വഞ്ചന മോണിറ്ററിംഗ് ക്ലിക്കുചെയ്യുക
പേജ് തിരഞ്ഞെടുക്കുക

വിട്ടുമാറാത്ത വേദന

വിട്ടുമാറാത്ത വേദന: സമയാസമയങ്ങളിൽ എല്ലാവർക്കും വേദനയുണ്ട്. നിങ്ങളുടെ വിരൽ മുറിക്കുക അല്ലെങ്കിൽ ഒരു പേശി വലിച്ചെടുക്കുക, വേദന നിങ്ങളുടെ തെറ്റിനുള്ള തെറ്റിനുള്ള വഴിയാണ്. പരുക്കേറ്റ പരിക്കുകൾ തടയാൻ നിറുത്തുക.

വിട്ടുമാറാത്ത വേദന വ്യത്യസ്തമായി പ്രവർത്തിക്കുന്നു. മുറിവുകൾ കഴിഞ്ഞ് ആഴ്ചകൾ, മാസങ്ങൾ, അല്ലെങ്കിൽ വർഷങ്ങൾ പോലും ശരീരത്തെ വേദനിപ്പിക്കുന്നു. 8 മുതൽ 18 വരെ മാസം കൂടുതലോ നീണ്ടുനിൽക്കുന്ന ഏതൊരു വേദനയും ഡോക്ടർമാർ വിട്ടുമാറാത്ത വേദനയെ നിർവ്വചിക്കുന്നു. വിട്ടുമാറാത്ത വേദന ദിവസം നിങ്ങളുടെ ജീവിതത്തെയും മാനസിക ആരോഗ്യത്തെയും ബാധിക്കും. നാഡീവ്യവസ്ഥയിലൂടെ കടന്നുപോകുന്ന സന്ദേശങ്ങളുടെ പരമ്പരയിൽ നിന്ന് വേദന വരുന്നു. ഉപദ്രവിക്കുമ്പോൾ, ആ മേഖലയിലെ വേദന സെൻസറുകളിലാണു പരുക്കേറ്റവർ. അവർ ഒരു മെസേജ് അയക്കുന്നു ഒരു വൈദ്യുത സിഗ്നൽ, അത് തലച്ചോറിലെത്തുന്നതുവരെ ഞരമ്പിൽ നിന്ന് ഞരമ്പിലേക്ക് സഞ്ചരിക്കുന്നു. മസ്തിഷ്കം സിഗ്നലുകളെ പ്രോസസ് ചെയ്ത് ശരീരം ഉപദ്രവിക്കുന്ന സന്ദേശത്തെ അയക്കുന്നു.

സാധാരണ സാഹചര്യങ്ങളിൽ, വേദനയുടെ കാരണം പരിഹരിക്കപ്പെടുമ്പോൾ സിഗ്നൽ നിർത്തുന്നു, ശരീരം വിരൽത്തുമ്പിൽ അല്ലെങ്കിൽ മുറിവുണ്ടാക്കുന്ന പേശികൾ പുനഃസ്ഥാപിക്കുന്നു. എന്നാൽ വിട്ടുമാറാത്ത വേദന, നാവി സിഗ്നലുകൾ പരിക്കേറ്റ ശേഷവും വെടിവയ്ക്കുകയാണ്.

വിട്ടുമാറാത്ത വേദനയ്ക്ക് കാരണമാകുന്ന വ്യവസ്ഥകൾക്ക് വ്യക്തമായ കാരണമില്ലാതെ ആരംഭിക്കാൻ കഴിയും. എന്നാൽ പലർക്കും ഇത് ഒരു പരിക്ക് ശേഷം ആരംഭിക്കും. മുൻനിര കാരണങ്ങളിൽ ചിലത്:

സന്ധിവാതം

തിരികെ പ്രശ്നങ്ങൾ

ഫൈബ്രോമലാജിയ, ജനങ്ങൾ ശരീരത്തിലുടനീളം പേശി വേദന അനുഭവിക്കുന്ന ഒരു അവസ്ഥയാണ്

അണുബാധ

മൈഗ്രെയിനുകളും മറ്റ് തലവേദനകളും

നാഡി ക്ഷതം

കഴിഞ്ഞ പരിക്കുകൾ അല്ലെങ്കിൽ ശസ്ത്രക്രിയകൾ

ലക്ഷണങ്ങൾ

ഈ വേദന മൃദുലവും കടുത്തതുമാണ്, ദിവസത്തിനു ശേഷമോ, വരുകയോ പോകാം. ഇത് പോലെ തോന്നും:

ഒരു മുഷിഞ്ഞ വേദന

ബേൺ ചെയ്യുന്നു

ഷൂട്ടിംഗ്

ക്ഷീണം

ഞെരുക്കം

ദൃഢത

തട്ടിപ്പ്

മിടിക്കുന്ന

എന്തെങ്കിലും ചോദ്യങ്ങൾക്കുള്ള ഉത്തരങ്ങൾ നിങ്ങൾക്ക് ഡോ. ജിമെനെസ് എന്നയാൾ വിളിക്കാം 915-850-0900


ഇന്റഗ്രേറ്റീവ് ടെസ്റ്റിംഗിലേക്കുള്ള ഒരു പ്രവർത്തനപരമായ സമീപനം

ഇന്റഗ്രേറ്റീവ് ടെസ്റ്റിംഗിലേക്കുള്ള ഒരു പ്രവർത്തനപരമായ സമീപനം

പരിസ്ഥിതി പ്രേരിത ഓട്ടോ ഇമ്മ്യൂണിറ്റിയിലെ പ്രവർത്തനപരമായ സമീപനത്തിൽ പ്രത്യേകതയുള്ള ഒരു നൂതന ക്ലിനിക്കൽ ലബോറട്ടറിയാണ് സൈറക്സ് ലബോറട്ടറീസ്. മെഡിക്കൽ ഗവേഷണത്തിലെ മുൻ‌നിര വിദഗ്ധരുമായി സൈറെക്സ് പ്രവർത്തിക്കുകയും ശരീര സംവിധാനങ്ങളിലുടനീളം ക്രോസ്-കണക്ഷനുകളെ അഭിസംബോധന ചെയ്യുന്ന അറേകൾ നൽകുകയും ചെയ്യുന്നു. ഇതിനുപുറമെ, സിറക്സ് ഏറ്റവും കൃത്യവും നൂതനവുമായ സാങ്കേതികവിദ്യ എല്ലായ്പ്പോഴും മെച്ചപ്പെടുത്തിക്കൊണ്ട് രോഗികൾക്ക് മികച്ച നിലവാരം നൽകാൻ ശ്രമിക്കുന്നു.

അറേ

രോഗലക്ഷണങ്ങളെ ആശ്രയിച്ച് രോഗികളെ പരീക്ഷിക്കാൻ അവർ ഉപയോഗിക്കുന്ന ഒന്നിലധികം അറേകൾ സിറക്‌സിനുണ്ട്. ഈ ശ്രേണികൾ അൽഷിമേഴ്‌സ് മുതൽ ജോയിന്റ് ഓട്ടോ-ഇമ്മ്യൂൺ റിയാക്റ്റിവിറ്റി സ്ക്രീനിംഗ് വരെയാണ്. മിക്കപ്പോഴും, സന്ധികളോ തലവേദനയോ വേദനയോ ഉള്ള രോഗികളെ ഒരു അടിസ്ഥാന പ്രശ്നത്തിലേക്ക് കണ്ടെത്താനാകും. ഒരു രോഗി ഒരു ഡോക്ടറുടെ അടുത്തെത്തുമ്പോൾ, പ്രാക്ടീഷണർ രോഗിയെ അവർ കൊണ്ടുവരുന്ന ലക്ഷണങ്ങളെ അടിസ്ഥാനമാക്കി വിലയിരുത്തുകയും വിലയിരുത്തുകയും ചെയ്യും. ഇവിടെ നിന്ന്, പരിശീലകന് സൈറക്സിൽ പോയി അവരുടെ രോഗിയുടെ ആവശ്യങ്ങൾക്ക് അനുയോജ്യമായ അറേകൾ ക്രമീകരിക്കാൻ കഴിയും. സൈറക്സ് സിസ്റ്റം രോഗപ്രതിരോധ പ്രവർത്തനത്തെ ചുറ്റിപ്പറ്റുകയും തലച്ചോറ്, ഹൃദയം, പാൻക്രിയാസ്, നാഡീവ്യൂഹം, കരൾ, ദഹനനാളം, അസ്ഥികൾ, സന്ധികൾ എന്നിവയുൾപ്പെടെ ശരീരത്തിലെ ഒന്നിലധികം ടിഷ്യുകളെ ബാധിക്കുന്ന ഐഡന്റിഫയറുകളെ അളക്കുകയും ചെയ്യുന്നു. ഈ ലാബുകളുടെ സമയക്രമീകരണം വളരെ വേഗത്തിലാണ്, മാത്രമല്ല രോഗിയുടെ ലക്ഷണങ്ങളുടെ അടിസ്ഥാന റൂട്ട് ഹൈലൈറ്റ് ചെയ്യാൻ ഇത് സഹായിക്കുന്നു.

സ്ക്രീൻഷോട്ട് (54) .png

സിറക്സ് അറേകൾ അവരുടെ പ്രധാന പരിശോധനാ രൂപമായി സെറം (ബ്ലഡ് ഡ്രോ) ഉപയോഗിക്കുന്നു. ഡോക്ടർ നിർദ്ദേശിക്കുന്ന ശ്രേണി പരിഗണിക്കാതെ തന്നെ, രോഗിക്ക് ഒരേ കിറ്റ് ലഭിക്കും. കിറ്റിനുള്ളിലുള്ള അഭ്യർത്ഥന ഫോം ഫ്ളെബോടോമിസ്റ്റിനും ലാബിനും പ്രാധാന്യമുള്ള കാര്യമാണ്, ഇവിടെയാണ് ഓർഡർ ചെയ്ത അറേ അടയാളപ്പെടുത്തുന്നത്.

സിറക്സ് ലബോറട്ടറീസ്, സെറം കളക്ഷൻ കിറ്റ് എന്ന് ലേബൽ ചെയ്തിട്ടുള്ള ഒരു ചെറിയ ബോക്സാണ് കിറ്റ്. ശേഖരിച്ച കിറ്റിന്റെ മുകളിൽ ഒരു ഷിപ്പിംഗ് ലേബലും സാമ്പിൾ ശേഖരിച്ചുകഴിഞ്ഞാൽ പോകാനുള്ള ബാഗും ആയിരിക്കും. കിറ്റിനുള്ളിൽ ഒരു ചെറിയ സ്റ്റൈറോഫോം ബോക്സ് ഉണ്ട്, അതിൽ ഒരു സെറം സെപ്പറേറ്റർ ട്യൂബ്, ഒരു സെറം ട്രാൻസ്പോർട്ട് ട്യൂബ്, ട്യൂബ് ലേബലുകൾ, ഒരു ബയോഹാസാർഡ് ബാഗ്, ശേഖരണ നിർദ്ദേശങ്ങൾ എന്നിവ ഉൾപ്പെടുന്നു.

മുകളിലുള്ള ഫോട്ടോയിൽ നിന്ന് ഒരാൾക്ക് കാണാനാകുന്നതുപോലെ, വ്യത്യസ്ത അറേകൾ വ്യത്യസ്ത പ്രതികരണങ്ങൾ / അവസ്ഥകൾക്കായി പരിശോധിക്കുന്നു. രോഗിയെ ആശ്രയിച്ച് ഒരു ഡോക്ടർക്ക് ഒന്നോ അതിലധികമോ അറേകൾ ഓർഡർ ചെയ്യാം.

മിക്ക അമേരിക്കക്കാരെയും ബാധിക്കുന്ന ഒരു അവസ്ഥയാണ് ചോർച്ചയുള്ള കുടൽ എന്നതിനാൽ അറേ എക്സ്എൻ‌എം‌എക്സ് ഏറ്റവും പ്രചാരമുള്ള ഒന്നാണ്. ലിപ്പോപൊളിസാച്ചറൈഡുകളുടെയും ഒക്ലുഡിൻ / സോനുലിന്റെയും IgG, IgA, IgM എന്നിവയ്‌ക്കായുള്ള ഈ പരിശോധന സ്‌ക്രീനുകൾ.

സംയോജിത പരിശോധന

മിക്കപ്പോഴും, പ്രാക്ടീഷണർമാർ ഒരു രോഗിയിൽ ഒന്നിലധികം ലാബ് കമ്പനികൾ ഉപയോഗിക്കും. ഇത് മറ്റൊന്നിനേക്കാൾ ശ്രേഷ്ഠമായതിനാലല്ല, മറിച്ച് അവർ വിവിധ മേഖലകളിൽ പ്രാവീണ്യം നേടിയതിനാലാണ്. വിവിധ കമ്പനികളിൽ നിന്ന് ലാബുകൾക്ക് ഡോക്ടർ ഓർഡർ നൽകാമെങ്കിലും, ഇത് രോഗിയുടെ ഏറ്റവും നല്ല താൽപ്പര്യമാണ്, കാരണം അടിസ്ഥാന പ്രശ്‌നം ശരിക്കും മനസിലാക്കാൻ ഒന്നിലധികം മേഖലകൾ കാണുന്നതിന് ഇത് പരിശീലകനെ അനുവദിക്കുന്നു.

സന്ധിവേദന, തലവേദന, ഉറങ്ങാൻ ബുദ്ധിമുട്ട്, ഉറങ്ങാൻ ബുദ്ധിമുട്ട്, ചോർച്ചയുള്ള കുടൽ, മസ്തിഷ്ക മൂടൽമഞ്ഞ് തുടങ്ങിയ ലക്ഷണങ്ങളുമായി വരുന്ന രോഗികൾക്ക് ഒന്നിലധികം ലാബ് കമ്പനികൾ ഉപയോഗിക്കുന്നതിലൂടെ തീർച്ചയായും പ്രയോജനം ലഭിക്കും.

Cyrex array 2, DUTCH + CAR എന്നിവ ഉപയോഗിച്ച് രോഗിക്ക് അവരുടെ ശരീരത്തിൽ സംഭവിക്കുന്ന കാര്യങ്ങളെക്കുറിച്ച് വളരെ കൃത്യമായ വിവരങ്ങൾ ലഭിക്കും. രോഗിക്ക് ചോർച്ചയുണ്ടെന്നും എത്ര കഠിനമാണെന്നും സിറക്സ് അറേ പരിശോധന പരിശീലകനെ കാണിക്കും. വ്യക്തിയുടെ ശരീരത്തിലെ കോർട്ടിസോൾ പാറ്റേണുകൾ നിർണ്ണയിക്കാൻ DUTCH + CAR ഡോക്ടറെ അനുവദിക്കുന്നു. ചിലപ്പോൾ, ഈ അളവ് ശരിയായ സമയത്ത് ഉയരുകയോ വീഴുകയോ ചെയ്യുന്നില്ല, ഇത് രോഗിയെ തളർത്തുകയോ ഉറങ്ങാൻ ബുദ്ധിമുട്ടുകയോ ചെയ്യുന്നു.

രോഗിയുടെ ആരോഗ്യം എല്ലായ്പ്പോഴും ഒന്നാമതായിരിക്കണം, കൂടാതെ ഒന്നിലധികം ലാബുകൾ ഉപയോഗിക്കാൻ ഡോക്ടർമാർക്ക് അറിവുണ്ടെങ്കിൽ, രോഗിയുടെ നേട്ടങ്ങൾ മികച്ചതാണ്. കമ്പനികളെ ഒരുമിച്ച് ഉപയോഗിക്കുന്നതിലൂടെ, ഡോക്ടർക്ക് ഒന്നിലധികം മേഖലകൾ പരിശോധിക്കാൻ കഴിയും, ഒരു ചികിത്സാ പ്രോട്ടോക്കോൾ വരുമ്പോൾ ess ഹങ്ങളൊന്നും അവശേഷിക്കുന്നില്ല. എന്നിരുന്നാലും, രോഗിയുടെ ആവശ്യങ്ങൾക്കനുസരിച്ച് ലാബുകൾ വ്യത്യാസപ്പെടുന്നു എന്നത് ഓർത്തിരിക്കേണ്ടത് പ്രധാനമാണ്. ചില രോഗികൾക്ക് എല്ലാ ലാബുകൾക്കും ഒരേ കമ്പനി ഉപയോഗിക്കാനും അവർക്ക് ആവശ്യമായ കൃത്യമായ ഫലങ്ങൾ നേടാനും കഴിയും.

