ (ഡി) പോലെ (ഡി) പോലെ. പിശക് ബാറുകൾ +/- SEM പ്രതിഫലിപ്പിക്കുന്നു


KEAP1-Nrf2-Pathway- ൽ ഫലങ്ങളിൽ നിന്നും സ്വതന്ത്രമായി mitochondrial fission / fusion dynamics- നെ SFN മോഡുലേറ്റ് ചെയ്യിക്കുന്നുവെന്ന് ഞങ്ങൾ കണ്ടെത്തി. Mitochondrial Dysfunction and ROS ഉൽപ്പാദനം എന്നിവ തമ്മിലുള്ള ഒരു നിശ്ചിത ബന്ധവും മൈറ്റോചോണ്ട്രയിൽ നിന്നുണ്ടായ ഫ്രീ റാഡിക്കലുകളെ Nrf2 വഴി സജീവമാക്കുന്നതിലൂടെയും ഇത് സങ്കീർണ്ണമായതാണ്. പ്രോസ്റ്റേറ്റ് ക്യാൻസർ, അൾട്രാസ്റ്റീവ് പൾമണറി രോഗം, അരിവാൾ കോശ രോഗം [30], [7], [10], [47], എന്നിവ ഉൾപ്പെടെ വിവിധ തരത്തിലുള്ള രോഗങ്ങളുടെ ചികിത്സയ്ക്കായി നിലവിൽ SFN- യുടെ പരീക്ഷണഫലമായ XNUMX ക്ലിനിക്കൽ പരീക്ഷണങ്ങൾക്ക് SFN- ന്റെ ഈ അധിക പ്രവർത്തന ഫലപ്രാപ്തി പ്രധാന ഘടകമാണ്. XNUMX].

Because SFN is an isothiocyanate [56] and it activates Nrf2 signaling by directly acylating critical KEAP1 cysteines to suppress Nrf2 degradation [21], it follows that SFN exerts its pro-fusion effects by modulating the activity of a fission or fusion factor via cysteine modification. Our data strongly support Drp1 being negatively regulated by SFN although whether the GTPase is a direct target of acylation remains to be elucidated. Despite this knowledge gap, the function of Drp1 is clearly being compromised by SFN as both mitochondria and peroxisomes become hyperfused in response to SFN treatment and these organelles share Drp1 for their respective scission events [38]. In addition, SFN decreases the amount of Drp1 that localizes and accumulates at mitochondria (Fig. 3). Because our experiments were done with all endogenous proteins, our detection of Drp1 at mitochondrial fission sites is under steady-state conditions, and consequently, we cannot distinguish between a recruitment versus a retention defect of the enzyme caused by SFN. Further, we cannot eliminate the possibility that SFN acylates a receptor at the mitochondria (Fis1 or Mff) to block Drp1 recruitment yet, we suspect that Drp1 is directly modified. Drp1 has nine cysteines, eight of which reside within the Middle Domain that is required for oligomerization [3], and one of which resides in the GTPase Effector Domain (GED) at the C-terminus of Drp1. Direct acylation of any of these cysteines could cause an activity defect in Drp1 and therefore underlie the effect of SFN on mitochondrial dynamics. Notably, prior work suggests that defects in oligomerization and catalytic activity can abrogate the retention of Drp1 at the mitochondria [52]. Cys644 in the GED domain is a particularly attractive target based on previous work showing that mutation of this cysteine phenocopies mutations that impair Drp1 GTPase activity [4] and that this particular cysteine is modified by thiol-reactive electrophiles [9]. Resolution of this outstanding question will require mass spectrometric validation.In summary, we have identified a novel, cytoprotective function for the clinically-relevant compound SFN. In addition to activating the master anti-oxidant transcription factor Nrf2, SFN promotes mitochondrial and peroxisomal fusion, and this effect is independent of Nrf2. The mechanism underlying this phenomenon involves a reduction in the function of the GTPase Drp1, the primary mediator of mitochondrial and peroxisomal fission. A major consequence of SFN-mediated mitochondrial fusion is that cells become resistant to the toxic effects of the apoptosis inducer staurosporine. This additional cytoprotective action of SFN could be of particular clinical utility in the numerous neurodegenerative diseases for which age is the leading risk factor (e.g., Parkinson’s Disease, Alzheimer’s Disease, Age-related Macular Degeneration) as these maladies have been associated with apoptosis and reduced levels and/or dysregulation of Nrf2 [35], [36], [48]. Together, these data demonstrate that the cytoprotective properties of SFN extend beyond activation of the KEAP1-Nrf2-ARE system and warrant further studies given the current use of this agent in multiple clinical trials.

വസ്തുക്കളും രീതികളും

അപ്പോപ്പോനോസിസ് അസൈസ്

താഴെ കാണിച്ചിരിക്കുന്നത് പോലെ കളങ്ങൾ സീഡ്എന്നിനൊപ്പം വിത്തുപോയിരുന്നു. മൈലോൺചോണ്ട്രൽ ഫ്യൂഷൻ കൊണ്ടുവരുന്നതിന് 50 μM സൾഫോഫോപനേനുമായി ഈ സെല്ലുകൾ മുന്കാല ചികിത്സ നൽകിയിരുന്നു, പിന്നീട് അപ്പോപോസിസിനെ പ്രോത്സാഹിപ്പിക്കാൻ 2 μM സ്റ്റോറൂറോപോരിൻ ഉപയോഗിച്ചു. വിളവെടുപ്പിനുശേഷം വ്യക്തിഗത ട്യൂബുകളിൽ ശേഖരിക്കപ്പെട്ടു. അപ്പൂപ്പൊട്ടിക് സെല്ലുകൾ പെല്ലറ്റുണ്ടാക്കാൻ ഹൈ സ്പീഡ് സെന്റ്രുഫിഗേഷൻ വിധേയമായി. ഈ സെൽ പെല്ലറ്റ് സഹജമായ സെല്ലുകളുമായി കൂടിച്ചേർന്ന് 1 തവണ കേന്ദ്രീകൃത Laemmli ബഫറിൽ സോല്യൂബിൽ ചെയ്തു. സാമ്പിളുകൾ PARP വിരുദ്ധ പാശ്ചാത്യപ്രയോഗത്തിന് വിധേയമാക്കി.