സിറക്സ് നിരവധി നിബന്ധനകൾ‌ക്കായി പരിശോധിക്കുകയും ഒന്നിലധികം അറേകൾ‌ ഉണ്ട്. പലരും ആണെങ്കിലും

പ്രാക്ടീഷണർമാർക്കും ഹെൽത്ത് കോച്ചുകൾക്കും ഉപയോഗിക്കുന്നതിനുള്ള മികച്ച ഉപകരണമാണ് സൈറക്സ് ലാബുകൾ! ഈ ശ്രേണികൾ‌ ഉപയോഗിക്കുന്നതിലൂടെ, ഇത്‌ രോഗലക്ഷണങ്ങളെ ചികിത്സിക്കാൻ‌ മാത്രമല്ല, റൂട്ട് ഉറവിടത്തിൽ‌ പ്രശ്‌നത്തെ ചികിത്സിക്കാൻ‌ ആവശ്യമായ ഉൾക്കാഴ്‌ചയും പരിശീലകനെ സഹായിക്കുന്നു. മനുഷ്യശരീരത്തിൽ ഉണ്ടാകാനിടയുള്ള സങ്കീർണമായ വൈകല്യങ്ങൾ വിലയിരുത്തുന്നതിന് സിറക്സ് നൽകുന്ന ഉപകരണങ്ങൾ വളരെയധികം മുന്നോട്ട് പോകുന്നു. സിറക്സ് ഉപയോഗിക്കുന്നതിലൂടെയും ഡച്ച് അല്ലെങ്കിൽ ലാബ്രിക്സിൽ നിന്നുള്ള മറ്റ് പരിശോധനകളുമായി ഇത് സംയോജിപ്പിക്കുന്നതിലൂടെ, രോഗിക്ക് ശരിയായ ചികിത്സ നേടാനും അവർ ഇഷ്ടപ്പെടുന്നതും ആസ്വദിക്കുന്നതും ഉപയോഗിച്ച ഹോബികളിലേക്ക് മടങ്ങാനും കഴിയും. ഈ കമ്പനികളെല്ലാം അതിശയകരമാണ് ഒപ്പം വിവിധ മേഖലകളിൽ പ്രത്യേകതകൾ നൽകുന്നു. ഒന്നിൽ കൂടുതൽ കമ്പനികൾ ഉപയോഗിക്കുന്നതിലൂടെ, പാറ്റിന്റിന് മികച്ച ഫലങ്ങൾ ലഭിക്കുന്നു, ഒപ്പം ലഭിച്ച എല്ലാ വിവരങ്ങളും ഉപയോഗിച്ച് സോളിഡ് ട്രീറ്റ്മെന്റ് പ്രോട്ടോക്കോൾ നിർമ്മിക്കാൻ ഡോക്ടർമാർക്ക് കഴിയും. - കെന്ന വോൺ, സീനിയർ ഹെൽത്ത് കോച്ച്

* എല്ലാ വിവരങ്ങളും Cyrex.com ൽ നിന്ന് ലഭിച്ചു

ഞങ്ങളുടെ വിവരങ്ങളുടെ വ്യാപ്തി കൈറോപ്രാക്റ്റിക്, മസ്കുലോസ്കലെറ്റൽ, നാഡീ ആരോഗ്യ പ്രശ്നങ്ങൾ, കൂടാതെ ഫംഗ്ഷണൽ മെഡിസിൻ ലേഖനങ്ങൾ, വിഷയങ്ങൾ, ചർച്ചകൾ എന്നിവയിൽ പരിമിതപ്പെടുത്തിയിരിക്കുന്നു. പരിക്കുകൾ അല്ലെങ്കിൽ മസ്കുലോസ്കലെറ്റൽ സിസ്റ്റത്തിന്റെ വിട്ടുമാറാത്ത തകരാറുകൾ എന്നിവ ചികിത്സിക്കാൻ ഞങ്ങൾ ഫംഗ്ഷണൽ ഹെൽത്ത് പ്രോട്ടോക്കോളുകൾ ഉപയോഗിക്കുന്നു. മുകളിലുള്ള വിഷയം കൂടുതൽ ചർച്ച ചെയ്യുന്നതിന്, ഡോ. അലക്സ് ജിമെനെസിനോട് ചോദിക്കാൻ മടിക്കേണ്ടതില്ല അല്ലെങ്കിൽ 915-850-0900 ൽ ഞങ്ങളെ ബന്ധപ്പെടുക.

ശിശുരോഗ ചികിത്സയിലൂടെ വിട്ടുമാറാത്ത വേദന എൽ പാസോ, ടെക്സസ്

ശിശുരോഗ ചികിത്സയിലൂടെ വിട്ടുമാറാത്ത വേദന എൽ പാസോ, ടെക്സസ്

വ്യക്തികൾ അവരുടെ ലക്ഷണങ്ങളെക്കുറിച്ചുള്ള കൃത്യമായ വേദനയും അവരുടെ മൊത്തത്തിലുള്ള ആരോഗ്യത്തെയും ബാധിച്ചു. കൈറോപ്രാക്റ്റിക് ചികിത്സ ലഭിച്ചിട്ടും, ഡോക്ടർ അലക്സ് ജിമെനെസ് തങ്ങളുടെ സാധാരണ ജീവിതത്തിലേക്ക് തിരികെ എത്താൻ സഹായിച്ചത് എങ്ങനെയെന്ന് രോഗികൾ വിവരിക്കുന്നു.

ചികിൽസാകൃതി ചികിത്സ എന്നത് പലതരത്തിലുള്ള ആരോഗ്യ പ്രശ്നങ്ങളുടെ രോഗനിർണയത്തിനും ചികിത്സയ്ക്കും തടയുന്നതിനും ഊന്നൽ നൽകുന്നു വ്യക്തിപരമായ പരിക്കുകൾ. രോഗികൾക്ക് ഡോ. ജിമെനെസ്, അവന്റെ സ്റ്റാഫ് എന്നിവയെ ആശ്രയിക്കാം ശിശുരോഗ ചികിത്സയിലൂടെ വിട്ടുമാറാത്ത വേദന.

എൽ പാസോ ബാക്ക് ക്ലിനിക്

ക്രോമസോം ചികിത്സയ്ക്കായി വിസ്ത ദൽ സോൾ ക്രോണിക് പെയിൻ ആശ്വാസം | എൽ പാസോ, ടെക്സസ്

ഞങ്ങൾ നിങ്ങൾക്കു കാണിച്ചുതരാം എൽ പാസോയുടെ പ്രീമിയർ വെൽനെസ് ആൻഡ് ഇൻജുറി കെയർ ക്ലിനിക്.

ഞങ്ങളുടെ സേവനങ്ങൾ സ്പെഷ്യലൈസ് ചെയ്തവയാണ്, പരിക്കുകളും പൂർണ്ണമായ വീണ്ടെടുക്കൽ പ്രക്രിയയും ആണ്. ഞങ്ങളുടെ മേഖലകൾ ഉൾപ്പെടുന്നു ആരോഗ്യവും പോഷകാഹാരവും, വിട്ടുമാറാത്ത വേദന, വ്യക്തിപരമായ അപമാനം, വാഹന അപകട സംരക്ഷണം, ജോലി പരിക്കുകൾ, ബാക്ക് ട്രീറ്റ്മെന്റ്, ലോ പുറം വേദന, കഴുത്തു വേദന, മൈഗ്രെയ്ൻ ചികിത്സ, കായിക പ്രശ്നങ്ങൾ, കഠിനമായ സൈറ്റികാ, സ്കോളിയോസിസ്, കോംപ്ലക്സ് ഹർണിയേറ്റഡ് ഡിസ്ക്കുകൾ, Fibromyalgia, ചിരകാല വേദന, സ്ട്രെസ്സ് മാനേജ്മെന്റ്, കോംപ്ലക്സ് പരിക്കുകൾ എന്നിവ.

എൽ-പാസോയുടെ ചികിൽസാകൃഷി പുനരധിവാസ ക്ലിനിക്കവും ഇന്റഗ്രേറ്റഡ് മെഡിസിൻ സെന്ററും എന്ന നിലയിൽ, പരുക്കേറ്റ പരിക്കുകളോടെയും വിട്ടുമാറാത്ത വേദന സിൻഡ്രോമുകളുടെയും ഫലമായി രോഗികൾക്ക് ചികിത്സ നൽകുന്നു. എല്ലാ പ്രായവിഭാഗങ്ങൾക്കും വൈകല്യങ്ങൾക്കും അനുയോജ്യമായ വഴക്കവും ചലനാത്മകവും വേഗവുമുളള പ്രവർത്തനങ്ങളിലൂടെ നിങ്ങളുടെ കഴിവ് മെച്ചപ്പെടുത്തുന്നതിന് ഞങ്ങൾ ശ്രദ്ധ കേന്ദ്രീകരിക്കുന്നു.

നിങ്ങൾ കൂടുതൽ ഊർജ്ജം, നല്ല മനോഭാവം, മെച്ചപ്പെട്ട ഉറക്കം, കുറവ് വേദന, ശരിയായ ശരീരഭാരം എന്നിവ ജീവിതത്തിൽ എങ്ങനെ നിലനിർത്തണമെന്ന് പഠിപ്പിച്ച ഒരു ജീവിതം നിങ്ങൾക്ക് ജീവിക്കാൻ ഞങ്ങൾ ആഗ്രഹിക്കുന്നു.

ഞങ്ങൾക്ക് നിങ്ങളെ ട്രാക്കുചെയ്യാൻ കഴിയും!

ക്രോമസോം ചികിത്സയ്ക്കായി വിസ്ത ദൽ സോൾ ക്രോണിക് പെയിൻ ആശ്വാസം | എൽ പാസോ, ടെക്സസ്

നിങ്ങൾ ഈ വീഡിയോ ആസ്വദിക്കുകയും ഞങ്ങളൊന്ന് ഏതെങ്കിലും വിധത്തിൽ നിങ്ങളെ സഹായിക്കുകയും ചെയ്തിട്ടുണ്ടെങ്കിൽ, ദയവായി മടിക്കേണ്ട സബ്സ്ക്രൈബുചെയ്യുന്നതിനും ഒപ്പം ഞങ്ങളെ ശുപാർശ ചെയ്യുക.

ശുപാർശ: ഡോ. അലക്സ് ജിമെനെസ് - ആർഎൻ, ഡിസി, എംഎസ്എസിപി, സിസിഎസ്ടി

ആരോഗ്യ ഗ്രേഡുകൾ: http://www.healthgrades.com/review/3SDJ4

ഫേസ്ബുക്ക് ക്ലിനിക്കൽ പേജ്: https://www.facebook.com/dralexjimene…

Facebook സ്പോർട്സ് പേജ്: https://www.facebook.com/pushasrx/

ഫേസ്ബുക്ക് പരിക്കുകൾ പേജ്: https://www.facebook.com/elpasochirop…

ഫേസ്ബുക്ക് ന്യൂറോപാതി പേജ്: https://www.facebook.com/ElPasoNeurop…

സഹായം: എൽ പാസ്വോ റിഹാബിലിറ്റേഷൻ സെന്റർ: http://goo.gl/pwY2n2

സഹായം: എൽ പാസോ ക്ലിനിക്കൽ സെന്റർ: ചികിത്സ: https://goo.gl/r2QPuZ

ക്ലിനിക്കൽ സാക്ഷ്യപത്രങ്ങൾ: https://www.dralexjimenez.com/categor…

വിവരം: ഡോ. അലക്സ് ജിമെനെസ് - ശസ്ത്രക്രിയാ വിദഗ്ധൻ

ക്ലിനിക്കൽ സൈറ്റ്: https://www.dralexjimenez.com

മുറിവ് സൈറ്റ്: https://personalinjurydoctorgroup.com

സ്പോർട്സ് ഉപദ്രവം സൈറ്റ്: https://chiropracticscientist.com

തിരികെ പരിക്കുള്ള സൈറ്റ്: https://www.elpasobackclinic.com

Pinterest: https://www.pinterest.com/dralexjimenez/

ട്വിറ്റർ: https://twitter.com/dralexjimenez

ട്വിറ്റർ: https://twitter.com/crossfitdoctor

ശുപാർശ: പുഷ്പത്തെ പോലെ-ആർക്സ് ® ™

പുനരധിവാസകേന്ദ്രം: https://www.pushasrx.com

ഫേസ്ബുക്ക്: https://www.facebook.com/PUSHftinessa…

പുഷ്-ആർ-റെക്സ്: http://www.push4fitness.com/team/

പ്രമേഹവും വിട്ടുമാറാത്ത വേദനയും

പ്രമേഹവും വിട്ടുമാറാത്ത വേദനയും

അടുത്തകാലത്തെ ഗവേഷണ പഠനമനുസരിച്ച് പ്രമേഹരോഗികളായ വ്യക്തികളിൽ നെഞ്ചുവേദനയും വേദനയും ഉണ്ടാകാൻ സാധ്യതയുള്ള ഒരു എൻഎക്സ്എക്സ്എഫ് ആകാം. പ്രമേഹരോഗികളായ വ്യക്തികൾ നെഞ്ചുവേദനയും വേദനയും വളർത്തുന്നതിനുള്ള സാധ്യത കൂടുതലാണെന്ന് കണ്ടെത്തിയ എട്ട് ഗവേഷണ പഠനങ്ങൾ ഗവേഷകർ നടത്തി. പ്രമേഹരോഗികളായവരിൽ ഗണ്യമായ വേദന സാധാരണമാണ്.

ജനസംഖ്യയിൽ എത്തുന്നവരിൽ ഏതാണ്ട് എൺപതു ശതമാനം പേർക്ക് ജീവിതകാലം മുഴുവൻ തുള്ളി വേദന അനുഭവപ്പെടാറുണ്ടെന്നും ആ സംഖ്യയിൽ ഏതാണ്ട് പകുതി പേർക്കും നെഞ്ചുവേദനയുണ്ടാകുമെന്നും ഗവേഷകർ അഭിപ്രായപ്പെടുന്നു. അതേസമയം, പ്രമേഹം ഒരു പൊതു ആരോഗ്യ പ്രശ്നമായി മാറിയിരിക്കുന്നു. വേൾഡ് ഹെൽത്ത് ഓർഗനൈസേഷൻറെ അഭിപ്രായത്തിൽ, 80 ദശലക്ഷം വ്യക്തികളെ ടൈപ്പ് ചെയ്യുമ്പോൾ XXX പ്രമേഹ രോഗമാണ്.

പ്രമേഹ ചികിത്സാ പദ്ധതികൾ നടപ്പിലാക്കിയെങ്കിലും പ്രമേഹവും വേദനയും തമ്മിൽ ഒരു കാരണ ബന്ധം സ്ഥാപിക്കാൻ മതിയായ തെളിവുകൾ ഇല്ലാത്തതായും കണ്ടെത്തിയിട്ടുണ്ട്. "മാനുവൽ ഫെരേര, പിഎച്ച്ഡി, ഗവേഷക പഠനത്തിന്റെ മുതിർന്ന എഴുത്തുകാരനും യൂണിവേഴ്സിറ്റി ഇൻസ്റ്റിറ്റ്യൂട്ട് ഓഫ് ബോൺ ജോയിന്റ് റിസേർച്ച്. "തെളിവുകൾ ആവശ്യമാണ് ഈ സ്ഥാപനത്തിന്റെ കൂടുതൽ വിലയിരുത്തൽ ആവശ്യമാണ്," അദ്ദേഹം വിശദീകരിച്ചു.

"ടൈപ്പ് എക്സപ്ഷനുകളും ടൈം വേദനയും ടൈപ്പ് ചെയ്യുക. ശാരീരികാധ്വാനമോ വ്യായാമക്കുറവോ പൊണ്ണത്തടിയോ ഉണ്ടാവില്ല. ടിവീട്ഈ പരിപാടി നടപടികൾ കൂടുതൽ വിശദമായി വിലയിരുത്തുന്നതിന് ഗവേഷണ പഠനത്തിന്റെ ഒരു ലോജിക്കൽ വികസനം ആവശ്യമാണ്. "ശരീരഭാരം, മാനസിക ആരോഗ്യം, ഭൗതിക പ്രവർത്തനം, വ്യായാമം തുടങ്ങിയവയെല്ലാം നമ്മുടെ മൂല്യനിർണയം തെളിയിക്കുന്നു."

പ്രമേഹ മരുന്ന് കൂടാതെ / അല്ലെങ്കിൽ മരുന്നുകൾ പുറമേ രക്തത്തിലെ പഞ്ചസാരയുടെ അളവ് അതിന്റെ ഫലമായി, വിട്ടുമാറാത്ത വേദന സ്വാധീനിക്കും ഗവേഷണ പഠനം തെളിയിച്ചു. എന്നിരുന്നാലും, ഈ കണക്ഷനും കൂടുതൽ ഗവേഷണ പഠനങ്ങൾ ആവശ്യമാണ്. കൂടാതെ, വേദനയോ നെഞ്ചുവേദനയോ പോലുള്ള വിട്ടുമാറാത്ത വേദനയ്ക്കായി നോക്കുന്ന രോഗികളിൽ പ്രമേഹ രോഗികൾക്ക് ആരോഗ്യപരിപാലന പരിപാടികൾ പരിഗണിക്കണമെന്ന് ഗവേഷണ പഠനങ്ങൾ പ്രോത്സാഹിപ്പിക്കുന്നു.

ഡോ ജിമനെസ് വൈറ്റ് കോട്ട്

വിട്ടുമാറാത്ത വേദന പ്രമേഹമുള്ള പല വ്യക്തികളെയും ബാധിക്കുന്നു. വിട്ടുമാറാത്ത വേദന ഏറ്റവും സാധാരണമായ തരം frസമചിത്തതയോടെ പ്രമേഹരോഗികളായ രോഗികൾ കഴുത്ത് വേദന, പുറം വേദന, കൈകൾക്കും കാലുകൾക്കുമുള്ള ന്യൂറോപാത്തിക് വേദന എന്നിവയാണ്. വിട്ടുമാറാത്ത വേദന ഒരാളുടെ ദൈനംദിന ശാരീരിക പ്രവർത്തനങ്ങളെ ബാധിക്കും. ഗവേഷകരുടെ അഭിപ്രായത്തിൽ, പ്രമേഹരോഗികൾക്കുണ്ടാകുന്ന ദീർഘനാളത്തെ വേദന വളരുന്നതിന് സാധ്യത കൂടുതലാണ്, അല്ലെങ്കിൽ ആറ് മാസത്തിലധികം നിലനിൽക്കുന്ന വേദനാജനകമായ ലക്ഷണങ്ങൾ.

ഡോ. അലക്സ് ജിമനേസ് DC, CCST ഇൻസൈറ്റ്

ഈ ചിത്രത്തിന് ഒരു ശൂന്യമായ ആട്രിബ്യൂട്ട് ഉണ്ട്; ഇതിന്റെ ഫയൽ നാമം ഇമേജ്-3.png ആണ്

ഇപ്പോൾ വാങ്ങുക സൌജന്യ ഷിപ്പിംഗ്

ഞങ്ങളുടെ വിവരങ്ങളുടെ പരിധി ചിപ്പിപ്പാക്ക്, സുഷുമ്നൽ ഹെൽത്ത് പ്രശ്നങ്ങൾ, ഫംഗ്ഷണൽ മെഡിസിൻ ലേഖനങ്ങൾ, വിഷയങ്ങൾ, ചർച്ചകൾ എന്നിവയിലേക്ക് പരിമിതപ്പെടുത്തിയിരിക്കുന്നു. മുകളിലെ വിഷയത്തെക്കുറിച്ച് കൂടുതലറിയാൻ ഡോ. അലക്സ് ജിമെനെസ് ചോദിക്കാൻ മടിക്കരുത് അല്ലെങ്കിൽ ഞങ്ങളെ ബന്ധപ്പെടുക 915-850-0900 .

ഡോ. അലക്സ് ജിമെനെസ് ക്യൂറാണ്

പച്ച കോൾ ഇപ്പോൾ ബട്ടൺ എച്ച് .png

കൂടുതൽ വിഷയം ചർച്ച: അക്യുട്ട് ബാക്ക് വേദന

പുറം വേദന ലോകമെമ്പാടും വൈകല്യമുള്ളതും നഷ്ടപ്പെടാത്തതുമായ ദിവസങ്ങളിൽ ഏറ്റവും കൂടുതലായ കാരണങ്ങൾ. ഡോക്ടർ ഓഫീസ് സന്ദർശനങ്ങൾക്കുള്ള രണ്ടാമത്തെ ഏറ്റവും സാധാരണ കാരണം ചൂണ്ടിക്കാണിക്കുന്നു. മുതിർന്ന ശ്വാസോച്ഛ്വാസം മൂലമുള്ള രോഗം മാത്രം. ജനസംഖ്യയിൽ ഏതാണ്ട് എട്ടുശതമാനം പേർക്ക് അവരുടെ ജീവിതകാലം മുഴുവൻ ഒരു വേദന ഒരിക്കൽ അനുഭവപ്പെടും. അസ്ഥികൾ, സന്ധികൾ, കട്ടിലുകൾ, പേശികൾ തുടങ്ങി മൃദുല കോശങ്ങളുള്ള ഒരു സങ്കീർണ്ണ ഘടനയാണ് നിങ്ങളുടെ നട്ടെല്ല്. പരുക്കുകളും ഒപ്പം / അല്ലെങ്കിൽ അഴുകിയ അവസ്ഥകളും ഹാർനിയേറ്റഡ് ഡിസ്ക്കുകൾ, ഒടുവിൽ മുടി വേദനയുടെ ലക്ഷണങ്ങളായി മാറുന്നു. സ്പോർട്സ് പരിക്കുകൾ അല്ലെങ്കിൽ വാഹനാപകടങ്ങൾ പലപ്പോഴും മുടി വേദനയ്ക്ക് ഇടയാക്കുന്നു, ചിലപ്പോൾ ചലനങ്ങളുടെ ലളിതമായ വേദനയ്ക്ക് വേദനയേറിയ ഫലങ്ങൾ ഉണ്ടാകാം. ഭാഗ്യവശാൽ, ചികിൽസാകൃതിയിലുള്ള സംരക്ഷണം പോലെയുള്ള ബദൽ ചികിൽസാരീതികൾ, നട്ടെല്ലിൽ മാറ്റം വരുത്താനും നട്ടെല്ലിൽ മാറ്റം വരുത്താനും സഹായകരമാകും, ഇത് ആത്യന്തികമായി വേദനയുടെ ആശ്വാസം വർദ്ധിപ്പിക്കും.

Xymogen ഫോർമുലകൾ - എൽ പാസോ, TX

XYMOGEN ന്റെ ലൈസൻസുള്ള പ്രൊഫഷണൽ പ്രൊഫഷണലുകൾ മുഖേന സവിശേഷ പ്രൊഫഷണൽ ഫോർമുലകൾ ലഭ്യമാണ്. XYMOGEN ഫോർമുലകളുടെ ഇൻറർനെറ്റ് വിൽപ്പനയും ഡിസ്കൗണ്ടിയും കർശനമായി നിരോധിച്ചിരിക്കുന്നു.

അഹങ്കാരമായി, ഡോ. അലക്സാണ്ടർ ജിമെനെസ് XYMOGEN സൂത്രവാക്യം നമ്മുടെ ശ്രദ്ധയിൽപ്പെട്ട രോഗികൾക്ക് മാത്രം ലഭ്യമാക്കുന്നു.

അടിയന്തിര പ്രവേശനത്തിനായി ഡോക്ടർ കൺസൾട്ടേഷൻ ഏർപ്പെടുത്താൻ ഞങ്ങളുടെ ഓഫീസിൽ വിളിക്കുക.

നിങ്ങൾ ഒരു രോഗിയാണെങ്കിൽ ഇൻജറി മെഡിക്കൽ & ഷിറോക്രാക് ക്ലിനിക്ക്, നിങ്ങളെ വിളിച്ചാൽ XYMOGEN എന്നതിനെക്കുറിച്ച് അന്വേഷിക്കാം 915-850-0900.

xymogen el paso, tx

നിങ്ങളുടെ സൗകര്യാർത്ഥം അവലോകനം ചെയ്യുക XYMOGEN ഉൽപ്പന്നങ്ങൾ ഇനിപ്പറയുന്ന ലിങ്ക് അവലോകനം ചെയ്യുക. *XYMOGEN- കാറ്റലോഗ്-ഇറക്കുമതി

* എല്ലാ XYMOGEN നയങ്ങളും കർശനമായി നിലവിലുണ്ട്.

***

TMD, Fibromyalgia എന്നിവയ്ക്കായി സ്വയം പരിചരണ വിദ്യകളുടെ നേട്ടങ്ങൾ

TMD, Fibromyalgia എന്നിവയ്ക്കായി സ്വയം പരിചരണ വിദ്യകളുടെ നേട്ടങ്ങൾ

തെറാപ്പി, കഴുത്ത് ഗാർഡുകൾ തുടങ്ങിയ ടെൻപോറോമാൻഡിബുലർ ഡിസോർഡേസ്, അല്ലെങ്കിൽ ടിഎംഡി എന്നിവയുമായി ബന്ധപ്പെട്ട മുഖാടിസ്ഥാനത്തിലുള്ള അസുഖമുള്ള ചികിത്സാരീതികളാണ്, ഇത്തരം രോഗങ്ങൾ സ്വാഭാവിക സംവിധാനങ്ങളെക്കാൾ വളരെ ഫലപ്രദമാണ്, ന്യൂ യോർക്ക് സിറ്റിയിലെ ന്യൂയോർക്ക് യൂണിവേഴ്സിറ്റിയിലെ ന്യൂയോർക്ക് യൂണിവേഴ്സിറ്റി കോളേജ് ഓഫ് ഡെന്റിസ്ട്രിയിലെ ഗവേഷകർ പ്രസിദ്ധീകരിച്ച ഒരു പുതിയ ഗവേഷണ പഠന പ്രകാരം.

ക്ലിനിക്കൽ ഓറൽ ഇൻവെലിഗേഷൻസിന്റെ ജേർണലിൽ പ്രസിദ്ധീകരിച്ച ഗവേഷണ പഠന പ്രകാരം, മസ്തിഷ്ക്കവുമായി ബന്ധപ്പെട്ട ടെംപെറോമെൻഡിബുലർ ഡിസോർഡേഴ്സ് അല്ലെങ്കിൽ ടിഎംഡി എന്നിവയെ സഹായിക്കാൻ സ്വയം പരിചരണ വിദ്യകൾ ഉപയോഗിക്കേണ്ടതുണ്ട്.

ടെംപറേൻഡാഡിബുലാർ സംയുക്തത്തിനുശേഷം ടിഎംജിയെ എപ്പോഴെങ്കിലും ടി.എം.ഡി എന്നു വിളിക്കുന്നു, ഇത് താടിയുള്ള ജോയിന്റേയും ചുറ്റുമുള്ള പേശികളിലും വളരുന്ന വേദനാജനകമായ അവസ്ഥകളുടെ ഒരു ശേഖരമാണ്. Myofascial temporomandibular disorder, അല്ലെങ്കിൽ mTMD, ഒരു സ്ത്രീയുടെ ബാധിക്കുന്ന ഒരു പേശീയം ആണ് സ്ത്രീകളുടെ 10 ശതമാനം. ടി.എം.ഡിയുമായുള്ള വ്യക്തികൾ പലപ്പോഴും വിട്ടുമാറാത്ത വേദനസംഭവങ്ങൾ അനുഭവിക്കുന്നു. ഗവേഷണ പഠനങ്ങൾ കണ്ടെത്തി, ടിഎഎംഡിയിലെ എൺപത് മുതൽ എൺപതു ശതമാനം വരെയാൾ ഫൈബ്രോയാൽജിയയും അനുഭവപ്പെടുന്നുണ്ട്.

ടി.എം.ഡി, ഫൈബ്രോമിയൽജിയ എന്നിവയ്ക്കുള്ള ചികിത്സകൾ

ദന്തരോഗ വിദഗ്ധരും രോഗികളും മുഖത്തെ മരുന്നുകൾ, സ്പ്ലിൻറുകൾ, കഴുത്ത് ഗാർഡുകൾ, വേദന മരുന്നുകൾ, നോൺസ്റ്റോറോയ്ഡൽ വിരുദ്ധ മരുന്നുകൾ, സ്വാഭാവിക സംരക്ഷണ രീതികൾ, ചൂട് കമ്പ്രസുകൾ തുടങ്ങിയവ കൈകാര്യം ചെയ്യാൻ സഹായിക്കുന്ന ചികിത്സാരീതികൾ പ്രയോജനപ്പെടുത്തുന്നു.

ഗവേഷണപഠന ഫലങ്ങളുടെ ഫലങ്ങളൊന്നും കണക്കിലെടുക്കാതെ ടി.എം.ഡിക്ക് പ്രാഥമികമായ ആദ്യ ചികിത്സാരീതിയാണ് ഓറൽ ഉപകരണങ്ങൾ. വിവിയൻ സാൻറിയാഗോ, പിഎച്ച്ഡി, എംപിഎച്ച്, ഓറൽ ആൻഡ് മാക്സില്ലോഫേഷ്യൽ പാത്തോളജി, റേഡിയോളജി, മെഡിസിൻ വിഭാഗത്തിലെ ഗവേഷക പഠന ശാസ്ത്രജ്ഞൻ എൻ.യു.യു. കോളേജ് ഓഫ് ഡെന്റിസ്ട്രി, ഗവേഷണ പഠനത്തിന്റെ മുൻനിര എഴുത്തുകാരൻ.

"വാക്കാലുള്ള സ്പ്ലിൻറുകൾ ചില ആനുകൂല്യങ്ങൾ കണ്ടെത്തിയപ്പോൾ, അവർ ചികിത്സിക്കുന്ന സമയത്ത് വ്യാപകമായ വേദന അനുഭവിക്കുന്ന രോഗികൾക്ക് ഇതുവരെ വിജയിച്ചിട്ടില്ല mTMD, "അവൾ വിശദീകരിച്ചു.

ഈ ഗവേഷണ പഠനത്തിൽ, MTMD- ൽ സ്ത്രീകൾക്ക് നോൺ-മരുന്നുകളുടെ പരിഹാരം അവരുടെ വേദന കൈകാര്യം ചെയ്യാൻ ഉപയോഗിച്ചു. വിജയകരമായ രോഗികളെ ഈ പരിഹാരമാർഗ്ഗങ്ങൾ എങ്ങനെ തിരിച്ചറിയുന്നുവെന്നും ഗവേഷകർ വിലയിരുത്തി. രോഗികൾക്കും രോഗികൾക്കും വ്യത്യാസമുണ്ടോ എന്നു പരിശോധിക്കുന്നതിനായി, ഫൈബ്രോമിയൽജിയയും എംടിഎമ്മിയും ഉള്ള നൂറോളം സ്ത്രീകൾ ഉൾപ്പെടെയുള്ള ഗവേഷകർ ഗവേഷകർ അഭിമുഖം നടത്തി.

വളരെ സാധാരണ ചികിത്സാരീതികളാണ് (ഇത് പങ്കെടുക്കുന്നവരിൽ എട്ടു ശതമാനം പേർ ഉപയോഗിക്കുന്നു), ഫിസിക്കൽ തെറാപ്പി (ഉപയോഗത്തിൽ പങ്കെടുക്കുന്നവരിൽ 59 പേർ), വീട്ടിലുണ്ടായിരുന്നവയുടെ വ്യായാമങ്ങൾ (ഇത് പങ്കെടുത്തവരിൽ 54 ശതമാനം) എന്നിവയാണ്. ഏറ്റവും കുറഞ്ഞ ചികിത്സാരീതികളാണ് അക്യൂപങ്ചർ (34 ശതമാനം ഉപയോഗിച്ചത്), ചിരപ്രകാശ പരിപാലനം (20 ശതമാനം ഉപയോഗിച്ചു), പോയിന്റ് കുത്തിവയ്പ്പുകൾ (18 ഉപയോഗപ്പെടുത്തി), യോഗ (ഉപയോഗപ്പെടുത്തിയത് 14 ശതമാനം), ധ്യാനം (7 ശതമാനം ഉപയോഗപ്പെടുത്തി) എന്നിവയാണ്. പങ്കെടുക്കുന്നവർ മിക്കപ്പോഴും ഒരു ചികിൽസയിലായിരുന്നു ഉപയോഗിച്ചിരുന്നത്.

ദന്തവൈദ്യം, യോഗ, ധ്യാനം, മസാജ്, ഊഷ്മാച്ചായ compresses തുടങ്ങിയ പരിചയസമ്പന്നരായ സ്വാശ്രയ വിദ്യകളിലെ അവരുടെ വേദനയിൽ പങ്കാളികൾ അവരുടെ വേദനയിൽ വളരെ മെച്ചപ്പെട്ടുവെന്ന് റിപ്പോർട്ട് ചെയ്യുകയും ചെയ്തു. വാമൊഴിയായി ഉപയോഗിക്കുന്നതിൽ പങ്കെടുത്തവരിൽ വെറും എട്ട് ശതമാനം പേർ മാത്രമാണ് അവരുടെ വേദന മെച്ചപ്പെടുത്താൻ സഹായിച്ചത്. വാമൊഴിയായി ഉപയോഗിക്കുന്ന വാക്യം ഉപയോഗിക്കുന്ന സ്ത്രീകളിൽ ഏതാണ്ട് എൺപതു ശതമാനം വരുന്നവർ ഇത് അവരുടെ വേദനയെ കൂടുതൽ വഷളാക്കിയെന്ന് പ്രസ്താവിച്ചു.