CRISPR / Cas9 കൺസ്ട്രക്ട് ജനറേഷൻ

LentiCRISPR / eCas9 സൃഷ്ടിക്കാൻ, LentiCRISPR V1.1 (ആഡ്ജെൻ #2) ആദ്യത്തേത് AXXXX ഉം BAMH52961 ഉം ആയിരുന്നു. അടുത്തതായി, താഴെപ്പറയുന്ന പ്രൈമറുകൾ (മുൻപത്തെ AGCGCACCGGTTCTAGAGCGCTGCCACCATGGACTATAAGGACCACGAC, റിവേഴ്സ് AAGCGCGGATCCCTTTTTCTTTTTTGCCTGGCCGG) എന്നിവയുപയോഗിച്ച് പിസിആർ, എക്സ്എക്സ്എക്സ്എക്സ്എക്സ്, ബിംഎക്സ്എക്സ്എക്സ്എക്സുകൾ എന്നിവ ഉപയോഗിച്ച് പിസിആർ കൂട്ടിച്ചേർത്തു, മുകളിലുള്ള കട്ട് വെക്റ്ററിലേക്ക് തരംതാഴ്ത്തുകയായിരുന്നു ഇ.എസ്.പി.സി. XXX (ADDGEN #1) മുതൽ SPCAS1. Benchling.com ഉപയോഗിച്ച് sgRNA ശ്രേണികളെ നിശ്ചയിച്ചിരുന്നു. കോഡിംഗ് സീക്വൻസിനു മുകളിലുള്ള ടാർഗെറ്റ് ഏറ്റവും കുറഞ്ഞ ടാർജറ്റ് സ്കോറുകളും, കുറഞ്ഞ സ്കോർ നേടിയ ടാർജറ്റുകളും കണക്കാക്കാനായി പരാമീറ്ററുകൾ സജ്ജമാക്കി. താഴെ സീക്വൻസുകൾ (അനുക്രമം ടാർഗെറ്റുചെയ്യൽ അണ്ടർലൈൻ എച്ച്എസ് സ്ഗ്ന്ഫെക്സനുമ്ക്സല്ക്സനുമ്ക്സ # ക്സനുമ്ക്സ അർത്ഥത്തിൽ ചച്ച്ഗ്ച്ഗച്ഗ്ഗഅഅഗഗ്തത്ഗഗ്ച്, അംതിസെംസെ അഅഅച്ഗ്ച്ത്ചതച്ത്ച്ത്ത്ത്ച്ച്ഗ്ത്ച്ഗ്ച്; എച്ച് സ്ഗ്ന്ഫെക്സനുമ്ക്സല്ക്സനുമ്ക്സ # ക്സനുമ്ക്സ അർത്ഥത്തിൽ ചച്ച്ഗ്ഗ്ത്ത്ത്ച്ത്ഗച്ത്ഗ്ഗത്ഗ്ത്ഗ്ച്ത്, അംതിസെംസെ അഅഅചഗ്ചചത്ച്ചഗ്ത്ചഗഅഅച്ച്; എച്ച് സ്ഗ്ന്ഫെക്സനുമ്ക്സല്ക്സനുമ്ക്സ # ക്സനുമ്ക്സ അർത്ഥത്തിൽ ചച്ച്ഗ്ഗഗ്തഗ്ത്ത്ഗ്ഗ്ചഗത്ച്ചച്, അംതിസെംസെ അഅഅച്ഗ്ത്ഗ്ഗത്ച്ത്ഗ്ച്ചഅച്തച്ത്ച്ച്) കടന്നു ബ്സ്ംബ്ക്സനുമ്ക്സ അംനെഅലെദ് ചെയ്ത് ലിഗതെദ് ചെയ്തു ലെംതിച്രിസ്പ്ര് / എചസ്ക്സനുമ്ക്സ ക്സനുമ്ക്സ മുറിച്ചു. ശ്വാസകോശ രോഗബാധയുള്ള RPE-9 സെല്ലുകൾ പൂമോമീസിനോടൊപ്പം തിരഞ്ഞെടുത്തു. ഇംപോൺഫുലോസോഴ്സ്സെൻസ്, പാശ്ചാത്യപ്രകടനത്താൽ നോക്കൗട്ട് സ്ഥിരീകരിച്ചു.

സെൽ കൾച്ചർ ആൻഡ് ട്രാൻസ്ഫൻഷൻസ്

തെലൊമെരസെ (ര്പെ-ക്സനുമ്ക്സ) (അത്ച്ച്) പരിവർത്തനം മാനവ റെറ്റിനയിലെ ചായക്കൂട്ട് എപിഥെലിഅല് കോശങ്ങൾ പെൻസിലിൻ, സ്ട്രെപ്റ്റോമൈസിൻ, ക്സനുമ്ക്സക്സ നോൺ-അമിനോ ആസിഡ് കോക്ടെയ്ൽ (ലൈഫ് ടെക്നോളജീസ്) ഉപയോഗിച്ച് അനുബന്ധമായ ക്സനുമ്ക്സ ഗ്രാം / എൽ ഗ്ലൂക്കോസ് അടങ്ങുന്ന ഡൽബെക്കോ ന്റെ പരിഷ്കരിച്ച ഈഗിൾ മീഡിയം (ദ്മെമ്) ൽ സംസ്ക്കരിച്ച ആയിരുന്നു, കൂടാതെ 1% ഗർഭസ്ഥ ശിശുവിന് (ലൈഫ് ടെക്നോളജി). SiRNA- ട്രാൻസ്ഫക്ഷനുകൾക്കായി, 1- 1 കളങ്ങൾ / എം.എൽ. സെല്ലുകൾ സെറം-ഫ്രീ ഡിഎംഎമെയിൽ ലയിപ്പിച്ച 10 nM siRNA ഉം ഇന്റർപ്രിൻ ട്രാൻസ്ഫീഷൻ റെജന്റ് (പോളി പ്ലുസ്) ഉം സംയോജിപ്പിച്ചിരിക്കുന്നു. Apoptosis സെൻസിറ്റൈസസിനായി, കോശങ്ങൾ 30,000 nM Bcl-XL siRNA ലഭിച്ചു. സെല്ലുകൾ പോസ്റ്റ്-ട്രാൻസ്ഫക്ഷന്റെ 35,000-XNUM ദിവസം വിളവെടുത്തു.

രാസവസ്തുക്കൾ, ആന്റിബോഡികൾ, സിറൺ ഒലിഗോസ്

α-തുബുലിന് (സെൽ സിഗ്നൽ), β-തുബുലിന് (സിഗ്മ), ദ്ര്പ്ക്സനുമ്ക്സ (ബി.ഡി. ബിഒസ്ചിഎന്ചെസ്), കെഅപ്ക്സനുമ്ക്സ (പ്രൊതെഇംതെഛ്), ലമിന് ബ്ക്സനുമ്ക്സ (അബ്ചമ്), പര്പ് (സെൽ സിഗ്നൽ), പ്ംപ്ക്സനുമ്ക്സ (അബ്ചമ്), ഒപ്പം തൊമ്ക്സനുമ്ക്സ (ബി.ഡി. ബിഒസ്ചിഎന്ചെസ് നേരെ ആന്റിബോഡികളുടെ ) പാശ്ചാത്യതൈലമർദ്ദത്തിനും immunofluorescence നു വേണ്ടി 1: 1 വിത്തുകൾ ഉപയോഗിച്ചു. ഇൻ-ഹൌസ്, ആന്റി- Nrf1 മുയൽ ആൻറിബോഡി, പടിഞ്ഞാറൻ കളഞ്ഞുകുളിക്കുള്ള [70], 20: 1 ൽ ഉപയോഗിച്ചു. സുൽഫോഫോഫെയ്ൻ (സിഗ്മ), സ്റ്റോർറോസ്പോരിൻ (ടോക്രിസ്) എന്നിവ യഥാക്രമം 1000 മമ്മിക്കും XMX μM ക്കുമായിരുന്നു. സൂചിപ്പിച്ചിരിക്കുന്നത് കൂടാതെ XXX nM- ൽ Drp2 (ധർമ്മകോൺ), Nrf1 (ധർമകോൺ), KEAP2000 (സെൽ സിഗ്നലിംഗ്), Bcl-XL (സെൽ സിഗ്നലിംഗ്) എന്നിവയ്ക്കെതിരായി siRNAs ഉപയോഗിച്ചു.

ഇമോൻഫുലൂസൻസ് ആൻഡ് വിവോ ലേബലിംഗ്

18 മില്ലീമീറ്റർ ഗ്ലാസ് കവർസ്ലിപ്സിൽ വിത്ത് സെല്ലുകൾ കാർഡുടമയോ മരുന്ന് ഉപയോഗിച്ചോ കണക്കാക്കിയത്, 3.7% ഫോർമാൽഡിഹൈഡിൽ നിശ്ചലമാക്കിയത്, അതിനുശേഷം 0.2% മഞ്ഞിൽ 100% Triton X-10 / PBS- ൽ പെർസെബിലിറ്റി ചെയ്തു. പ്രാഥമിക പ്രതിരോധ വസ്തുക്കൾ PBS ൽ 3% ബോവീൻ സീറം ആൽബത്തിൽ (ബി.എസ്.ഇ) ചുരുങ്ങിയത്, രാത്രി 10 ഡിഗ്രി സെൽഷ്യസിൽ. ക്സനുമ്ക്സ% ബ്സ / പിബിഎസ് ലും ക്സനുമ്ക്സ μഗ് / മില്ലി ദപി (സിഗ്മ): പിബിഎസ് ആയമാർ അംഗിതന്നെ ദ്വിതീയ ആന്റിബോഡികളുടെ (ക്സനുമ്ക്സ ആണയിടുമ്പോഴും ക്സനുമ്ക്സ) തുടർന്ന്, സെല്ലുകൾ ഇനം-ഉചിതമായ ൽ ക്സനുമ്ക്സ പ്രതി വിരിയിച്ചെടുത്ത ചെയ്തു, അലെക്സഅക്സനുമ്ക്സ- അല്ലെങ്കിൽ അലെക്സഅക്സനുമ്ക്സ-. മൈറ്റോകോണ്ട്രിയകളില്ലാതെ-തൊമ്ക്സനുമ്ക്സ വിരുദ്ധ ഇംമുനൊഫ്ലുഒരെസ്ചെന്ചെ അല്ലെങ്കിൽ ഫിക്സേഷൻ മുൻപുള്ള ക്സനുമ്ക്സ ഡിഗ്രി ക്സനുമ്ക്സ മിനിറ്റ് സെറം-സ്വതന്ത്ര ദ്മെമ് ൽ ക്സനുമ്ക്സ NM മിതൊത്രച്കെര് റെഡ് ച്മ്ക്സരൊസ് (മോളിക്യുലർ പ്രോബ്സ്, ഇൻക്) സെല്ലുകൾ ഇന്ചുബതിന്ഗ് ഒന്നുകിൽ ദൃശ്യവൽക്കരിക്കുകയും ചെയ്തു.

മൈക്രോസ്കോപ്പിയും ഇമേജ് അനാലിസിസും

Immunofluorescence സാമ്പിളുകൾ ഒരു LSM710 കോൺഫ്രാക് സൂക്ഷ്മകോശത്തിൽ (കാൾ സീസ്) കണ്ടു. Adobe Photoshop CS63 ഉപയോഗിച്ച് അഡ്ജസ്റ്റ് ചെയ്തതും മെച്ചപ്പെട്ടതുമായ ചിത്രങ്ങൾ 100X അല്ലെങ്കിൽ 6 എണ്ണ ഇമ്പർഷൻ ലക്ഷ്യങ്ങളും ഇമേജുകളും ഉപയോഗിച്ചാണ് മൈക്രോഗ്രാം പകർത്തിയത്. സാമ്പിളുകളുടെ ഐഡന്റിറ്റിക്ക് അന്ധതയിറക്കുന്നതിനിടയിൽ സ്വയം സജ്ജീകരണങ്ങളോടെയുള്ള കാർൽ സെയ്സ് LSM710 സഹ-ലോക്കൽലൈസേഷൻ സവിശേഷത ഉപയോഗിച്ച് കോ-ലോക്കൽ വ്യാഴത്തിന്റെ വിശകലനം നടത്തി. സൂചിപ്പിക്കാത്ത പക്ഷം ബാറുകൾ സ്കെയിൽ ചെയ്യുക, 10 μm ആകുന്നു. മൈറ്റോചോണ്ട്രൽ മോർഫോളജി അന്ധമായ സ്കോറാണ് നൽകിയിരുന്നത്. ഒരു കോശത്തിന്റെ മൈറ്റോകോണ്ട്രിയ അനേകം, റൌണ്ട്, ഡിസ്ക്രിമിനേറ്റ് പങ്ക്സ് ആയി കൈകാര്യം ചെയ്തിരുന്നാൽ സെൽ 'ഫിഷൻ' എന്ന് രേഖപ്പെടുത്തുകയുണ്ടായി. വ്യക്തിഗത മൈറ്റോകോണ്ട്രിയ വേർതിരിക്കാനാവാത്തതായിരുന്നെങ്കിൽ എല്ലാ മെറ്റോക്രൊഡിയൽ ശൃംഖലയും തുടർച്ചയായി പ്രത്യക്ഷപ്പെട്ടിരുന്നുവെങ്കിൽ, കോശം 'ഫ്യൂഷൻ' എന്നാക്കി. മൈറ്റോകോണ്ട്രിയ ക്ലസ്റ്ററിങ് ഉൾപ്പെടെയുള്ള മറ്റ് എല്ലാ കോശങ്ങളും 'ഇന്റർമീഡിയറ്റ്' ആയി കണക്കാക്കപ്പെട്ടു.

ഉപസൗലിക സങ്കൽപ്പങ്ങൾ

RPE-1 കോശങ്ങൾ കൂടിച്ചേർന്ന് വളർന്നു. ഒരു പി.ബി.എസ് വാഷ് അനുസരിച്ച് കോശങ്ങൾ 600 × 10 മിനിറ്റിനുള്ളിൽ സെന്റീഫുഗേഷൻ ആക്റ്റിവേറ്റ് ചെയ്തു, 10 μL ലാൻഡിംഗ് ബഫറിൽ പുനർസന്ദർശിച്ചു (600 എംഎം മാനിറ്റോൾ, XM എം എം സുക്കോസ്, എംഎംഎസ് എംപോപ്സ്, എംഎംഎം എംഎടിഎ പിഎച്ച് X + 210 എംഎം പിഎംഎസ്എഫ്). ഒരു സസ്പെൻസ് homogenizer ൽ സസ്പെൻഷൻ 70 തവണ ലീസ് ചെയ്തു. "മുഴുവൻ സെൽ lysate" ആയി homogenate ഒരു ഭിന്നസംരക്ഷണമായിരുന്നു. ബാക്കി Nuclei pendlet ലേക്കുള്ള 5 × 10 മിനിറ്റ് centrifugation വിധേയമായിരുന്നു. സൂപ്പർനേറ്ററുകൾക്ക് 1 × 10 മിനിറ്റിനുള്ളിൽ ബാക്കിയുള്ള ന്യൂക്ലിയസും അൺലിസെസ് സെല്ലുകളും മായ്ക്കുന്നതിന് സെന്റ്രൂഫിഗേഷൻ വിധേയമായി. ഈ സൂപ്പർമർങ് 7.4 × 10 മിനിറ്റിനുള്ളിൽ മൈറ്റോകോണ്ട്രിയയിൽ pestlet to centrifugation വിധേയമായിരുന്നു. സൂപ്പർനോട്ടാലിറ്റി "സൈറ്റോസോളിക് ഫ്രീ" എന്ന് സൂക്ഷിച്ചു. പെഡ്രാറ്റ് പിബിഎസ് ഉപയോഗിച്ച് സൌമ്യമായി കഴുകുകയും ഒറ്റപ്പെടൽ ബഫറിൽ വീണ്ടും പുനർനിർമ്മിക്കുകയും ചെയ്തു. ബിപിൻചോണിക് ആസിഡ് (ബിസിഎ) ആസെയുടെ ഓരോ അംശം പ്രോട്ടീൻ കോൺസൺട്രേഷൻ അളക്കുകയും SDS-PAGE വഴി തുല്യ പ്രോട്ടീൻ പരിഹരിക്കപ്പെടുകയും ചെയ്തു.