കെയർ റാഫേൽ, പിഎച്ച്ഡി എന്നിവ പ്രകാരം, മുഖത്തെ വേദന മെച്ചപ്പെടുത്തുന്നതിന് ഊർജ്ജ സംരക്ഷണ സാങ്കേതികവിദ്യയെ അതിലംഘിക്കുന്നതിൽ പരാജയപ്പെട്ടു. പ്രൊഫസർ ഗവേഷണ പഠനത്തിന്റെ സഹ-ഗ്രന്ഥകാരൻ, ഓറിയൽ ആൻഡ് മാക്സില്ലോഫേഷ്യൽ പാത്തോളജി, റേഡിയോളജി, ആൻഡ് മെഡിസിൻ, ന്യൂയോ യൂണിവേഴ്സിറ്റി കോളേജ് ഓഫ് ഡെന്റിസ്ട്രി എന്നിവിടങ്ങളിൽ.

"ചികിത്സയുടെ ആദ്യവരിയായി സ്വയം പരിചരണ സമ്പ്രദായങ്ങളെ ഉപയോഗപ്പെടുത്താൻ ഞങ്ങളുടെ അന്തിമ നടപടി നടപടികൾ പ്രോത്സാഹിപ്പിക്കുന്നു mTMD കൂടുതൽ വിലപിടിച്ച ഇടപെടലുകൾ ആലോചിക്കുന്നതിനു മുമ്പ്, "റാഫേൽ പറഞ്ഞു.

ഗവേഷകർക്ക് അതിൽ വലിയ വ്യത്യാസം ഉണ്ടായിരുന്നില്ല തുക സ്ത്രീകളുമില്ലാതെ ഫൈബ്രോമലാജിയ ഉണ്ടാക്കിയ പരിഹാരങ്ങളിൽ. ഇതര ചികിത്സ ഓപ്ഷനുകൾ ഉപയോഗിക്കുമ്പോൾ mTMD fibromyalgia സ്ത്രീകൾക്കിടയിൽ റിപ്പോർട്ട് ചെയ്യപ്പെട്ടു, കൂടുതൽ ഗവേഷണ പഠനങ്ങൾ നടന്നിട്ടുണ്ട്. സ്ത്രീകളിൽ സ്വയം പരിചരണ സമ്പ്രദായങ്ങൾ ഉപയോഗിച്ചു കൊണ്ട് വേദനയ്ക്ക് ആശ്വാസം കൂടുതലായിരുന്നു with കൂടാതെ ഫൈബ്രോമലാജിയ ഇല്ലാതെ.

"ഫിബ്രോമ്യാൽജിയ ഒരു ഹെൽത്ത് കെയർ പ്രൊഫഷണലാണ് രോഗനിർണയം നടത്തിയത്, ഒരു വാതരോഗ വിദഗ്ദ്ധനെപ്പോലെ, റ്റിഎംഡി സാധാരണയായി ഒരു ദന്ത ഡോക്ടറെ ചികിത്സിക്കുകയും ചികിത്സിക്കുകയും ചെയ്യുന്നു," സാന്റിയാഗോ പറഞ്ഞു. "കഠിനമായ വേദനയും രോഗബാധിതരുമായ രോഗികൾ ദന്തരോഗികൾക്കുള്ള ചികിത്സ തേടേണ്ടതുണ്ടെന്ന് ഞങ്ങളുടെ ഗവേഷണ പഠനങ്ങൾ തെളിയിക്കുന്നു. കാരണം ഇത് അവരുടെ ചികിത്സയ്ക്കായി ആസൂത്രണം ചെയ്യാൻ കൂടുതൽ വിവരങ്ങൾ നൽകും."

ഡോ ജിമനെസ് വൈറ്റ് കോട്ട്

ക്ഷീണം, ഉറക്കം, മെമ്മറി, മാനസിക പ്രശ്നങ്ങൾ എന്നിവയ്ക്കൊപ്പം വ്യാപകമായ വേദന അനുഭവിക്കുന്ന ഒരു ആരോഗ്യപ്രശ്നമാണ് ഫിബ്രോമിലാൽഗിയ. ടിമഡി കൂടാതെ / അല്ലെങ്കിൽ ടി.എം.ജോ പോലുള്ള വൈവിധ്യമാർന്ന ആരോഗ്യപ്രശ്നങ്ങൾ ഫൈബ്രോറിയൽഗിയയുമായി ബന്ധപ്പെട്ടിരിക്കുന്നു. ഈ വേദനാജനകമായ രോഗമുള്ള വ്യക്തികൾ തങ്ങളുടെ ദൈനംദിന ശാരീരിക പ്രവർത്തനങ്ങളിൽ ഏർപ്പെടാൻ പലപ്പോഴും പോരാടണം. ഒരു യോഗ്യതയുള്ളതും പരിചയസമ്പന്നവുമായ ചിരസ്ഥാവത്ര ആയതിനാൽ, ഫൈബ്രോമളജിയയിലെ നിരവധി രോഗികളെ ഞാൻ സഹായിച്ചിട്ടുണ്ട്. രോഗം ബാധിച്ച രോഗലക്ഷണങ്ങൾ നോക്കുമ്പോൾ രോഗികൾ മാത്രമാണെന്ന കാര്യം രോഗികൾക്ക് വളരെ പ്രധാനമാണ്. ശാരീരികാസ്വാദ ചികിത്സ എന്നത് ഒരു ബദൽ ചികിത്സാ ഉപാധിയാണ്, വൈവിധ്യമാർന്ന ആരോഗ്യപ്രശ്നങ്ങൾ കൈകാര്യം ചെയ്യാൻ ഇത് സഹായിക്കും.

ഡോ. അലക്സ് ജിമനേസ് DC, CCST ഇൻസൈറ്റ്

ഈ ചിത്രത്തിന് ഒരു ശൂന്യമായ ആട്രിബ്യൂട്ട് ഉണ്ട്; ഇതിന്റെ ഫയൽ നാമം ഇമേജ്-3.png ആണ്

ഇപ്പോൾ വാങ്ങുക സൌജന്യ ഷിപ്പിംഗ്

ഞങ്ങളുടെ വിവരങ്ങളുടെ പരിധി ചിപ്പിപ്പാക്ക്, സുഷുമ്നൽ ഹെൽത്ത് പ്രശ്നങ്ങൾ, ഫംഗ്ഷണൽ മെഡിസിൻ ലേഖനങ്ങൾ, വിഷയങ്ങൾ, ചർച്ചകൾ എന്നിവയിലേക്ക് പരിമിതപ്പെടുത്തിയിരിക്കുന്നു. മുകളിലെ വിഷയത്തെക്കുറിച്ച് കൂടുതലറിയാൻ ഡോ. അലക്സ് ജിമെനെസ് ചോദിക്കാൻ മടിക്കരുത് അല്ലെങ്കിൽ ഞങ്ങളെ ബന്ധപ്പെടുക 915-850-0900 .

ഡോ. അലക്സ് ജിമെനെസ് ക്യൂറാണ്

പച്ച കോൾ ഇപ്പോൾ ബട്ടൺ എച്ച് .png

കൂടുതൽ വിഷയം ചർച്ച: അക്യുട്ട് ബാക്ക് വേദന

പുറം വേദന ലോകമെമ്പാടും വൈകല്യമുള്ളതും നഷ്ടപ്പെടാത്തതുമായ ദിവസങ്ങളിൽ ഏറ്റവും കൂടുതലായ കാരണങ്ങൾ. ഡോക്ടർ ഓഫീസ് സന്ദർശനങ്ങൾക്കുള്ള രണ്ടാമത്തെ ഏറ്റവും സാധാരണ കാരണം ചൂണ്ടിക്കാണിക്കുന്നു. മുതിർന്ന ശ്വാസോച്ഛ്വാസം മൂലമുള്ള രോഗം മാത്രം. ജനസംഖ്യയിൽ ഏതാണ്ട് എട്ടുശതമാനം പേർക്ക് അവരുടെ ജീവിതകാലം മുഴുവൻ ഒരു വേദന ഒരിക്കൽ അനുഭവപ്പെടും. അസ്ഥികൾ, സന്ധികൾ, കട്ടിലുകൾ, പേശികൾ തുടങ്ങി മൃദുല കോശങ്ങളുള്ള ഒരു സങ്കീർണ്ണ ഘടനയാണ് നിങ്ങളുടെ നട്ടെല്ല്. പരുക്കുകളും ഒപ്പം / അല്ലെങ്കിൽ അഴുകിയ അവസ്ഥകളും ഹാർനിയേറ്റഡ് ഡിസ്ക്കുകൾ, ഒടുവിൽ മുടി വേദനയുടെ ലക്ഷണങ്ങളായി മാറുന്നു. സ്പോർട്സ് പരിക്കുകൾ അല്ലെങ്കിൽ വാഹനാപകടങ്ങൾ പലപ്പോഴും മുടി വേദനയ്ക്ക് ഇടയാക്കുന്നു, ചിലപ്പോൾ ചലനങ്ങളുടെ ലളിതമായ വേദനയ്ക്ക് വേദനയേറിയ ഫലങ്ങൾ ഉണ്ടാകാം. ഭാഗ്യവശാൽ, ചികിൽസാകൃതിയിലുള്ള സംരക്ഷണം പോലെയുള്ള ബദൽ ചികിൽസാരീതികൾ, നട്ടെല്ലിൽ മാറ്റം വരുത്താനും നട്ടെല്ലിൽ മാറ്റം വരുത്താനും സഹായകരമാകും, ഇത് ആത്യന്തികമായി വേദനയുടെ ആശ്വാസം വർദ്ധിപ്പിക്കും.

Xymogen ഫോർമുലകൾ - എൽ പാസോ, TX

XYMOGEN ന്റെ ലൈസൻസുള്ള പ്രൊഫഷണൽ പ്രൊഫഷണലുകൾ മുഖേന സവിശേഷ പ്രൊഫഷണൽ ഫോർമുലകൾ ലഭ്യമാണ്. XYMOGEN ഫോർമുലകളുടെ ഇൻറർനെറ്റ് വിൽപ്പനയും ഡിസ്കൗണ്ടിയും കർശനമായി നിരോധിച്ചിരിക്കുന്നു.

അഹങ്കാരമായി, ഡോ. അലക്സാണ്ടർ ജിമെനെസ് XYMOGEN സൂത്രവാക്യം നമ്മുടെ ശ്രദ്ധയിൽപ്പെട്ട രോഗികൾക്ക് മാത്രം ലഭ്യമാക്കുന്നു.

അടിയന്തിര പ്രവേശനത്തിനായി ഡോക്ടർ കൺസൾട്ടേഷൻ ഏർപ്പെടുത്താൻ ഞങ്ങളുടെ ഓഫീസിൽ വിളിക്കുക.

നിങ്ങൾ ഒരു രോഗിയാണെങ്കിൽ ഇൻജറി മെഡിക്കൽ & ഷിറോക്രാക് ക്ലിനിക്ക്, നിങ്ങളെ വിളിച്ചാൽ XYMOGEN എന്നതിനെക്കുറിച്ച് അന്വേഷിക്കാം 915-850-0900.

xymogen el paso, tx

നിങ്ങളുടെ സൗകര്യാർത്ഥം അവലോകനം ചെയ്യുക XYMOGEN ഉൽപ്പന്നങ്ങൾ ഇനിപ്പറയുന്ന ലിങ്ക് അവലോകനം ചെയ്യുക. *XYMOGEN- കാറ്റലോഗ്-ഇറക്കുമതി

* എല്ലാ XYMOGEN നയങ്ങളും കർശനമായി നിലവിലുണ്ട്.

***

ഇത് കഴിക്കുന്നത് നിർത്തുക, വിട്ടുമാറാത്ത വേദന നിർത്തുക

ഇത് കഴിക്കുന്നത് നിർത്തുക, വിട്ടുമാറാത്ത വേദന നിർത്തുക

ചില ഭക്ഷണസാധനങ്ങൾ കഴിച്ചതിനു ശേഷം നിങ്ങളുടെ വിട്ടുമാറാത്ത വേദന കൂടുതൽ വഷളാകുന്നതു പോലെ ചിലപ്പോൾ നിങ്ങൾക്കറിയാമോ? പലതരം ഭക്ഷണ സാധനങ്ങൾ കഴിക്കുന്നത് മനുഷ്യശരീരത്തിൽ വീക്കം വീശുന്നതായി ഗവേഷണ പഠനങ്ങൾ തെളിയിച്ചിട്ടുണ്ട്. നിങ്ങളുടെ എല്ലാക്കാലം വേദനയുടെ വേദനയുടെ പ്രാഥമിക കാരണങ്ങളിൽ ഒന്നാണ് വീക്കം എന്ന് നമുക്കെല്ലാവർക്കും അറിയാം. വീക്കം, വീക്കം എന്നിവയ്ക്കെതിരായ പോരാട്ടത്തിന് കാരണമായേക്കാവുന്ന ഭക്ഷണങ്ങൾ നാം ചർച്ച ചെയ്യുന്നതിനു മുമ്പ്, വീക്കം എന്താണ്, എങ്ങനെ വീക്കം അളക്കാൻ കഴിയും.

എന്താണ് വീക്കം?

വീക്കം പ്രതിരോധസംവിധാനത്തിന്റെ സ്വാഭാവിക പ്രതിരോധ സംവിധാനമാണ്. മനുഷ്യ ശരീരത്തെ പരിക്ക്, രോഗം, അണുബാധമൂലം സംരക്ഷിക്കുന്നതിലൂടെയാണ് ഇത് പ്രവർത്തിക്കുന്നത്. ആരോഗ്യവും സൗഖ്യവും നിലനിർത്താൻ വീക്കം സഹായിക്കുന്നു. അലർജി പ്രതിപ്രവർത്തനങ്ങൾ വീക്കം കാരണമാക്കും. നിങ്ങൾ പരിക്കേറ്റ അല്ലെങ്കിൽ ഒരു അണുബാധ ഉണ്ടെങ്കിൽ, നിങ്ങൾ വീക്കം ലക്ഷണങ്ങൾ കാണാം: അല്ലെങ്കിൽ വീർത്ത, ചുവന്ന, ചൂടുള്ള പാടുകൾ. എന്നിരുന്നാലും, ഒരു കാരണവുമില്ലാതെ വീഴ്ചയുണ്ടായിട്ടുണ്ടാകാം. രക്തപരിശോധനയിലൂടെ നിർദ്ദിഷ്ട biomarkers അളക്കുക എന്നതാണ് വീക്കം കണ്ടെത്തുന്നതിനുള്ള ഉത്തമമാർഗം.

സി-റിയാക്ടീവ് പ്രോട്ടീൻ, അല്ലെങ്കിൽ സി.ആർ.പി, കരളിൽ നിന്നും ഉത്പാദിപ്പിക്കപ്പെടുന്ന ഒരു വസ്തുവാണ്, അത് വീക്കം പോലെയുള്ള മികച്ച ബയോവാർക്കറുകളിൽ ഒന്നാണ്. സി.ആർ.പി അളവ് വീക്കം കൂടും എന്നതിനാൽ, സിആർപി നിലവാരങ്ങൾ നോക്കി നിങ്ങളുടെ ശരീരത്തിൽ എന്താണ് സംഭവിക്കുന്നതെന്ന് നിങ്ങൾക്ക് അറിയാം. അമേരിക്കൻ ഹാർട്ട് അസോസിയേഷൻ, സെന്റേഴ്സ് ഫോർ ഡിസീസ് കൺട്രോൾ ആന്റ് പ്രിവെൻഷൻ എന്നിവ പ്രകാരം, സി.എൻ.പീസ് എംഎച്ച് / എൽ യുടെ ഒരു സി.ആർ.പി ഘാതം ഹൃദയസംബന്ധമായ പ്രശ്നങ്ങൾക്ക് സാധ്യത കുറയ്ക്കുന്നു എന്നാണ്. ഹൃദയസ്തംഭനങ്ങൾക്ക് ശരാശരി അപകടസാധ്യതയാണെങ്കിൽ, എൺപത് മുതൽ എട്ട് മില്യൻ വരെ എച്ച്. കൂടാതെ ഹൃദയസംബന്ധമായ പ്രശ്നങ്ങളുടെ ഉയർന്ന റിസ്ക് സൂചിപ്പിക്കുന്നത്. സി.ആർ.പി.യുടെ ഉയർന്ന അളവുകൾ (1.0- ൽ കൂടുതലാണ്), മറ്റ് ആരോഗ്യപ്രശ്നങ്ങൾ വളർത്തുന്നതിനുള്ള സാധ്യതയും നിർദ്ദേശിക്കാവുന്നതാണ്.

Activated monocytes, സൈട്ടോകൈൻസ്, chemokines, വിവിധ adhesion തന്മാത്രകൾ, adiponectin, fibrinogen, സെറം amyloid ആൽഫ തുടങ്ങിയ മറ്റ് biomarkers രക്തം biestarkers അളക്കുന്നത് പരിശോധിക്കുക രക്തചംക്രമണം വഴി അളക്കാൻ കഴിയും വീക്കം. കോശജ്വലന പ്രവർത്തനങ്ങൾ, ഓക്സിഡന്റ് സ്ട്രെസ്സ്, ആണവോർജ്ജക കാപ്പബ് (എൻഎഫ്-കെ.ബി) ആക്ടിവേഷൻ, പ്രോൻഫാംമൈമറി സൈട്ടോകൈൻ ഉൽപാദനം എന്നിവയാണ് കോശജ്വലനത്തിലുള്ള പ്രതികരണങ്ങൾ.