വെസ്റ്റേൺ ബ്ലോട്ടിംഗ്

കളങ്ങൾ പിബിഎസ് ൽ കഴുകി ക്സനുമ്ക്സ തവണ സൊലുബിലിജെദ് ചെയ്തു ലെംമ്ലി സൊലുബിലിജിന്ഗ് ബഫർ (ക്സനുമ്ക്സ എം.എം. ത്രിസ് [അമ്ലത്വം ക്സനുമ്ക്സ], ക്സനുമ്ക്സ% സ്ദ്സ്, ക്സനുമ്ക്സ% ബ്രൊമൊഫെനൊല് നീല, ക്സനുമ്ക്സ% ക്സനുമ്ക്സ-മെര്ചപ്തൊഎഥനൊല്, ക്സനുമ്ക്സ% നൊസ്റ്റാള്ജിയ, ഒപ്പം ക്സനുമ്ക്സ% പ്യ്രിനിന് വൈ) കേന്ദ്രീകരിച്ചു. സോഡിയം dodecyl സൾഫേറ്റ് (SDS) പോളാകിരംമൈഡ് ജെല്ലുകൾക്ക് മുൻപ് കയറ്റുന്നതിനു മുമ്പ് LASATES 2 മിനിറ്റ് വേവിച്ചു. പ്രോട്ടീനുകൾ nitrocellulose membranes ലേക്ക് മാറ്റി, 100% പാൽ / TBST ൽ 6.8 മണിക്കൂർ തടഞ്ഞു. പ്രാഥമിക പ്രതിരോധ വസ്തുക്കൾ 2% Milk / TBST ൽ ലയിപ്പിച്ചശേഷം സ്ഫോടനത്തിൽ 0.008 ° C ൽ കുതിർന്നിരുന്നു. Horseradish peroxidase (HRP) - കോണ്ഗ്രസ്ഡ് ദ്വിതീയ ആന്റിബോഡുകള് 2% Milk / TBST ല് ലയിപ്പിച്ചതാണ്. മെച്ചപ്പെട്ട ചെമ്മിലിനംസിനുപയോഗിച്ച് ബ്ലാട്ടുകൾ പ്രോസസ് ചെയ്തു, ഇമേജസ് സോഫ്റ്റ് വെയർ ഉപയോഗിച്ച് ഡിസ്മിറ്റോമെട്രിക് അളവുകൾ നിർവ്വഹിച്ചു.

ബ്രോക്കോളി, കാബേജ്, കോളിഫ്ളവർ, കാൾ, കോൾഡ്സ് തുടങ്ങിയവ ഉൾപ്പെടെ കുങ്കുമക്കഷണങ്ങൾ ശേഖരിച്ച ഓർഗാനോഫുലർ വസ്തുക്കളുടെ ഇസോഷ്യിയോസൈനിയറ്റ് ശേഖരത്തിൽ നിന്നും സൾഫോപ്രഫീൻ ഒരു രാസവസ്തുവാണ്. എൻറോം myrosinase ഗ്ലൂക്കോറാപാനിൻ, ഗ്ലൂക്കോസിനോളാറ്റ്, സൾഫോറഫാനിലേക്ക് പരിവർത്തനം ചെയ്യുമ്പോൾ സുൽഫോപ്പാപാനി ഗ്ലൂക്കോസിനോളേറ്റ് എന്നും അറിയപ്പെടുന്നു. ബ്രോക്കോളി മുട്ടകൾ, കോളിഫ്ളവർ എന്നിവയ്ക്ക് ഗ്ലൂക്കോറോപ്പണിയുടെ ഏറ്റവും ഉയർന്ന സാന്നിദ്ധ്യം അല്ലെങ്കിൽ സൾഫൊർഫാനിലേക്ക് മുൻഗാമികൾ ഉണ്ട്. വിവിധ ആരോഗ്യപ്രശ്നങ്ങൾ തടയുന്നതിനായി മനുഷ്യശരീരത്തിലെ ആൻറി ഓക്സിഡൻറുകളുടെ ശേഷി വർദ്ധിപ്പിക്കാൻ സൾഫോറാഫാനെ സഹായിക്കുമെന്ന് ഗവേഷണ പഠനങ്ങൾ തെളിയിച്ചിട്ടുണ്ട്. ഡോ. അലക്സ് ജിമനേസ് DC, CCST ഇൻസൈറ്റ്

ക്യാൻസർ, മോർട്ടാലിറ്റി, ഏജിംഗ്, ബ്രെയിൻ ആന്റ് ബിഹേവിയർ, ഹൃദ്രോഗം എന്നിവയെല്ലാം സുൽഫോപ്പഫണും അതിന്റെ പ്രഭാവവും

ഐസോത്തിയോസയനങ്ങൾ ഭക്ഷണത്തിൽ നിങ്ങൾക്ക് ലഭിക്കുന്ന ഏറ്റവും പ്രധാനപ്പെട്ട പ്ലാന്റ് സംയുക്തങ്ങളാണ്. ഈ വീഡിയോയിൽ ഞാൻ നിർമ്മിച്ചതിൽ ഏറ്റവും സമഗ്രമായ കേസ് ഞാൻ ഉണ്ടാക്കുന്നു. ചെറിയ ശ്രദ്ധാകേന്ദ്രം? ചുവടെയുള്ള സമയ പോയിന്റുകളിൽ ഒന്ന് ക്ലിക്കുചെയ്ത് നിങ്ങളുടെ പ്രിയപ്പെട്ട വിഷയത്തിലേക്ക് പോകുക. പൂർണ്ണ ടൈംലൈൻ താഴെ.

കീ വിഭാഗങ്ങൾ:

  • വ്യായാമം, മരണ നിരക്ക്
  • ചൊവ്വ: 83 - 83 - ഏജിംഗ്
  • XXX: 00: 26 - ബ്രെയിൻ ആൻഡ് പെരുമാറ്റം
  • 00: 38: 06 - അവസാനത്തെ റീക്യാപ്പ്
  • XXX: 00: 40 - ഡോസ്

പൂർണ്ണ ടൈംലൈൻ:

  • 00: 00 - 34 - വീഡിയോയുടെ പ്രധാന ശ്രദ്ധ പിടിച്ചുപറ്റിയ സൾഫൊർഫാനെ എന്ന ആമുഖം.
  • 83 - 83 - ക്രസ്കീരിയസ് പച്ചക്കറി ഉപഭോഗം, എല്ലാ കാരണങ്ങളാലും മരണനിരക്ക് കുറയ്ക്കുക.
  • 83 - 83 - പ്രോസ്റ്റേറ്റ് കാൻസർ റിസ്ക്.
  • 83: 83 - ക്ഷയിക്കുന്ന അർബുദം.
  • പുകവലി റിസ്കിൽ ശ്വാസകോശ കാൻസർ.
  • വ്യായാമം: സ്തനാർബുദം.
  • 00: 03: 13 - Hypothetical: നിങ്ങൾക്ക് ഇപ്പോൾ ക്യാൻസറുണ്ടെങ്കിൽ? (ഇടപെടൽ)
  • 00: 03 - 35 - കാൻസർ, മരണസംബന്ധമായ ബന്ധിത വിവരങ്ങളിൽ ഡ്രൈവിംഗ് സംവിധാനം.
  • 83: 83 - സുൽഫോപ്പഫനും അർബുദവും.
  • 83 - 83 - എലികളിലെ കോശവളർച്ച വികസനത്തിൽ ബ്രോക്കോളി മുളക്കുന്നതിന്റെ ശക്തമായ പ്രഭാവം കാണിക്കുന്നു.
  • 83 - 83 - പ്രോസ്റ്റേറ്റ് കാൻസർ രോഗികളിലെ സൾഫോറഫായെ നേരിട്ട് നൽകുക.
  • 83 - 83 - യഥാർത്ഥ ബ്രെസ്റ്റ് ടിഷ്യസിൽ ഐസോതോയോസൈനറ്റ് മെറ്റബോളിറ്റുകളുടെ ജൈവകചലനം.
  • NSS: XX: XXL - സ്തനാർബുദം സ്റ്റെം സെല്ലുകൾ തടഞ്ഞത്.
  • പുരാതന റോമിൽപോലും ഹെൽത്ത് പ്രോപ്പർട്ടികളായി ബ്രസികകൾ സ്ഥാപിക്കപ്പെട്ടു.
  • 83-83 - കാൻസറിൻ വിസർജ്ജനം വർദ്ധിപ്പിക്കുന്നതിനുള്ള സൾഫൊർഫാന്റെ കഴിവ് (ബെൻസീൻ, അൾരോലിൻ).
  • 00: 09 - NRF51 ആൻറിഓക്സിഡന്റ് പ്രതികരണ ഘടകങ്ങൾ വഴി ജനിതകമാറ്റം പോലെ.
  • 00: 10 - NRF10 activation ഗ്ലൂത്തോത്തോൺ-എസ്-കോഞ്ഞഗേറ്റുകൾ വഴി കാർകിനേജൻ വിസർജ്ജത്തെ എങ്ങനെ മെച്ചപ്പെടുത്തുന്നു.
  • ബ്രസൽസ് മുളകൾ ഗ്ലൂട്ടാട്യൺ-എസ്-ട്രാൻസ്ഫസർ വർദ്ധിപ്പിക്കുകയും ഡി.എൻ.എ നാശനഷ്ടം കുറയ്ക്കുകയും ചെയ്യുന്നു.
  • 83-83 - ബ്രോക്കോളി മുളപ്പിച്ച പാനീയം ബെൻസീൻ വിസർജ്ജനം 00% വർദ്ധിപ്പിക്കും.
  • ബ്രോക്കോളി മുട്ട പൊരിഞ്ഞത്, വായു ശ്വസനത്തിലെ ആന്റിഓക്സിഡന്റ് എൻസൈമുകൾ വർദ്ധിപ്പിക്കും.
  • 83 - 83 - ക്രസ്റ്റീരിയസ് പച്ചക്കറി ഉപഭോഗം, ഹൃദ്രോഗ മരണനിരക്ക്.
  • വ്യായാമം: ബ്രോക്കോളി മുളക് പൊടി രക്തത്തിലെ ലിപിഡുകളും, ഹൃദയമിടിപ്പിന്റെ ഭീഷണിയുമൊക്കെയാണ് ടൈപ്പ് എക്സ് പ്രസ് ഡയബറ്റിക്സിൽ.
  • 83: 83 - പ്രായപൂർത്തിയായവർക്കുള്ള ഭാഗം ആരംഭിക്കുക.
  • 83-83 - സുൽഫോപ്പഫൻ സമ്പുഷ്ടമായ ആഹാരം വെൻഡിൻറെ ആയുസ്സ് വർദ്ധിപ്പിക്കും 00 മുതൽ XNUM% വരെ (ചില സാഹചര്യങ്ങളിൽ).
  • XXX: 00 - XXX - ആയുർദൈർഘ്യം കുറഞ്ഞ പ്രാധാന്യം.
  • ഞരമ്പുകളായ പച്ചക്കറികളും ബ്രോക്കലിയും മുളപ്പിച്ച പൗഡർ മനുഷ്യരിൽ പലതരം വീക്കം ഉദ്ദീപിപ്പിക്കുകയും ചെയ്യുന്നു.
  • വ്യായാമം: പ്രായപൂർത്തിയാകാത്ത ഒരാൾ
  • സൾഫർഫെയ്നിലെ മൗസ് സർവ്വേകൾ പഴക്കമുള്ള രോഗപ്രതിരോധ പ്രവർത്തനം മെച്ചപ്പെടുത്തും എന്നാണ് മൗസ് പഠനങ്ങൾ സൂചിപ്പിക്കുന്നത്.
  • നൂൽനൂൽ: തുഞ്ചത്തെഴുത്തച്ഛൻ ഒരു മൗസ് മോഡലിൽ സുൽഫോപ്പഫീൻ മുടി വളർച്ച മെച്ചപ്പെടുത്തി. ചിത്രത്തിലെ ചിത്രം: 00: 25: 18.
  • 83 - 83 - 83 - മസ്തിഷ്ക്കം, സ്വഭാവം ഭാഗം ആരംഭിക്കുക.
  • വ്യായാമം: ബ്രോക്കോളി മുട്ടയുടെ പ്രാധാന്യം ഓട്ടിസം
  • സ്കെസോഫ്രെനിയയിലെ ഗ്ലൂക്കോറാഫാനിൻറെ പ്രഭാവം.
  • 83 - 83 - മാനസിക വിഭ്രാന്തിയുടെ ആരംഭം (വിശ്വസനീയമായ സംവിധാനവും പഠനവും).
  • 83 - 83 - സ്ട്രെസ്-ഇൻഡുഡഡ് ഡിപ്രഷൻ ഷോയുടെ വിവിധ മോഡലുകൾ ഉപയോഗിച്ച് മൗസ് പഠനം ഫ്ലൂക്സെറ്റിൻ (പ്രോസക്) പോലെ സൾഫൊർഫാഹനെപ്പോലെ ഫലപ്രദമാണ്.
  • എലികളിൽ ഗ്ലൂക്കോറാപാനിനെ നേരിട്ട് ഉൾപ്പെടുത്തുന്നുവെന്ന് പഠിക്കുന്നത് സാമൂഹ്യ പരാജയങ്ങളുടെ സ്ട്രെസ് മോഡലിൽ വിഷാദരോഗം തടയുന്നതിന് സമാനമാണ്.
  • ഞാനിത്: ന്യൂറോഡെഗനേഷൻ വിഭാഗം ആരംഭിക്കുന്നു.
  • 83: 83 - സുൽഫോപ്പഫനും അൽസിമേഴ്സും രോഗം.
  • 83 - 83 - സുൽഫോപ്പഫേൻ പാർക്കിൻസൺസ് രോഗം.
  • 83: 83 - സുൽഫോപ്പഫൻ, ഹംഗിങ്ടൺസ് രോഗം.
  • 83: 83 - സുൽഫോപ്പഫേൻ ചൂട് ഷോക്ക് പ്രോട്ടീനുകൾ വർദ്ധിപ്പിക്കുന്നു.
  • വ്യായാമം: ബ്രോങ്കോ ന്യൂട്രീഷൻ തലച്ചോറ്ക്കുള്ള വ്യായാമം ആരംഭിക്കുക.
  • 83 - 83 - ടിബിഐ മെമ്മറി മെച്ചപ്പെടുത്തുന്നതിന് ശേഷം സുൽഫോപ്പഫീൻ കുത്തിവച്ച് (മൗസ് പഠനം).
  • 83 - 83 - സൾഫൊറാഫാനയും ന്യൂറോണൽ പ്ലാസ്റ്റിവും.
  • 83-83 - സോൾഫോപാപീൻ എലികളുടെ ടൈപ്പ് II ഡയബറ്റിസ് മാതൃകയിൽ പഠന മെച്ചപ്പെടുത്തുന്നു.
  • ഞരമ്പുകൾ, ഡുക്ക്ഹെൻ പേശീ നീർപ്പം.
  • 00: 37 - മയോസ്ടാടിൻ പേശികളുടെ ഉപഗ്രഹ സെല്ലുകളിൽ (in vitro) നിരോധനം.
  • മസ്തിഷ്ക, അർബുദം, ഡി.എൻ.എ നാശം, ഓക്സിഡേറ്റീവ് സ്ട്രെസ് ആൻഡ് വീക്കം, ബെൻസീൻ വിസർജ്യങ്ങൾ, ഹൃദയ രോഗങ്ങൾ, ടൈപ്പ് II പ്രമേഹം, മസ്തിഷ്കത്തിലെ പ്രഭാവങ്ങൾ (വിഷാദം, ഓട്ടിസം, സ്കീസോഫ്രേനിയ, ന്യൂറോഡെഗനേഷൻ), NRF00 പാത.
  • നഴ്സറികൾ, സൾഫൊർഫാപെണിന്റെ അളവ് നിർണ്ണയിക്കുന്നതിനുള്ള ചിന്തകൾ.
  • 83: 83 - 83 - വീട്ടിൽ മുളയ്ക്കുന്നമേൽ anecdotes.
  • 83: 83 - പാചകം താപനിലയും സൾഫൊർഫാനെ പ്രവർത്തനവും.
  • 83 - 83 - ഗ്ലൂക്കോറാപാഹിനിൽ നിന്ന് സൾഫർഫാപാനെ ഗുഡ് ബാക്ടീരിയയുടെ പരിവർത്തനം.
  • ഞാൺ: പച്ചക്കറികളിൽ സക്രിയ മൈറോസിനസിനൊപ്പം സപ്ലൈമുകൾ നന്നായി പ്രവർത്തിക്കുന്നു.
  • ഞാ 9: XX: XXX - പാചകം ടെക്നിക്കുകളും cruciferous പച്ചക്കറി.
  • 00: 46: 06 - ഐസോത്തിയോസയറ്റേറ്റുകൾ ഗായത്രി ആയി.