മനുഷ്യ ശരീരത്തിന്റെ പ്രതിരോധവ്യവസ്ഥയിൽ വൈറ്റമിക് കോശങ്ങൾ ഒരു പ്രധാന പങ്കു വഹിക്കുന്നു. ഓരോ തവണയും ഒരു ബാക്ടീരിയയോ വൈറസ് രക്തരോഗിലോ വെള്ള രക്തകോശമോ ലീകോക്കൈറ്റിലേക്കോ പ്രവേശിക്കുമ്പോൾ വിദേശ ആക്രമണകാരികളെ തിരിച്ചറിഞ്ഞ് നശിപ്പിക്കുകയാണ് ചെയ്യുക. വെളുത്ത രക്തകോശങ്ങൾ അണുബാധയുമായി പൊരുതുന്നതിനാൽ വെളുത്ത രക്തകോശങ്ങളുടെ എണ്ണം വർദ്ധിച്ചേക്കാമെന്ന് നിങ്ങൾ വിശ്വസിച്ചേക്കാം, എന്നിരുന്നാലും ഇത് അങ്ങനെയായിരിക്കണമെന്നില്ല. ഒരു വൈറ്റ് ബ്ലഡ് സെൽ എണ്ണൽ മറ്റൊരു ആരോഗ്യ പ്രശ്നത്തിന്റെ സാന്നിദ്ധ്യം സൂചിപ്പിക്കുമെങ്കിലും, ഒരു വലിയ വെളുത്ത രക്തകോൽ എണ്ണം ഒരു പ്രശ്നമല്ല.

നശിപ്പിക്കുന്ന ഭക്ഷണങ്ങൾ

വീക്കം ഉണ്ടാക്കാൻ പോകുന്ന ഇത്തരം തരത്തിലുള്ള ഭക്ഷണങ്ങൾ സാധാരണയായി നമ്മുടെ ആരോഗ്യം, ശുദ്ധീകരിച്ച കാർബോഹൈഡ്രേറ്റ്, സോഡാസ്, ചുവന്ന മാംസം, പ്രോസസ് ചെയ്ത മാംസം തുടങ്ങിയവയെ ദോഷകരമായി കണക്കാക്കുന്നു. തരംതാഴ്ത്തൽ ഒരു പ്രധാന അണുസംരക്ഷണ മാർഗ്ഗമാണ്, ഇത് XXX ടൈപ്പ് ഡയബറ്റീസും ഹൃദ്രോഗവും പോലെയുള്ള വിട്ടുമാറാത്തരോഗങ്ങൾക്ക് മറ്റു ആരോഗ്യപ്രശ്നങ്ങൾക്കിടയിലും വർദ്ധനവുമുണ്ട്.

അനാരോഗ്യകരമായ ഭക്ഷണങ്ങൾ ശരീരഭാരം വർദ്ധിപ്പിക്കും, അത് സ്വയം വീക്കം മൂലമുള്ള അപകട ഘടകമാണ്. പല ഗവേഷണ പഠനങ്ങളിലും, ഗവേഷകർക്ക് പൊണ്ണത്തടി കാരണമുണ്ടായെങ്കിലും, വീക്കവും ഈ ഭക്ഷണങ്ങളും തമ്മിലുള്ള ബന്ധം നിലനിന്നിരുന്നു, ശരീരഭാരം ഒരു കാരണമല്ലെന്ന് ഇത് സൂചിപ്പിക്കുന്നു. ചില ആഹാരങ്ങൾ വീക്കം, വർദ്ധിച്ച കലോറി ഉപഭോഗത്തിൽ വർദ്ധനവ് വരുത്തിയിട്ടുണ്ട്.

വീക്കം ഉണ്ടാക്കുന്ന ഭക്ഷണങ്ങൾ:

  • വെളുത്ത അപ്പവും പേസ്ട്രികളും പോലെ ശുദ്ധീകരിച്ച കാർബോഹൈഡ്രേറ്റ്
  • ഫ്രെഞ്ച് ഫ്രൈസും മറ്റ് വറുത്ത ഭക്ഷണവും
  • സോഡകളും മറ്റ് പഞ്ചസാര മധുരമുള്ള പാനീയങ്ങളും
  • ബർഗറുകളും സ്റ്റീക്കുകളും പോലെയുള്ള ചുവന്ന മാംസം, ചൂടായ നായ്ക്കളും സോസേജ് പോലുള്ള മാംസവും
  • വഴറ്റുക, ചുരുക്കി, കിട്ടട്ടെ

നശിപ്പിക്കുന്നതിന് എതിരെ പോരാടുന്ന ഭക്ഷണങ്ങൾ

കൂടാതെ, വീക്കം, ഒപ്പം അത് വിട്ടുമാറാത്ത രോഗം എന്നിവയ്ക്കെതിരായ പോരാട്ടങ്ങളുണ്ട്. ബ്ലൂബെറി, ആപ്പിൾ, ഇലക്കറികൾ തുടങ്ങിയ പഴങ്ങളും പച്ചക്കറികളും പോളിഫെനോളുകൾ, ആൻറിഓക്സിഡൻറുകൾ എന്നിവയാണ്. ഗവേഷണ പഠനങ്ങൾക്കു പുറമേ വീക്കം കുറച്ച ബയോമാനർമാർക്കും പ്രമേഹത്തിനും ഹൃദയ സംബന്ധമായ അസുഖത്തിനും സാധ്യത കുറവുള്ളതാണ്. കോഫി വീക്കത്തിനെതിരെ പരിരക്ഷിക്കാം, അതുപോലെ. വിരുദ്ധ വീക്കം ഭക്ഷണങ്ങൾ തിരഞ്ഞെടുക്കുക, നിങ്ങളുടെ മൊത്തത്തിലുള്ള ആരോഗ്യവും ക്ഷേമവും മെച്ചപ്പെടുത്താൻ കഴിയും. കൊഴുപ്പു കുറഞ്ഞ ഭക്ഷണങ്ങൾ തിരഞ്ഞെടുക്കുക, നിങ്ങൾ വേദനയും വിട്ടുമാറാത്ത വേദനയും വർദ്ധിപ്പിക്കും.

വീക്കംക്കെതിരെ പോരാടുന്ന ഭക്ഷണങ്ങളിൽ ഉൾപ്പെടുന്നു:

  • തക്കാളി
  • ഒലിവ് എണ്ണ
  • ചീര, കാൾ, കൊളാർഡ് എന്നിവ പോലുള്ള പച്ചിലകളായ പച്ചക്കറികൾ
  • ബദാം, വാൽനട്ട് തുടങ്ങിയവ
  • സാൽമണ്ട്, ട്യൂണ, അയലമ, മത്തി എന്നിവ പോലുള്ള കൊഴുപ്പുള്ള മത്സ്യം
  • സ്ട്രോബെറി, ബ്ലൂബെറി, ഷാമീസ്, ഓറഞ്ച് തുടങ്ങിയ പഴങ്ങൾ
ഡോ ജിമനെസ് വൈറ്റ് കോട്ട്

ആരോഗ്യ വിദഗ്ദ്ധർ പറയുന്നത് വീക്കം കുറയ്ക്കാൻ കഴിയുന്ന ഏറ്റവും മികച്ച വഴികളിലൊന്നാണ്. മെഡിസിൻ മന്ത്രിസഭയിൽ, പക്ഷേ ഫ്രിഡ്ജ് ലെ. മനുഷ്യശരീരത്തിലെ കോശജ്വസ്തുക്കളുടെ പ്രതികരണശേഷി കുറയ്ക്കാൻ ഒരു വിരുദ്ധപോലുള്ള ഭക്ഷണക്രമം ആത്യന്തികമായി കഴിയും. മനുഷ്യശരീരം പരിക്ക്, രോഗം, അണുബാധമൂലം രക്ഷിക്കാനായി രോഗപ്രതിരോധം വീക്കം ഉണ്ടാക്കുന്നു. എന്നാൽ വീക്കം തുടരുകയാണെങ്കിൽ, അത് വിട്ടുമാറാത്ത വേദന ലക്ഷണങ്ങൾ ഉൾപ്പെടെ നിരവധി ആരോഗ്യപ്രശ്നങ്ങൾക്ക് കാരണമാകും. മനുഷ്യശരീരത്തിൽ വീഴ്ചയുടെ പ്രത്യാഘാതം ചില ഭക്ഷണങ്ങളെ സ്വാധീനിക്കുമെന്ന് ഗവേഷണ പഠനങ്ങൾ തെളിയിച്ചിട്ടുണ്ട്.

ഡോ. അലക്സ് ജിമനേസ് DC, CCST ഇൻസൈറ്റ്

മയക്കുമരുന്ന് വിസർജ്ജന ദിശകൾ

വീക്കം കുറയ്ക്കാൻ, മൊത്തത്തിൽ ആരോഗ്യകരമായ ഭക്ഷണക്രമം പിന്തുടരുക. നിങ്ങൾ ഒരു വിരുദ്ധ കോശജ്വഭാവമുള്ള ഭക്ഷണത്തിനായി നോക്കുകയാണെങ്കിൽ, മെഡിറ്ററേനിയൻ ഭക്ഷണക്രമം, പഴങ്ങൾ, പച്ചക്കറികൾ, പരിപ്പ്, ധാന്യങ്ങൾ, മത്സ്യം, എണ്ണകൾ എന്നിവയിൽ ഉയർന്നതാണ്. ദീർഘകാല ഡൈറ്റ് പ്ലാൻ ഡോ. വാട്ടർ ലോംഗോ പുസ്തകത്തിൽ അവതരിപ്പിച്ച ഭക്ഷണങ്ങൾ, ഉത്തേജനം, ഉത്തേജനം, ദീർഘായുസ്സ് എന്നിവ ഉത്തേജിപ്പിക്കുകയും ചെയ്യുന്നു. ഉപവാസം, അല്ലെങ്കിൽ കലോറി നിയന്ത്രണം, നീണ്ട ഓക്സിഡൻറ് സ്ട്രെസ് കുറയ്ക്കുകയും പല ജീവിവർഗങ്ങളിലെ പ്രായമാകൽ പ്രക്രിയയുടെ വേഗത കുറയ്ക്കുകയും ചെയ്തു.

ദീർഘായുസ്സ്-ആഹാരം- book-new.png

ഉപവാസം നിങ്ങൾക്കില്ലെങ്കിൽ ഡോ. വാലെർ ലോംഗോയുടെ ദീർഘായുസ്സ് പദ്ധതിയിൽ നോമ്പുതുറയ്ക്കുന്ന ഭക്ഷണമോ, അല്ലെങ്കിൽ എഫ്ടിഡിയോ ഉൾപ്പെടുന്നു. ഇത് നിങ്ങളുടെ ഭക്ഷണക്രമത്തെ നഷ്ടപ്പെടുത്തി പരമ്പരാഗത ഉപവാസം പ്രയോജനപ്പെടുത്താൻ അനുവദിക്കുന്നു. ഭക്ഷണപദാർത്ഥങ്ങളുടെ പ്രധാന വ്യത്യാസം നിരവധി ദിവസങ്ങളോ ആഴ്ചകളോ എല്ലാ ഭക്ഷണങ്ങളും ഒഴിവാക്കുന്നതിനുപകരം മാസത്തിൽ അഞ്ച് ദിവസം നിങ്ങളുടെ കലോറി ഉപഭോഗം മാത്രമാണ് നിങ്ങൾ നിയന്ത്രിക്കുക. മൊത്തത്തിലുള്ള ആരോഗ്യവും ക്ഷേമവും, വീക്കം, വിട്ടുമാറാത്ത വേദന എന്നിവ കുറയ്ക്കാൻ സഹായിക്കുന്ന ഒരു മാസത്തിലൊരിക്കൽ എഫ്എംഡി പ്രയോഗിക്കാവുന്നതാണ്.

എഫ്എംഡി സ്വന്തമായി ആർക്കും സ്വന്തമാക്കുവാനാകുമെങ്കിലും ഡോ. ​​വാലെർ ലോങ്കോ വാഗ്ദാനം ചെയ്യുന്നു ProLon® കൃത്യമായ അളവിലും കോമ്പിനേഷനുകളിലും എഫ്ടിഡി ആവശ്യമുള്ള ഭക്ഷണങ്ങളെ വ്യക്തിപരമായി പായ്ക്കുചെയ്ത് ലേബൽ ചെയ്യപ്പെട്ട 5- ദിവസത്തെ ഭക്ഷണ പരിപാടി ഭക്ഷണത്തെ അനുകരിക്കുന്നതാണ്. ഭക്ഷണ പരിപാടി തയ്യാറാക്കുന്നതും തയ്യാറാകുന്നതും എളുപ്പത്തിൽ തയ്യാറാക്കുന്നതും ബാർ, സൂപ്പ്, സ്നാക്ക്സ്, സപ്ലിമെന്റുകൾ, പാനീയം ഏകോപിപ്പിക്കുക, തേയില എന്നിവയുൾപ്പെടെയുള്ളവയാണ്. പക്ഷേ, ബിefore ആരംഭിക്കുന്നു പ്രോലോൺ ® ഉപവാസം ഭക്ഷണത്തെ അനുകരിക്കുന്നതും, എൺപത് ദിവസത്തെ ഭക്ഷണ പരിപാടിയും, അല്ലെങ്കിൽ മുകളിൽ വിവരിച്ച ജീവിതരീതിയിലെ ഏതെങ്കിലും തരത്തിലുള്ള ഏതെങ്കിലും ഒരു വേദന ചികിത്സ നിങ്ങൾക്ക് അനുയോജ്യമാണോ എന്ന് കണ്ടെത്താൻ ഒരു ഡോക്ടറോട് സംസാരിക്കുക.

പ്രോലോൺ നോജിംഗ് ഡയറ്റ് ബാനർ

ഇപ്പോൾ വാങ്ങുക സൌജന്യ ഷിപ്പിംഗ്

വീക്കം കുറയ്ക്കുന്നതിനു പുറമേ, കൂടുതൽ സ്വാഭാവികവും കുറഞ്ഞ അളവിലുള്ള ഭക്ഷണവും നിങ്ങളുടെ ശാരീരികവും വൈകാരികവുമായ ആരോഗ്യത്തിൽ ശ്രദ്ധേയമായ ഫലങ്ങൾ ഉണ്ടാക്കും. ഞങ്ങളുടെ വിവരങ്ങളുടെ പരിധി ചിപ്പിപ്പാക്ക്, സുഷുമ്നൽ ഹെൽത്ത് പ്രശ്നങ്ങൾ, ഫംഗ്ഷണൽ മെഡിസിൻ ലേഖനങ്ങൾ, വിഷയങ്ങൾ, ചർച്ചകൾ എന്നിവയിലേക്ക് പരിമിതപ്പെടുത്തിയിരിക്കുന്നു. മുകളിലെ വിഷയത്തെക്കുറിച്ച് കൂടുതലറിയാൻ ഡോ. അലക്സ് ജിമെനെസ് ചോദിക്കാൻ മടിക്കരുത് അല്ലെങ്കിൽ ഞങ്ങളെ ബന്ധപ്പെടുക 915-850-0900 .

ഡോ. അലക്സ് ജിമെനെസ് ക്യൂറാണ്

പച്ച കോൾ ഇപ്പോൾ ബട്ടൺ എച്ച് .png

കൂടുതൽ വിഷയം ചർച്ച: അക്യുട്ട് ബാക്ക് വേദന

പുറം വേദന ലോകമെമ്പാടും വൈകല്യമുള്ളതും നഷ്ടപ്പെടാത്തതുമായ ദിവസങ്ങളിൽ ഏറ്റവും കൂടുതലായ കാരണങ്ങൾ. ഡോക്ടർ ഓഫീസ് സന്ദർശനങ്ങൾക്കുള്ള രണ്ടാമത്തെ ഏറ്റവും സാധാരണ കാരണം ചൂണ്ടിക്കാണിക്കുന്നു. മുതിർന്ന ശ്വാസോച്ഛ്വാസം മൂലമുള്ള രോഗം മാത്രം. ജനസംഖ്യയിൽ ഏതാണ്ട് എട്ടുശതമാനം പേർക്ക് അവരുടെ ജീവിതകാലം മുഴുവൻ ഒരു വേദന ഒരിക്കൽ അനുഭവപ്പെടും. അസ്ഥികൾ, സന്ധികൾ, കട്ടിലുകൾ, പേശികൾ തുടങ്ങി മൃദുല കോശങ്ങളുള്ള ഒരു സങ്കീർണ്ണ ഘടനയാണ് നിങ്ങളുടെ നട്ടെല്ല്. പരുക്കുകളും ഒപ്പം / അല്ലെങ്കിൽ അഴുകിയ അവസ്ഥകളും ഹാർനിയേറ്റഡ് ഡിസ്ക്കുകൾ, ഒടുവിൽ മുടി വേദനയുടെ ലക്ഷണങ്ങളായി മാറുന്നു. സ്പോർട്സ് പരിക്കുകൾ അല്ലെങ്കിൽ വാഹനാപകടങ്ങൾ പലപ്പോഴും മുടി വേദനയ്ക്ക് ഇടയാക്കുന്നു, ചിലപ്പോൾ ചലനങ്ങളുടെ ലളിതമായ വേദനയ്ക്ക് വേദനയേറിയ ഫലങ്ങൾ ഉണ്ടാകാം. ഭാഗ്യവശാൽ, ചികിൽസാകൃതിയിലുള്ള സംരക്ഷണം പോലെയുള്ള ബദൽ ചികിൽസാരീതികൾ, നട്ടെല്ലിൽ മാറ്റം വരുത്താനും നട്ടെല്ലിൽ മാറ്റം വരുത്താനും സഹായകരമാകും, ഇത് ആത്യന്തികമായി വേദനയുടെ ആശ്വാസം വർദ്ധിപ്പിക്കും.