ശാസ്ത്രീയമായ / സയൻസ് / ഘടന / പോഷകാഹാരം

സുൽഫോരോഫീൻ നിർമ്മിക്കുന്നത് എങ്ങനെ?

പ്രോട്ടീൻ പ്രവർത്തനം, ബ്രോക്കോളിയിൽ സുൽഫോരോഫെയ്ൻ രൂപീകരണം വർദ്ധിപ്പിക്കൽ


ബ്രോക്കോളിയിൽ നിന്നുള്ള ഒരു ഐസോതോസിയാനേറ്റ് എന്ന സുൽഫോ പോഫാനെ, ശക്തമായ ഭക്ഷ്യധാന്യ ശേഖരമുള്ള ആന്റികർക്നോജെനുകളിൽ ഒന്നാണ്. ഈ സംയുക്തം പച്ചക്കറികളിൽ അടങ്ങിയിട്ടില്ല, മറിച്ച് ഗ്ലൂക്കോസിനോളേറ്റിൽ നിന്നുള്ള ഗ്ലോക്കോസിനോളേറ്റിൽ നിന്നും രൂപപ്പെട്ടതാണ് ഗ്ലോക്കോരാപാനിൻ, ബ്രൈക്കോളി കോശം തകർന്നാലോ ചവച്ചതോ ആയപ്പോൾ, തൈലോഗ്കൂസിഡസിസ് എൻസൈം എന്ന മരുന്നിന്റെ പ്രവർത്തനത്തിലൂടെ. എന്നാൽ, ഗ്ലൂക്കോപാപാനിനിൽ നിന്നുള്ള സൾഫോർഫാപ്പൻ വിളവ് വളരെ കുറവാണെന്നും അനിയന്ത്രിത നൈട്രലി അനലോഗ്, സൾഫോരോഫീൻ നൈട്രൈൽ, ഊഷ്മാവിൽ ടിഷ്യു തകർത്ത് തുടങ്ങിയപ്പോൾ പ്രൈമറി ഹൈഡ്രോളിസിസ് ഉത്പന്നമാണെന്നും നിരവധി പഠനങ്ങൾ തെളിയിച്ചിട്ടുണ്ട്. അറബിയോപ്രോസിസിൽ ഗ്ലൂക്കോസിനോളേറ്റുകളിൽ നിന്നുള്ള നൈട്രൽ രൂപവത്കരണം ചൂടിൽ സെൻസിറ്റീവ് പ്രോട്ടീൻ, എപിത്യോസ്പെസിഫയർ പ്രോട്ടീൻ (ഇപിഎസ്), മൈറോസിനാസിൻറെ രാസാഗ്നിയുടെ ഉത്തേജനം, നിയന്ത്രിക്കുന്നതായി പുതിയ തെളിവുകൾ സൂചിപ്പിക്കുന്നു. നമ്മുടെ ലക്ഷ്യങ്ങൾ സുല്ഫൊരഫനെ ആൻഡ് സുല്ഫൊരഫനെ നിത്രിലെ രൂപവത്കരണത്തിൽ താപനം ബ്രോക്കോളി ഫ്ലൊരെത്സ് ആൻഡ് മുളപ്പിച്ച ആഘാതവും, ബ്രോക്കോളി ഇഎസ്പി പ്രവർത്തനം അടങ്ങിയിരിക്കുന്നു, നിർണ്ണയിക്കുന്നതിന്, തുടർന്ന് ഇഎസ്പി പ്രവർത്തനത്തിൽ ചൂട്-ആശ്രിത മാറ്റങ്ങൾ, സുല്ഫൊരഫനെ ഉള്ളടക്കവും ബിഒഅച്തിവിത്യ് പരസ്പര വരെ, ഓൾട്ടർനേറ്റീവ് കണക്കാക്കിയത് പരിശോധിക്കുവാൻ ആയിരുന്നു കോശ സംസ്ക്കരണത്തിലെ ഘട്ടം II വിഷവസ്തുവാൽ ക്വിനോൺ റിഡക്ഷൻ (QR). ഹോമോജെസേഷനു മുൻപ് പൂരിപ്പിക്കൽ ബ്രൂക്കോലി ഫ്ലററ്റ് അല്ലെങ്കിൽ ബ്രോക്കോളി മുളപ്പിച്ച സസ്യങ്ങൾ 60 ° C ലേക്ക് ഒരേസമയം വർദ്ധിപ്പിച്ചത് സൾഫോറാഫാൻ രൂപീകരണവും സൾഫോറാപ്പനെ നൈട്രിലിൻറെ രൂപീകരണവും വർദ്ധിപ്പിച്ചു. ഇഎസ്പി പ്രവർത്തനങ്ങളുടെ ഭീമമായ നഷ്ടം സൾഫോറാഫാൻ നൈട്രൽ രൂപീകരണത്തിലെ കുറവുമായി സമാന്തരമായി. ബ്രൂക്കോളി ഫ്ലാരെറ്റുകളിൽ രണ്ട് ഉത്പന്നങ്ങളുടെ രൂപീകരണം കുറച്ചു, പക്ഷേ ബ്രോക്കോളി മുളകളിൽ ഇല്ലാത്തതും, ചൂടാക്കി 70 ° C ഉം താപനം. സംയുക്തമായ മൗസ് ഹെപ്പറ്റോമയിൽ QR ന്റെ ആഗിരണം ഹെൽറ്റാ Lclc7 കളങ്ങൾ സമാന്തരമായി സൾഫൊർപാണി രൂപത്തിൽ വർദ്ധിപ്പിക്കും.