Xymogen ഫോർമുലകൾ - എൽ പാസോ, TX

XYMOGEN ന്റെ ലൈസൻസുള്ള പ്രൊഫഷണൽ പ്രൊഫഷണലുകൾ മുഖേന സവിശേഷ പ്രൊഫഷണൽ ഫോർമുലകൾ ലഭ്യമാണ്. XYMOGEN ഫോർമുലകളുടെ ഇൻറർനെറ്റ് വിൽപ്പനയും ഡിസ്കൗണ്ടിയും കർശനമായി നിരോധിച്ചിരിക്കുന്നു.

അഹങ്കാരമായി, ഡോ. അലക്സാണ്ടർ ജിമെനെസ് XYMOGEN സൂത്രവാക്യം നമ്മുടെ ശ്രദ്ധയിൽപ്പെട്ട രോഗികൾക്ക് മാത്രം ലഭ്യമാക്കുന്നു.

അടിയന്തിര പ്രവേശനത്തിനായി ഡോക്ടർ കൺസൾട്ടേഷൻ ഏർപ്പെടുത്താൻ ഞങ്ങളുടെ ഓഫീസിൽ വിളിക്കുക.

നിങ്ങൾ ഒരു രോഗിയാണെങ്കിൽ ഇൻജറി മെഡിക്കൽ & ഷിറോക്രാക് ക്ലിനിക്ക്, നിങ്ങളെ വിളിച്ചാൽ XYMOGEN എന്നതിനെക്കുറിച്ച് അന്വേഷിക്കാം 915-850-0900.

xymogen el paso, tx

നിങ്ങളുടെ സൗകര്യാർത്ഥം അവലോകനം ചെയ്യുക XYMOGEN ഉൽപ്പന്നങ്ങൾ ഇനിപ്പറയുന്ന ലിങ്ക് അവലോകനം ചെയ്യുക. *XYMOGEN- കാറ്റലോഗ്-ഇറക്കുമതി

* എല്ലാ XYMOGEN നയങ്ങളും കർശനമായി നിലവിലുണ്ട്.

***

ഉപവാസവും വിട്ടുമാറാത്ത വേദനയും

ഉപവാസവും വിട്ടുമാറാത്ത വേദനയും

വിട്ടുമാറാത്ത വേദന ഒരു പൊതു ആരോഗ്യ പ്രശ്നമാണ്, അത് അമേരിക്കയിലെ പലരെയും ബാധിക്കുന്നു. ഫിബ്രോമ്യാൽഗിയ, myofascial വേദന സിൻഡ്രോം മുതലായ പല രോഗങ്ങളും വിട്ടുമാറാത്ത വേദനയ്ക്ക് കാരണമാകാം. പല ആരോഗ്യ പ്രശ്നങ്ങൾക്കും കാരണം ഇത് വികസിപ്പിച്ചേക്കാം. ഗവേഷണ പഠനങ്ങൾ കണ്ടെത്തിയത്, വിശാലമായ വീക്കം വിട്ടുമാറാത്ത വേദനയുടെ പ്രധാന കാരണം. മുറിവുകൾ, രോഗം, അണുബാധ എന്നിവയ്ക്ക് പ്രകൃതിദത്ത പ്രതിരോധ സംവിധാനമാണ് വീക്കം. പക്ഷേ, ഇഞ്ചിസംബന്ധമായ പ്രവർത്തനം ഏറെക്കാലം തുടരുകയാണെങ്കിൽ, അത് പ്രശ്നകരമായിരിക്കും.

രോഗപ്രതിരോധ സംവിധാനത്തെ രോഗപ്രതിരോധ സംവിധാനത്തെ ലഘൂകരിച്ച് തകർത്ത ടിഷ്യു തകർക്കുകയും, ബാക്ടീരിയ, വൈറസ് എന്നിവയ്ക്കെതിരെ സ്വയം സംരക്ഷിക്കുകയും ചെയ്യുന്നു. എങ്കിലും മുകളിൽ പറഞ്ഞതുപോലെ, വിട്ടുമാറാത്ത വീക്കം പല തരത്തിലുള്ള ആരോഗ്യപ്രശ്നങ്ങൾക്ക് ഇടയാക്കും, വിട്ടുമാറാത്ത വേദന ലക്ഷണങ്ങൾ ഉൾപ്പെടെ. വിട്ടുമാറാത്ത വേദനയെ നിയന്ത്രിക്കാൻ ആരോഗ്യപൂർണമായ ജീവിതരീതികൾ സഹായിക്കും, എന്നാൽ ആദ്യം, വിട്ടുമാറാത്ത വേദനയുടെ പൊതുവായ കാരണങ്ങൾ നമുക്ക് മനസിലാക്കാം.

എന്താണ് തീവ്രമായ വീക്കം?

കഠിനമായ വീക്കം, ഉദാഹരണത്തിലൂടെ, ഒരു തൊണ്ട തൊണ്ടായി അല്ലെങ്കിൽ തൊണ്ടവേദനപോലെ ലളിതമായി സംഭവിക്കുന്നു. ഇത് പ്രതികൂല ഫലങ്ങളുള്ള ഒരു സ്വാഭാവിക പ്രതികരണമാണ്, അതായത്, ആരോഗ്യപ്രശ്നം കണ്ടെത്തിയ പ്രദേശത്തെ പ്രാദേശികമായി പ്രവർത്തിക്കുന്നു. നാഷണൽ ലൈബ്രറി ഓഫ് മെഡിസിൻ പറഞ്ഞിരിക്കുന്നതുപോലെ വീക്കം, തിമിരം, ഊഷ്മാവ്, വേദന, വേദന എന്നിവയെല്ലാം നിശിതം വീക്കം കാണിക്കുന്നതിൻറെ ലക്ഷണങ്ങളാണ്. നിശിതം വീക്കം സംഭവിക്കുമ്പോൾ, രക്തക്കുഴലുകൾ രക്തപ്രവാഹം വർദ്ധിപ്പിക്കും, പരുക്കേറ്റ പ്രദേശങ്ങളിലെ വെളുത്ത രക്തകോശങ്ങൾ വീണ്ടെടുക്കാൻ സഹായിക്കും.

ഗുരുതരമായ വീക്കം സംഭവിക്കുമ്പോൾ, സൈറ്റോകൈൻസ് എന്ന സംയുക്തം കേടുപാടുകൾ ഉണ്ടാക്കിയ നാശങ്ങൾ പുറത്തുവിടും. മനുഷ്യന്റെ ശരീരത്തിൻറെ രോഗപ്രതിരോധ കുത്തിവയ്പ്പുകൾ, അതുപോലെ ഹോർമോണുകളും നിരവധി പോഷണങ്ങളും ആരോഗ്യപ്രശ്നങ്ങൾ പരിഹരിക്കുന്നതിനായി "അടിയന്തിര സിഗ്നലുകൾ" എന്ന സൈറ്റോകൈൻ പ്രവർത്തിക്കുന്നു. കൂടാതെ പ്രോസ്റ്റാഗ്ലാൻഡിൻസ് എന്നറിയപ്പെടുന്ന ഹോർമോൺ പോലെയുള്ള ലഹരിവസ്തുക്കൾ രക്തക്കുഴലുകൾ തകരാറിലായ കോശങ്ങളെ നിയന്ത്രിക്കാൻ കാരണമാവുകയും ഇത് പനിയും വേദനയും മൂലമുണ്ടാകുന്ന കോശജ്വലനത്തിന്റെ ഭാഗമായി മാറുകയും ചെയ്യാം. തകരാറിലോ മുറിവുകളിലോ ഉണരുന്നതുപോലെ, വീക്കം കുറയ്ക്കുന്നു.

ക്രോണിക് വീക്കം എന്താണ്?

കടുത്ത വീക്കം പോലെ, വിട്ടുമാറാത്ത വീക്കം ദീർഘകാല ഇഫക്റ്റുകൾ ഉണ്ട്. രക്തത്തിലേക്കും സെൽ ടിഷ്യുകളിലുമുള്ള രോഗപ്രതിരോധ സംവിധാനത്തിൽ വർദ്ധനവ് പ്രകടിപ്പിക്കുന്ന, മനുഷ്യശരീരത്തിൽ എല്ലായിടത്തും വീക്കം കുറയുന്നതായി കാണപ്പെടുന്ന ദീർഘകാല വീക്കം, സ്ഥിരമായ വീക്കം എന്നറിയപ്പെടുന്നു. വിട്ടുമാറാത്ത വീക്കം പല രോഗങ്ങളുടെയും അവസ്ഥയുടെയും പുരോഗതിക്ക് കാരണമാകാം. മുറിവുകൾ, രോഗങ്ങൾ, അല്ലെങ്കിൽ അണുബാധകൾ ഉണ്ടെങ്കിൽ പോലും ചിലപ്പോൾ വീക്കം കുറയ്ക്കും. ചിലപ്പോൾ രോഗപ്രതിരോധവ്യവസ്ഥ പ്രതികരിക്കാറുണ്ട്.

തത്ഫലമായി മനുഷ്യശരീര രോഗപ്രതിരോധ സംവിധാനത്തെ ആരോഗ്യമുള്ള കോശങ്ങൾ, ടിഷ്യുകൾ അല്ലെങ്കിൽ അവയവങ്ങൾ ആക്രമിക്കാൻ തുടങ്ങും. മനുഷ്യശരീരത്തിലെ ദീർഘവും നീണ്ടതുമായ വീഴ്ചയുടെ പ്രത്യാഘാതങ്ങളെയും പ്രകൃതി സംരക്ഷണ പ്രക്രിയയിൽ ഉൾപ്പെടുന്ന പ്രവർത്തനങ്ങളെയും കുറിച്ച് ഗവേഷകർ ഇപ്പോഴും പരിശ്രമിച്ചുകൊണ്ടിരിക്കുകയാണ്. ഉദാഹരണമായി ഹൃദ്രോഗം, സ്ട്രോക്ക് മുതലായ പല ആരോഗ്യ പ്രശ്നങ്ങളുമായി വിട്ടുമാറാത്ത വീക്കം ബന്ധപ്പെട്ടിരിക്കുന്നു.

രക്തക്കുഴലുകളിൽ വീക്കം എത്തുമ്പോൾ അത് ഫലകത്തിന്റെ ശേഖരണത്തെ പ്രോത്സാഹിപ്പിക്കുമെന്ന് ഒരു സിദ്ധാന്തം പറയുന്നു. അമേരിക്കൻ ഹാർട്ട് അസോസിയേഷൻ അഥവാ AHA പ്രകാരം, പ്രതിരോധ സംവിധാനം ഒരു വിദേശ ആക്രമണത്തിലെ ഫലകത്തെ തിരിച്ചറിയുന്നുവെങ്കിൽ, ധമനികളിൽ രക്തം ചൊരിഞ്ഞ രക്തക്കുഴലുകളിൽ വെളുത്ത രക്താണുക്കൾ പ്രതിരോധിക്കാൻ ശ്രമിക്കും. ഇത് രക്തം കട്ട പിടികൂടുവാൻ കാരണമാകും. ഇത് ഹൃദയത്തിലേക്കോ മസ്തിഷ്ക്കത്തിലേക്കോ രക്തപ്രവാഹം തടയുകയും അസ്ഥിരമാക്കുകയും അസ്ഥിരമാകുകയും ചെയ്യും. കാൻസർ എന്നത് ഹൃദയ സംബന്ധമായ അസുഖമുള്ള മറ്റൊരു ആരോഗ്യപ്രശ്നമാണ്. കൂടാതെ, നാഷണൽ ക്യാൻസർ ഇൻസ്റ്റിറ്റ്യൂട്ട് അനുസരിച്ച്, ഡി.എൻ.എ നാശനങ്ങളും ശ്വാസകോശത്തിൽ നിന്നും ഉണ്ടാകാം.

നിരന്തരമായ, കുറഞ്ഞ ഗ്രേഡ് വീക്കം പതിവായി ഒരു ലക്ഷണമില്ല, എന്നാൽ ആരോഗ്യ പ്രൊഫഷണലുകൾ രക്തം കണ്ടെത്തി വീക്കം ഒരു മാർക്കർ lipoic ആസിഡ്, ഒരു സി-പ്രതിപ്രവർത്തനം പ്രോട്ടീൻ അല്ലെങ്കിൽ സി.ആർ.പി, പരിശോധിക്കാൻ കഴിയും. സി.ആർ.പി യുടെ ഉയർച്ച അളവ് ഹൃദയ സംബന്ധമായ അസുഖങ്ങളെ കൂടുതലായി ബാധിക്കുന്നു. ല്യൂപ്പസ് അല്ലെങ്കിൽ റുമാറ്റോയ്ഡ് ആർത്രൈറ്റിസ് പോലെയുള്ള ദീർഘകാല രോഗങ്ങളിൽ ഉയർത്തിയ സിആർപി ലെവലുകൾ കാണാവുന്നതാണ്.

ഫിബ്രോമിലൽജിയ പോലുള്ള മറ്റ് സ്ഥായിയായ അവസ്ഥകളിൽ, നാഡീവ്യൂഹം പ്രത്യേക ഉത്തേജകത്തിലേക്ക് കൂടുതൽ പ്രതികരിക്കുന്നുണ്ടെങ്കിലും, വിട്ടുമാറാത്ത വേദന ലക്ഷണങ്ങളെ ബാധിക്കുന്ന വീക്കം മാത്രമാണ് ഇത്. വിഷാദരോഗം, നാഡീവ്യൂഹം മൂലമുള്ള കഠിനമായ വേദനയ്ക്കും വിശാലമായ വീക്കം മൂലമുണ്ടാകുന്ന വിട്ടുമാറാത്ത വേദനയ്ക്കും ഇടയിലുള്ള വ്യത്യാസത്തെക്കുറിച്ച് പറയാൻ കഴിയുന്നതും അസാധ്യമാണ്. രക്തസ്രാവത്തിനുള്ളിൽ നിന്നുള്ള സൂചനകൾ തിരയുന്നതിനുപുറമെ, ഒരു വ്യക്തിയുടെ പോഷകാഹാരം, ജീവിതശൈലി ശീലങ്ങൾ, പാരിസ്ഥിതിക വ്യാധികൾ എന്നിവയും വിട്ടുമാറാത്ത വീക്കം ഉത്തേജിപ്പിക്കും.

ഡോ ജിമനെസ് വൈറ്റ് കോട്ട്

മുറിവുകൾ, രോഗങ്ങൾ, രോഗം എന്നിവയ്ക്കെതിരായ പ്രതിരോധ സംവിധാനത്തിന്റെ സ്വാഭാവിക പ്രതിരോധ സംവിധാനമാണ് വീക്കം. ഈ കോശജ്വശം പ്രതികരണം ടിഷ്യുകൾ സൌഖ്യവും നന്നാക്കാനും സഹായിക്കും, വിട്ടുമാറാത്ത, വ്യാപകമായ വീക്കം വിട്ടുമാറാത്ത വേദന ലക്ഷണങ്ങൾ ഉൾപ്പെടെ ആരോഗ്യ പ്രശ്നങ്ങൾ പലതരം കാരണമാകും. സമതുലിതമായ പോഷകാഹാരങ്ങൾ, പലതരം ഭക്ഷണരീതികൾ, ഉപവാസം എന്നിവയും വീക്കം കുറയ്ക്കാൻ സഹായിക്കും. കലോറി പരിമിതി എന്നറിയപ്പെടുന്ന ഉപവാസം, സെൽ അപ്പോപോസിസും മൈറ്റോകോണ്ട്രിയൽ റിക്കോർഡിനും പ്രോത്സാഹിപ്പിക്കുന്നു. പരമ്പരാഗത ഉപവാസം പ്രയോജനപ്പെടുത്തുന്നതിന് മനുഷ്യശരീരം ഒരു ഉപവാസം സംസ്ഥാനമാക്കി "ഭക്ഷണ" എന്ന് വിളിക്കുന്ന ഒരു ഭക്ഷണപദ്ധതിയാണ് ആയുർവേദ ഭക്ഷണ പദ്ധതിയുടെ ഭാഗമായ ഭക്ഷണ രീതി. ഈ ലേഖനത്തിൽ വിവരിച്ച ഏതെങ്കിലും ആഹാരത്തെ പിന്തുടരുന്നതിന് മുമ്പ് ഒരു ഡോക്ടറെ സമീപിക്കേണ്ടത് ഉറപ്പാക്കുക.