പ്രീ-താപോർജ്ജം ബ്രോക്കോളി ഫ്ലാരെറ്റുകളും മുളപ്പിച്ച തണലും 60 ° C ലേക്ക് വർദ്ധിപ്പിച്ചത് പച്ചക്കറി ടിഷ്യു സാച്ചുറേഷനിലെ സോൾഫോപാപാനെ (എസ്എഫ്) എന്ന മിറൈനൈസിസ്-ഉത്കണ്ഠാജനകമായ രൂപവത്കരണം. സുൽഫോപ്പാപീൻ നൈട്രിലെ (SF Nitrile) രൂപീകരണവും എപിത്വോസ്പെസിഫയർ പ്രോട്ടീനും (ഇഎസ്പി) പ്രവർത്തനത്തിൽ കുറവുണ്ടായതാണ് ഇത്.

അടയാളവാക്കുകൾ: ബ്രോക്കോളി, ബ്രാസിക്ക ഓളാരേഷ്യ, ക്രൂസിഫെരാ, കാൻസർ, ആന്റികാർക്കോണിൻ, സൾഫോപ്രാപീൻ, സൾഫോപ്രഫാൻ നൈട്രൽ, എപിത്വോസ്പെസിഫയർ പ്രോട്ടീൻ, ക്വിനോൺ റിഡക്ഷൻ

ഉപസംഹാരമായി, സൾഫൊറഫേൻ ബ്രോക്കോളിയിൽ കണ്ടെത്തിയ ഫൈറ്റോകെകെമിക്കൽ, മറ്റ് cruciferous പച്ചക്കറികൾ. ആന്തരികവും ബാഹ്യവുമായ ഘടകങ്ങളാൽ ഉണ്ടാകുന്ന അനിയന്ത്രിതമായ ഓക്സിഡൻറുകൾ മനുഷ്യ ശരീരത്തിലെ ഓക്സിഡീവ് സ്ട്രെസ് ഉണ്ടാക്കുന്നു, ഇത് ആത്യന്തികമായി ആരോഗ്യപ്രശ്നങ്ങൾക്ക് കാരണമാകാം. ഓക്സിഡൻറുകൾക്കുള്ള സെൽ പ്രതികരണത്തെ നിയന്ത്രിക്കുന്ന സംരക്ഷക ആന്റിഓക്സിഡന്റ് സംവിധാനങ്ങളെ നിയന്ത്രിക്കുന്ന ഒരു ട്രാൻസ്ക്രിപ്ഷൻ ഘടകം എൻആർഎഫ്എക്സ്എൻഎക്സ്എക്സ് എന്ന ഉൽപാദനത്തെ സുൽഫോരോഫെയ്നിൽ സജീവമാക്കാം. ഞങ്ങളുടെ വിവരങ്ങളുടെ പരിധി ചിതറായും അസാധാരണമായ ആരോഗ്യ പ്രശ്നങ്ങളിലേക്കും പരിമിതപ്പെടുത്തിയിരിക്കുന്നു. വിഷയം ചർച്ച ചെയ്യാൻ, ഡോക്ടർ ജിമെനെസ് ചോദിക്കാൻ മടിക്കരുത് അല്ലെങ്കിൽ ഞങ്ങളെ ബന്ധപ്പെടുക 915-850-0900 .

ഡോ. അലക്സ് ജിമെനെസ് ക്യൂറാണ്

ഇതിൽ നിന്നും റെഫറൻസ്: Sciencedirect.com

കൂടുതൽ വിഷയം ചർച്ച: അക്യുട്ട് ബാക്ക് വേദന

പുറം വേദന ലോകവ്യാപകമായി തൊഴിലാളിയുടെ വൈകല്യവും നഷ്ടപ്പെടാത്ത ദിവസങ്ങളും ഏറ്റവും കൂടുതലായ കാരണങ്ങൾ. ഡോക്ടർ ഓഫീസ് സന്ദർശനങ്ങൾക്കുള്ള രണ്ടാമത്തെ ഏറ്റവും സാധാരണ കാരണം ചൂണ്ടിക്കാട്ടുന്നു, ഉയർന്ന ശ്വാസകോശബാധയുള്ള അണുബാധകൾ മാത്രം. ജനസംഖ്യയിൽ ഏതാണ്ട് എൺപതു ശതമാനം പേർക്ക് അവരുടെ ജീവിതകാലം മുഴുവൻ ഒരു വേദന ഒരിക്കൽ അനുഭവപ്പെടും. നട്ടെല്ല്, സന്ധികൾ, കട്ടിലുകൾ, പേശികൾ തുടങ്ങി മൃദുവായ ടിഷ്യൂകൾ കൊണ്ട് നിർമ്മിച്ച സങ്കീർണമായ ഘടനയാണ് നട്ടെല്ല്. ഇതുമൂലം, ഗുരുതരമായ പരുക്കുകളോ അല്ലെങ്കിൽ അല്ലെങ്കിൽ മോശപ്പെട്ടതോ ആയ അവസ്ഥകൾ ഹാർനിയേറ്റഡ് ഡിസ്ക്കുകൾ, ഒടുവിൽ മുടി വേദനയുടെ ലക്ഷണങ്ങളായി മാറുന്നു. സ്പോർട്സ് പരിക്കുകൾ അല്ലെങ്കിൽ വാഹനാപകടങ്ങൾ പലപ്പോഴും മുടി വേദനയ്ക്ക് ഇടയാക്കുന്നു, ചിലപ്പോൾ ചലനങ്ങളുടെ ലളിതമായ വേദനയ്ക്ക് വേദനയേറിയ ഫലങ്ങൾ ഉണ്ടാകാം. ഭാഗ്യവശാൽ, ചികിൽസാകൃതിയിലുള്ള സംരക്ഷണം പോലെയുള്ള ബദൽ ചികിൽസാരീതികൾ, നട്ടെല്ലിൽ മാറ്റം വരുത്താനും നട്ടെല്ലിൽ മാറ്റം വരുത്താനും സഹായകരമാകും, ഇത് ആത്യന്തികമായി വേദനയുടെ ആശ്വാസം വർദ്ധിപ്പിക്കും.