ഡോ. അലക്സ് ജിമനേസ് DC, CCST ഇൻസൈറ്റ്

പ്രോലോൺ നോജിംഗ് ഡയറ്റ് ബാനർ

ഇപ്പോൾ വാങ്ങുക സൌജന്യ ഷിപ്പിംഗ്

പോഷകാഹാരം, ആഹാരം, ഉപവാസം, കടുത്ത വേദന

പഴങ്ങൾ, പച്ചക്കറികൾ, മത്സ്യം, കൊഴുപ്പ് തുടങ്ങിയവ ഭക്ഷണത്തിൽ ഉൾപ്പെടുത്തിയിട്ടുണ്ട്. ഉദാഹരണത്തിന് മെഡിറ്ററേനിയൻ ഭക്ഷണപദ്ധതി ഒരു വിരുദ്ധ വിരുദ്ധ ഭക്ഷണമാണ്. ഇത് പരിമിതമായ അളവിൽ കഴിക്കുന്നത്, വളരെ കുറഞ്ഞ മാംസം കഴിക്കുകയും, വൈൻ കുടിക്കുകയും ചെയ്യുന്നു. ഒമേഗ-എൻ.എ.എൻ.എക്സ്.എൽ ഫാറ്റി ആസിഡുകൾ പോലെയുള്ള മരുന്നുകൾക്കുണ്ടാകുന്ന ഭക്ഷണപദാർത്ഥങ്ങൾ മനുഷ്യശരീരത്തിനെതിരായി damage വീക്കം കൊണ്ടു വന്നു.

വീക്കം തടയുന്നതിനുള്ള ഭക്ഷണങ്ങളിൽ നിന്നും അകന്നു നില്ക്കുന്ന ഒരു വിരുദ്ധ രാസവസ്തുവാണ് ആഹാരം. ഭക്ഷണങ്ങളുടെ അളവ് കുറയ്ക്കാൻ അനുയോജ്യമാണ്, ഇവ ഭക്ഷണസാധനങ്ങളും, ഭക്ഷണസാധനങ്ങളും കൊഴുപ്പുള്ളവയാണ്. കൂടാതെ, ഒരു വിരുദ്ധ-കൊഴുപ്പ് ഭക്ഷണരീതി, ബ്രെഡും അരിയും പോലെയുള്ള ശുദ്ധമായ കാർബോഹൈഡ്രേറ്റ്സിന്റെയും ഭക്ഷണങ്ങളുടെയും ഉപഭോഗത്തെ പരിമിതപ്പെടുത്തുന്നു. ഇവ സൂര്യകാന്തി, കുളിമുറി എന്നിവ പോലെ ഒമേഗ -3083 ഫാറ്റി ആസിഡുകൾ അടങ്ങിയ മാര്ഗറിനുകളും എണ്ണകളും ഉപയോഗിക്കുന്നത് തിരിച്ചെടുക്കാനും പ്രോത്സാഹിപ്പിക്കുന്നു. ഒപ്പം ധാന്യം എണ്ണ.

ഉപവാസം, അല്ലെങ്കിൽ കലോറി നിയന്ത്രണം, നീണ്ട ഓക്സിഡൻറ് സ്ട്രെസ് കുറയ്ക്കുകയും പല ജീവിവർഗങ്ങളിലെ പ്രായമാകൽ പ്രക്രിയയുടെ വേഗത കുറയ്ക്കുകയും ചെയ്തു. പ്രോഗ്രാം ചെയ്യപ്പെടുന്ന സെൽ മരണം, അപ്പോപ്പോസിസ്, ട്രാൻസ്ക്രിപ്ഷൻ, മൊബൈൽ എനർജി കാര്യക്ഷമത, മൈറ്റോകോൺഡിയൽ ബയോജനിസിസ്, ആന്റിഓക്സിഡന്റ് സംവിധാനങ്ങൾ, സിക്രാഡിയൻ റിഥം എന്നിവ ഉൾപ്പെടുന്നു. മൈറ്റോകോണ്ട്രിയയിൽ മൈറ്റോകോണ്ട്രിയയിൽ ജീനുകൾ ഉൽപ്പാദിപ്പിക്കുന്ന അപ്പോപ്പോസിസിനു കാരണമാകാൻ ഉത്തേജിതരാകുന്ന മൈറ്റോകോണ്ട്രൽ ഓട്ടോഫഗീസിനു കാരണമാകുന്നു.

ഇടയ്ക്കിടെ ഉപവാസം ഉപവാസത്തിനെതിരെ പോരാടാനും, ദഹനം മെച്ചപ്പെടുത്താനും, ദീർഘായുസ്സിനെ ശക്തിപ്പെടുത്താനും സഹായിക്കും. ആഹാരമില്ലാതെയുള്ള കാലത്തേയ്ക്ക് അതിജീവിക്കാൻ മനുഷ്യ ശരീരം രൂപകൽപ്പന ചെയ്തിരിക്കുന്നു. ഇടയ്ക്കിടെ നിരാഹാരസമരങ്ങൾ നിങ്ങളുടെ ഗ്യാസ് മൈക്രോബയോട്ടയുടെ മൊത്തത്തിലുള്ള ഘടനയിൽ നല്ല മാറ്റങ്ങൾ വരുമെന്ന് ഗവേഷണ പഠനങ്ങൾ തെളിയിച്ചു. മാത്രമല്ല, ഇടവിട്ടുള്ള ഉപവാസം ഇൻസുലിൻ പ്രതിരോധം കുറയ്ക്കുകയും, രോഗപ്രതിരോധ വ്യവസ്ഥ പ്രതികരണത്തെ വർദ്ധിപ്പിക്കുകയും ചെയ്യുന്നു. അവസാനമായി, ഇടവിട്ടുള്ള ഉപവാസം, β-hydroxybutyrate എന്നറിയപ്പെടുന്ന പദാർത്ഥത്തിന്റെ ഉത്പാദനത്തെ പ്രോത്സാഹിപ്പിക്കും, അത് രോഗപ്രതിരോധ സംവിധാനത്തിൽ ഉൾപ്പെടുന്ന രോഗപ്രതിരോധ സംവിധാനത്തിന്റെ ഒരു ഭാഗം തടയുകയും സൈക്കോകൈൻസും സി-റിയാക്ടീവ് പ്രോട്ടീൻ പോലുള്ള കോശജ്വലന മാർക്കറുകളുടെ ഉത്പാദനവും ഗണ്യമായി കുറയ്ക്കുകയും ചെയ്യുന്നു. , അല്ലെങ്കിൽ മുകളിൽ സൂചിപ്പിച്ച സി.ആർ.പി.

ദീർഘകാല ഡൈറ്റ് പ്ലാൻ ഡോ. വോളർ ലോംഗോ പുസ്തകത്തിൽ അവതരിപ്പിച്ചതാണ്. പ്രോസസ് ചെയ്ത ഭക്ഷണങ്ങളുടെ ഉപയോഗം ഇല്ലാതാക്കുന്നത്, അത് വീക്കം ഉണ്ടാക്കുകയും, ദീർഘായുസ്സും ദീർഘായുസും ഉണ്ടാക്കുകയും ചെയ്യും. ഈ പരമ്പരാഗത ഭക്ഷണരീതി, പരമ്പരാഗതമായ ആഹാരത്തിൽ നിന്ന് വ്യത്യസ്തമായി, ശരീരഭാരം കുറയ്ക്കാൻ സാധിക്കുന്നില്ല. ശരീരഭാരം കുറയ്ക്കുമെങ്കിലും ഈ സവിശേഷമായ ആഹാരരീതിയുടെ പ്രാധാന്യം ആരോഗ്യകരമായ ഭക്ഷണം കഴിക്കുന്നത് ആണ്. ദീർഘനാളത്തെ ഡൈറ്റ് പദ്ധതി സ്ട്രെം സെൽ അടിസ്ഥാനമാക്കിയുള്ള പുനരുൽപ്പാദനം, വയറിലെ കൊഴുപ്പ് കുറയ്ക്കൽ, പ്രായം സംബന്ധിച്ച അസ്ഥി, പേശി നഷ്ടപ്പെടൽ തടയുന്നതിനും, അൽഷിമേഴ്സിന്റെ രോഗം, പ്രമേഹം, ക്യാൻസർ തുടങ്ങിയ രോഗങ്ങളെ പ്രതിരോധിക്കാൻ സഹായിക്കും.

ദീർഘായുസ്സ്-ആഹാരം- book-new.png

ഭക്ഷണമോ, അല്ലെങ്കിൽ എഫ്ടിഡിയോ ഉപദേശം ചെയ്യുന്ന ഉപവാസം, ഭക്ഷണക്രമത്തെ നഷ്ടപ്പെടുത്താതെ പരമ്പരാഗത ഉപവാസം പ്രയോജനപ്പെടുത്താൻ അനുവദിക്കുന്നു. പല ഭക്ഷണങ്ങളും പൂർണമായും ഒഴിവാക്കുന്നതിനുപകരം മാസത്തിൽ അഞ്ച് ദിവസം നിങ്ങളുടെ കലോറി ഉപഭോഗം മാത്രം നിയന്ത്രിക്കുക മാത്രമാണ് എഫ്.എം.ഡി യുടെ പ്രധാന വ്യത്യാസം. മൊത്തത്തിലുള്ള ആരോഗ്യവും ക്ഷേമവും പ്രോത്സാഹിപ്പിക്കുന്നതിന് മാസത്തിലൊരിക്കൽ FMD പ്രാവർത്തികമാക്കാൻ കഴിയും.

ആർക്കു വേണമെങ്കിലും എഫ് എം ഡി പിന്തുടരാൻ കഴിയും ProLon® ഓരോ ദിവസവും ഓരോ ദിവസവും ഓരോ പാക്ക് ചെയ്ത് ലേബൽ ചെയ്യപ്പെട്ട ഒരു എൺദിവസദിന ഭക്ഷണപരിപാടി വാഗ്ദാനം ചെയ്യുന്നു. ഇത് കൃത്യമായ അളവിലും കോമ്പിനേഷനുകളിലും നിങ്ങൾക്ക് ആവശ്യമുള്ള ഭക്ഷണങ്ങളാണ്. ഭക്ഷണപാനീയങ്ങൾ തയ്യാറാക്കുന്നതും തയ്യാറാകുന്നതും തയ്യാറാകുന്നതും ബാർ, സൂപ്പ്, സ്നാക്ക്സ്, സപ്ലിമെന്റുകൾ, പാനീയം ഏകോപിതം, തേയില എന്നിവയുൾപ്പടെയുള്ളതാണ്. ആരംഭിക്കുന്നതിന് മുമ്പ് പ്രോലോൺ ® ഉപവാസം ഭക്ഷണത്തെ അനുകരിക്കുന്നതും, എൺപത് ദിവസത്തെ ഭക്ഷണ പരിപാടിയും, അല്ലെങ്കിൽ മുകളിൽ വിവരിച്ച ജീവിതരീതിയിലെ ഏതെങ്കിലും തരത്തിലുള്ള ഏതെങ്കിലും ചികിത്സാരീതികളുമായി സംസാരിക്കാൻ ശ്രദ്ധിക്കുക.

ഞങ്ങളുടെ വിവരങ്ങളുടെ പരിധി ചിപ്പിപ്പാക്ക്, സുഷുമ്നൽ ഹെൽത്ത് പ്രശ്നങ്ങൾ, ഫംഗ്ഷണൽ മെഡിസിൻ ലേഖനങ്ങൾ, വിഷയങ്ങൾ, ചർച്ചകൾ എന്നിവയിലേക്ക് പരിമിതപ്പെടുത്തിയിരിക്കുന്നു. മുകളിലെ വിഷയത്തെക്കുറിച്ച് കൂടുതലറിയാൻ ഡോ. അലക്സ് ജിമെനെസ് ചോദിക്കാൻ മടിക്കരുത് അല്ലെങ്കിൽ ഞങ്ങളെ ബന്ധപ്പെടുക 915-850-0900 .

ഡോ. അലക്സ് ജിമെനെസ് ക്യൂറാണ്

പച്ച കോൾ ഇപ്പോൾ ബട്ടൺ എച്ച് .png

കൂടുതൽ വിഷയം ചർച്ച: അക്യുട്ട് ബാക്ക് വേദന

പുറം വേദന ലോകമെമ്പാടും വൈകല്യമുള്ളതും നഷ്ടപ്പെടാത്തതുമായ ദിവസങ്ങളിൽ ഏറ്റവും കൂടുതലായ കാരണങ്ങൾ. ഡോക്ടർ ഓഫീസ് സന്ദർശനങ്ങൾക്കുള്ള രണ്ടാമത്തെ ഏറ്റവും സാധാരണ കാരണം ചൂണ്ടിക്കാണിക്കുന്നു. മുതിർന്ന ശ്വാസോച്ഛ്വാസം മൂലമുള്ള രോഗം മാത്രം. ജനസംഖ്യയിൽ ഏതാണ്ട് എട്ടുശതമാനം പേർക്ക് അവരുടെ ജീവിതകാലം മുഴുവൻ ഒരു വേദന ഒരിക്കൽ അനുഭവപ്പെടും. അസ്ഥികൾ, സന്ധികൾ, കട്ടിലുകൾ, പേശികൾ തുടങ്ങി മൃദുല കോശങ്ങളുള്ള ഒരു സങ്കീർണ്ണ ഘടനയാണ് നിങ്ങളുടെ നട്ടെല്ല്. പരുക്കുകളും ഒപ്പം / അല്ലെങ്കിൽ അഴുകിയ അവസ്ഥകളും ഹാർനിയേറ്റഡ് ഡിസ്ക്കുകൾ, ഒടുവിൽ മുടി വേദനയുടെ ലക്ഷണങ്ങളായി മാറുന്നു. സ്പോർട്സ് പരിക്കുകൾ അല്ലെങ്കിൽ വാഹനാപകടങ്ങൾ പലപ്പോഴും മുടി വേദനയ്ക്ക് ഇടയാക്കുന്നു, ചിലപ്പോൾ ചലനങ്ങളുടെ ലളിതമായ വേദനയ്ക്ക് വേദനയേറിയ ഫലങ്ങൾ ഉണ്ടാകാം. ഭാഗ്യവശാൽ, ചികിൽസാകൃതിയിലുള്ള സംരക്ഷണം പോലെയുള്ള ബദൽ ചികിൽസാരീതികൾ, നട്ടെല്ലിൽ മാറ്റം വരുത്താനും നട്ടെല്ലിൽ മാറ്റം വരുത്താനും സഹായകരമാകും, ഇത് ആത്യന്തികമായി വേദനയുടെ ആശ്വാസം വർദ്ധിപ്പിക്കും.

Xymogen ഫോർമുലകൾ - എൽ പാസോ, TX

XYMOGEN ന്റെ ലൈസൻസുള്ള പ്രൊഫഷണൽ പ്രൊഫഷണലുകൾ മുഖേന സവിശേഷ പ്രൊഫഷണൽ ഫോർമുലകൾ ലഭ്യമാണ്. XYMOGEN ഫോർമുലകളുടെ ഇൻറർനെറ്റ് വിൽപ്പനയും ഡിസ്കൗണ്ടിയും കർശനമായി നിരോധിച്ചിരിക്കുന്നു.

അഹങ്കാരമായി, ഡോ. അലക്സാണ്ടർ ജിമെനെസ് XYMOGEN സൂത്രവാക്യം നമ്മുടെ ശ്രദ്ധയിൽപ്പെട്ട രോഗികൾക്ക് മാത്രം ലഭ്യമാക്കുന്നു.

അടിയന്തിര പ്രവേശനത്തിനായി ഡോക്ടർ കൺസൾട്ടേഷൻ ഏർപ്പെടുത്താൻ ഞങ്ങളുടെ ഓഫീസിൽ വിളിക്കുക.