EXTRA EXTRA | പ്രധാന വിഷയം: ശുപാർശ എൽ പാസോ, TX ച്യൂയിപോർട്ട് സ്ട്രക്ചർ


ഡോ. അലക്സ് ജിമനേസ് DC, CCST

സ്വാഗതം- Bienvenido ഞങ്ങളുടെ ബ്ലോഗിലേക്ക് പോകുന്നു. കടുത്ത നട്ടെല്ല്, പരിക്കുകൾ എന്നിവയ്ക്ക് നാം ശ്രദ്ധ ചെലുത്തുന്നു. നാം സൈറ്റാസ്റ്റ, നെക്ക് ആൻഡ് ബാക്ക് വേദന, വിപ്ലാഷ്, തലവേദന, മുടി പരിക്കുകൾ, സ്പോർട്സ് ഇൻജൂറീസ്, തലകറക്കം, പാവം സ്ലീപ്പ്, ആർട്ടിറ്റിസ് എന്നിവ കൈകാര്യം ചെയ്യുന്നു. ഒപ്റ്റിമൽ മൊബിലിറ്റി, ഹെൽത്ത്, ഫിറ്റ്നസ്, ഘടനാപരമായ കൺട്രോൾ എന്നിവയിൽ ശ്രദ്ധകേന്ദ്രീകരിച്ച നൂതനമായ തെളിയിക്കപ്പെട്ട ചികിത്സകൾ ഞങ്ങൾ ഉപയോഗിക്കുന്നു. വിവിധതരം മുറിവുകളിലൂടെയും, ആരോഗ്യപ്രശ്നങ്ങൾമൂലമുള്ള രോഗികൾക്കുമായി വ്യക്തിഗത ഡൈറ്റ് പ്ലാനുകൾ, പ്രത്യേകവൈദ്യുത സാങ്കേതിക വിദ്യകൾ, മൊബിലിറ്റി-അഗലിറ്റി ട്രെയിനിങ്, അഡോപ്ഡ് ക്രോസ് ഫിറ്റ് പ്രോട്ടോക്കോളുകൾ, "പിഷ് എച് സിസ്റ്റം" എന്നിവയാണ് ഞങ്ങൾ ഉപയോഗിക്കുന്നത്. പൂർണ്ണമായ ശാരീരിക ആരോഗ്യം സുഗമമാക്കുന്നതിന് പുരോഗമന പുരോഗമന സാങ്കേതിക വിദ്യ ഉപയോഗിക്കുന്ന ഒരു ഡോക്ടർ ഓഫ് ചൈക്രോ സ്ട്രക്റ്റിയെ കുറിച്ച് കൂടുതൽ അറിയാൻ ആഗ്രഹിക്കുന്നുവെങ്കിൽ, ദയവായി എന്നെ ബന്ധിപ്പിക്കുക. ചലനശേഷി വീണ്ടെടുക്കാനും പുനരുജ്ജീവിപ്പിക്കാനും ഞങ്ങൾ ലളിതമായി ശ്രദ്ധിക്കുന്നു. നിന്നെ കാണാൻ ഞാൻ ആഗ്രഹിക്കുന്നു. ബന്ധിപ്പിക്കുക!


സമീപകാല പോസ്റ്റുകൾ

നടുവേദനയ്ക്കുള്ള വിപരീത തെറാപ്പി എൽ പാസോ, ടെക്സസ്

വിപരീത പട്ടികകളും വിപരീത ചികിത്സയും / തെറാപ്പി കുറഞ്ഞ പുറം / കാലിലെ വേദനയ്ക്കും സയാറ്റിക്കയ്ക്കും സഹായിക്കും. ഇത് ശസ്ത്രക്രിയേതരവും നിങ്ങളുടെ ഡോക്ടർ ഒരു ഓപ്ഷനുമാണ്,… കൂടുതല് വായിക്കുക

ജനുവരി 16, 2020

ഫംഗ്ഷണൽ ന്യൂറോളജി: ഡോപാമൈനും സെറോട്ടോണിനും തമ്മിലുള്ള വ്യത്യാസങ്ങൾ

ഡോപാമൈൻ, സെറോടോണിൻ എന്നിവയെ "സന്തുഷ്ട രാസവസ്തുക്കൾ" എന്ന് വിളിക്കുന്നു, കാരണം അവ നമ്മുടെ മാനസികാവസ്ഥയെ നിയന്ത്രിക്കുന്നതിൽ അടിസ്ഥാനപരമായ പങ്ക് വഹിക്കുന്നു. ഇവ… കൂടുതല് വായിക്കുക

ജനുവരി 16, 2020

ഉയർന്ന അപകടസാധ്യതയുള്ള ജോലി, നിങ്ങളുടെ നട്ടെല്ല്, പുറം പരിക്ക് എൽ പാസോ, ടെക്സസ്

ജോലി / ജോലി എർണോണോമിക്സ് ഇന്നത്തെ തൊഴിൽ ശക്തിയിൽ, പല ജോലികളും തൊഴിലാളികളെ നട്ടെല്ലിന് പരിക്കേൽക്കാനുള്ള സാധ്യത കൂടുതലാണ്. പട്ടിക ഇതാണ്… കൂടുതല് വായിക്കുക

ജനുവരി 15, 2020

ഫംഗ്ഷണൽ ന്യൂറോളജി: സ്വാഭാവികമായും സെറോട്ടോണിൻ വർദ്ധിപ്പിക്കുന്നതിനുള്ള ഭക്ഷണങ്ങൾ

പലതരം തലച്ചോറിലും ശാരീരിക പ്രവർത്തനങ്ങളിലും അടിസ്ഥാനപരമായ പങ്ക് വഹിക്കുന്ന ന്യൂറോ ട്രാൻസ്മിറ്ററാണ് സെറോടോണിൻ. ഈ കെമിക്കൽ മെസഞ്ചർ… കൂടുതല് വായിക്കുക

ജനുവരി 15, 2020

ഫംഗ്ഷണൽ എൻ‌ഡോക്രൈനോളജി: ഗട്ട്, “കീമോ-ബ്രെയിൻ” കണക്ഷൻ

അതിശയകരമെന്നു പറയട്ടെ, കീമോ-ബ്രെയിൻ ഒരു സാധാരണ കാര്യമായി മാറുന്നതിനിടയിൽ അർബുദത്തെ അതിജീവിച്ചവരിൽ പകുതിയിലധികം പേരെ ബാധിച്ചു… കൂടുതല് വായിക്കുക

ജനുവരി 14, 2020

ടെക്സസിലെ എൽ പാസോ, നട്ടെല്ല് എന്നിവ ശ്രദ്ധിക്കുക

ഓരോരുത്തരും അവരുടെ പുറം / നട്ടെല്ല് പരിപാലിക്കേണ്ടതുണ്ട്, കാരണം ഇത് ഞങ്ങൾ സൂക്ഷിക്കുന്നിടത്തോളം കാലം നമ്മെ ഉയർത്തിപ്പിടിക്കുന്നു… കൂടുതല് വായിക്കുക

ജനുവരി 14, 2020
സ്വാഗതം & ബിയെൻ‌വിഡോസ്. ഞങ്ങൾക്ക് നിങ്ങളെ എങ്ങനെ സഹായിക്കാനാകും? കോമോ ലെ പോഡെമോസ് ആയുർദാർ?
പുതിയ രോഗി രജിസ്ട്രേഷൻ
ഇന്ന് ഞങ്ങളെ വിളിക്കുക