നിങ്ങൾ ഒരു രോഗിയാണെങ്കിൽ ഇൻജറി മെഡിക്കൽ & ഷിറോക്രാക് ക്ലിനിക്ക്, നിങ്ങളെ വിളിച്ചാൽ XYMOGEN എന്നതിനെക്കുറിച്ച് അന്വേഷിക്കാം 915-850-0900.

xymogen el paso, tx

നിങ്ങളുടെ സൗകര്യാർത്ഥം അവലോകനം ചെയ്യുക XYMOGEN ഉൽപ്പന്നങ്ങൾ ഇനിപ്പറയുന്ന ലിങ്ക് അവലോകനം ചെയ്യുക. *XYMOGEN- കാറ്റലോഗ്-ഇറക്കുമതി

* എല്ലാ XYMOGEN നയങ്ങളും കർശനമായി നിലവിലുണ്ട്.

***

ഡിപ്രഷൻ ആൻഡ് ക്രോണിക് വേൾഡ് | വീഡിയോ | എൽ പാസോ, TX.

ഡിപ്രഷൻ ആൻഡ് ക്രോണിക് വേൾഡ് | വീഡിയോ | എൽ പാസോ, TX.

അപകടങ്ങൾ മൂലമുണ്ടാകുന്ന വേദനയും / അല്ലെങ്കിൽ മർദ്ദനമേറ്റ അവസ്ഥയും രോഗികളിൽ വിഷാദത്തിനുള്ള പ്രധാന കാരണങ്ങളിലൊന്നാണ്. വേദനാജനകമായ രോഗലക്ഷണങ്ങൾ രോഗികളെ ദൈനംദിന ജീവിതത്തിൽ നേരിടാൻ പ്രേരിപ്പിക്കുമ്പോഴാണ് കായിക വൃത്തിഅവരുടെ മാനസികാരോഗ്യം വളരെയേറെ സ്വാധീനിക്കും. നട്ടെല്ലുള്ള പ്രാഥമിക സമഗ്രത പുനഃസ്ഥാപിക്കാൻ സഹായിക്കുന്ന നവീകരണവും കൈയ്യെഴുത്തുകളുമൊക്കെ ചികിൽസാകൃത്തായ സംരക്ഷണം പ്രയോജനപ്പെടുത്തുന്നു. ചിരസ്ഥരാശി പരിപാലനം അവരുടെ ക്ഷേമത്തെ എങ്ങനെ സഹായിക്കുമെന്ന് രോഗികൾ വിശദീകരിക്കുന്നു. ശിശുരോഗ വിദഗ്ധനായ ഡോക്ടർ അലക്സ് ജിമെനെസ്, എല്ലാവർക്കുമുള്ള മറ്റു പല ആരോഗ്യ പ്രശ്നങ്ങൾക്കും വിട്ടുമാറാത്ത വേദനയ്ക്കും വിഷാദംക്കുമുള്ള ശസ്ത്രക്രീയ തെരഞ്ഞെടുക്കലിനായി അവരെ ശുപാർശ ചെയ്യുന്നു.

ശിശുരോഗ വിദഗ്ധ

വിഷാദവും വിട്ടുമാറാത്ത വേദനയും.

ഞങ്ങൾ നിങ്ങൾക്കു കാണിച്ചുതരാം എൽ പാസോയുടെ പ്രീമിയർ വെൽനെസ് ആൻഡ് ഇൻജുറി കെയർ ക്ലിനിക്.

ഞങ്ങളുടെ സേവനങ്ങൾ സ്പെഷ്യലൈസ് ചെയ്തവയാണ്, പരിക്കുകളും പൂർണ്ണമായ വീണ്ടെടുക്കൽ പ്രക്രിയയും ആണ്. ഞങ്ങളുടെ മേഖലകൾ ഉൾപ്പെടുന്നു ആരോഗ്യവും പോഷകാഹാരവും, വിട്ടുമാറാത്ത വേദന, വ്യക്തിപരമായ അപമാനം, വാഹന അപകട സംരക്ഷണം, ജോലി പരിക്കുകൾ, ബാക്ക് ട്രീറ്റ്മെന്റ്, ലോ പുറം വേദന, കഴുത്തു വേദന, മൈഗ്രെയ്ൻ ചികിത്സ, കായിക പ്രശ്നങ്ങൾ, കഠിനമായ സൈറ്റികാ, സ്കോളിയോസിസ്, കോംപ്ലക്സ് ഹർണിയേറ്റഡ് ഡിസ്ക്കുകൾ, Fibromyalgia, ചിരകാല വേദന, സ്ട്രെസ്സ് മാനേജ്മെന്റ്, കോംപ്ലക്സ് പരിക്കുകൾ എന്നിവ.

എൽ-പാസോയുടെ ചികിൽസാകൃഷി പുനരധിവാസ ക്ലിനിക്കവും ഇന്റഗ്രേറ്റഡ് മെഡിസിൻ സെന്ററും എന്ന നിലയിൽ, പരുക്കേറ്റ പരിക്കുകളോടെയും വിട്ടുമാറാത്ത വേദന സിൻഡ്രോമുകളുടെയും ഫലമായി രോഗികൾക്ക് ചികിത്സ നൽകുന്നു. എല്ലാ പ്രായവിഭാഗങ്ങൾക്കും വൈകല്യങ്ങൾക്കും അനുയോജ്യമായ വഴക്കവും ചലനാത്മകവും വേഗവുമുളള പ്രവർത്തനങ്ങളിലൂടെ നിങ്ങളുടെ കഴിവ് മെച്ചപ്പെടുത്തുന്നതിന് ഞങ്ങൾ ശ്രദ്ധ കേന്ദ്രീകരിക്കുന്നു.

കൂടുതൽ ഊർജ്ജം, നല്ല മനോഭാവം, മെച്ചപ്പെട്ട ഉറക്കം, കുറവ് വേദന, ശരിയായ ശരീരഭാരം എന്നിവ ജീവിതത്തിൽ എങ്ങനെ നിലനിറുത്തണമെന്ന് അറിഞ്ഞിരിക്കേണ്ട ഒരു ജീവിതം നിങ്ങൾക്ക് ജീവിക്കാൻ ഞങ്ങൾ ആഗ്രഹിക്കുന്നു. എന്റെ രോഗികളിൽ ഓരോരുത്തരെയും പരിപാലിക്കുന്നതിനുള്ള ഒരു ജീവിതം ഞാൻ നടത്തിയിട്ടുണ്ട്.

ഞാൻ നിങ്ങൾക്ക് ഉറപ്പു നൽകുന്നു, നിങ്ങൾക്ക് വേണ്ടി ഏറ്റവും മികച്ചത് മാത്രമേ ഞാൻ സ്വീകരിക്കൂ ...

നിങ്ങൾ ഈ വീഡിയോ ആസ്വദിക്കുകയും ഞങ്ങളൊന്ന് ഏതെങ്കിലും വിധത്തിൽ നിങ്ങളെ സഹായിക്കുകയും ചെയ്തിട്ടുണ്ടെങ്കിൽ, ദയവായി മടിക്കേണ്ട സബ്സ്ക്രൈബുചെയ്യുന്നതിനും ഒപ്പം ഞങ്ങളെ ശുപാർശ ചെയ്യുക.

ശുപാർശ: ഡോ. അലക്സ് ജിമെനെസ് - ശസ്ത്രക്രിയാനടിക്കൽ

ആരോഗ്യ ഗ്രേഡുകൾ: http://www.healthgrades.com/review/3SDJ4

ഫേസ്ബുക്ക് ക്ലിനിക്കൽ പേജ്: https://www.facebook.com/dralexjimene…

Facebook സ്പോർട്സ് പേജ്: https://www.facebook.com/pushasrx/

ഫേസ്ബുക്ക് പരിക്കുകൾ പേജ്: https://www.facebook.com/elpasochirop…

ഫേസ്ബുക്ക് ന്യൂറോപാതി പേജ്: https://www.facebook.com/ElPasoNeurop…

സഹായം: http://goo.gl/pwY2n2

ക്ലിനിക്കൽ സാക്ഷ്യപത്രങ്ങൾ: https://www.dralexjimenez.com/categor…

വിവരം: ഡോ. അലക്സ് ജിമെനെസ് - ശസ്ത്രക്രിയാ വിദഗ്ധൻ

ക്ലിനിക്കൽ സൈറ്റ്: https://www.dralexjimenez.com

മുറിവ് സൈറ്റ്: https://personalinjurydoctorgroup.com

സ്പോർട്സ് ഉപദ്രവം സൈറ്റ്: https://chiropracticscientist.com

തിരികെ പരിക്കുള്ള സൈറ്റ്: https://www.elpasobackclinic.com

ഇതിൽ ലിങ്ക് ചെയ്തിരിക്കുന്നു: https://www.linkedin.com/in/dralexjim…

Pinterest: https://www.pinterest.com/dralexjimenez/

ട്വിറ്റർ: https://twitter.com/dralexjimenez

ട്വിറ്റർ: https://twitter.com/crossfitdoctor

ശുപാർശ: പുഷ്പത്തെ പോലെ-ആർക്സ് ® ™

പുനരധിവാസകേന്ദ്രം: https://www.pushasrx.com

ഫേസ്ബുക്ക്: https://www.facebook.com/PUSHftinessa…

പുഷ്-ആർ-റെക്സ്: http://www.push4fitness.com/team/

വിട്ടുമാറാത്ത വേദന പുനരധിവാസം | വീഡിയോ | എൽ പാസോ, TX.

വിട്ടുമാറാത്ത വേദന പുനരധിവാസം | വീഡിയോ | എൽ പാസോ, TX.

ഒരു സ്ലിപ്-ആൻഡ്-വീലാബാധയെത്തുടർന്ന്, ജോലി ചെയ്യാനുള്ള തന്റെ കഴിവിന്റെ കാര്യത്തിൽ അരാസ്കി നോർട് പരിമിതമായിരുന്നു, അത് അവളുടെ ജീവിത ഗുണനിലവാരത്തെ ബാധിച്ചു. വിട്ടുമാറാത്ത വേദന കാരണം, സ്ഥിരവും ദൈനംദിന ഉത്തരവാദിത്തങ്ങളിലും അരാസ്കിക്ക് പ്രയാസമായിരുന്നു. എലി പാസോ, ടി. ഡോക്ടർ അലക്സ് ജിമനേസ് തന്റെ അഭിഭാഷകനായ അരാക്കിയിൽ നിന്നും വിട്ടുമാറാത്ത വേദനയിൽ നിന്ന് ആശ്വാസം കണ്ടെത്തി. ഡോക്ടർ ജിമെനെസ് പരുക്കേറ്റതിനെത്തുടർന്ന് അവരുടെ ആരോഗ്യപ്രശ്നങ്ങൾ, അവരുടെ ചികിത്സാ പ്രശ്നങ്ങൾ എന്നിവയെക്കുറിച്ച് അറിഞ്ഞിരുന്നു. വിട്ടുമാറാത്ത വേദനയ്ക്ക് ശസ്ത്രക്രിയാവിശദീകരണം എന്ന നിലയിൽ ഡോ. ജിമെനെസ് അശ്രദ്ധമായി ശുപാർശ ചെയ്യുന്നു. വിട്ടുമാറാത്ത വേദന പല കാരണങ്ങൾകൊണ്ട് ഉണ്ടാകുന്ന ഒരു പൊതുവായ പ്രശ്നമാണ്, പരിക്കുകൾ, അടിസ്ഥാനപരമായ സാഹചര്യങ്ങൾ ഉൾപ്പെടെ, കൈറോപ്രാക്റ്റിക് കെയർ വിട്ടുമാറാത്ത വേദന ലക്ഷണങ്ങൾ ഒഴിവാക്കാൻ സഹായിക്കും.

ചിക്കരപ്രശ്ന പുനരധിവാസം

ക്രോണിക് വേദന ചിയോപ്രക്റ്റിക്കൽ കെയർ എ എൽ പാസോ ടി.

ഞങ്ങൾ നിങ്ങൾക്കു കാണിച്ചുതരാം എൽ പാസോയുടെ പ്രീമിയർ വെൽനെസ് ആൻഡ് ഇൻജുറി കെയർ ക്ലിനിക്.

ഞങ്ങളുടെ സേവനങ്ങൾ സ്പെഷ്യലൈസ് ചെയ്തവയാണ്, പരിക്കുകളും പൂർണ്ണമായ വീണ്ടെടുക്കൽ പ്രക്രിയയും ആണ്. ഞങ്ങളുടെ മേഖലകൾ ഉൾപ്പെടുന്നു ആരോഗ്യവും പോഷകാഹാരവും, വിട്ടുമാറാത്ത വേദന, വ്യക്തിപരമായ അപമാനം, വാഹന അപകട സംരക്ഷണം, ജോലി പരിക്കുകൾ, ബാക്ക് ട്രീറ്റ്മെന്റ്, ലോ പുറം വേദന, കഴുത്തു വേദന, മൈഗ്രെയ്ൻ ചികിത്സ, കായിക പ്രശ്നങ്ങൾ, കഠിനമായ സൈറ്റികാ, സ്കോളിയോസിസ്, കോംപ്ലക്സ് ഹർണിയേറ്റഡ് ഡിസ്ക്കുകൾ, Fibromyalgia, ചിരകാല വേദന, സ്ട്രെസ്സ് മാനേജ്മെന്റ്, കോംപ്ലക്സ് പരിക്കുകൾ എന്നിവ.

എൽ-പാസോയുടെ ചികിൽസാകൃഷി പുനരധിവാസ ക്ലിനിക്കവും ഇന്റഗ്രേറ്റഡ് മെഡിസിൻ സെന്ററും എന്ന നിലയിൽ, പരുക്കേറ്റ പരിക്കുകളോടെയും വിട്ടുമാറാത്ത വേദന സിൻഡ്രോമുകളുടെയും ഫലമായി രോഗികൾക്ക് ചികിത്സ നൽകുന്നു. എല്ലാ പ്രായവിഭാഗങ്ങൾക്കും വൈകല്യങ്ങൾക്കും അനുയോജ്യമായ വഴക്കവും ചലനാത്മകവും വേഗവുമുളള പ്രവർത്തനങ്ങളിലൂടെ നിങ്ങളുടെ കഴിവ് മെച്ചപ്പെടുത്തുന്നതിന് ഞങ്ങൾ ശ്രദ്ധ കേന്ദ്രീകരിക്കുന്നു.

കൂടുതൽ ഊർജ്ജം, നല്ല മനോഭാവം, മെച്ചപ്പെട്ട ഉറക്കം, കുറവ് വേദന, ശരിയായ ശരീരഭാരം എന്നിവ ജീവിതത്തിൽ എങ്ങനെ നിലനിറുത്തണമെന്ന് അറിഞ്ഞിരിക്കേണ്ട ഒരു ജീവിതം നിങ്ങൾക്ക് ജീവിക്കാൻ ഞങ്ങൾ ആഗ്രഹിക്കുന്നു. എന്റെ രോഗികളിൽ ഓരോരുത്തരെയും പരിപാലിക്കുന്നതിനുള്ള ഒരു ജീവിതം ഞാൻ നടത്തിയിട്ടുണ്ട്.

ഞാൻ നിങ്ങൾക്ക് ഉറപ്പു നൽകുന്നു, നിങ്ങൾക്ക് വേണ്ടി ഏറ്റവും മികച്ചത് മാത്രമേ ഞാൻ സ്വീകരിക്കൂ ...

നിങ്ങൾ ഈ വീഡിയോ ആസ്വദിക്കുകയും ഞങ്ങളൊന്ന് ഏതെങ്കിലും വിധത്തിൽ നിങ്ങളെ സഹായിക്കുകയും ചെയ്തിട്ടുണ്ടെങ്കിൽ, ദയവായി മടിക്കേണ്ട സബ്സ്ക്രൈബുചെയ്യുന്നതിനും ഒപ്പം ഞങ്ങളെ ശുപാർശ ചെയ്യുക.

ശുപാർശ: ഡോ. അലക്സ് ജിമെനെസ് - ശസ്ത്രക്രിയാനടിക്കൽ

ആരോഗ്യ ഗ്രേഡുകൾ: http://www.healthgrades.com/review/3SDJ4

ഫേസ്ബുക്ക് ക്ലിനിക്കൽ പേജ്: https://www.facebook.com/dralexjimene…

Facebook സ്പോർട്സ് പേജ്: https://www.facebook.com/pushasrx/

ഫേസ്ബുക്ക് പരിക്കുകൾ പേജ്: https://www.facebook.com/elpasochirop…

ഫേസ്ബുക്ക് ന്യൂറോപാതി പേജ്: https://www.facebook.com/ElPasoNeurop…

സഹായം: http://goo.gl/pwY2n2

ക്ലിനിക്കൽ സാക്ഷ്യപത്രങ്ങൾ: https://www.dralexjimenez.com/categor…

വിവരം: ഡോ. അലക്സ് ജിമെനെസ് - ശസ്ത്രക്രിയാ വിദഗ്ധൻ

ക്ലിനിക്കൽ സൈറ്റ്: https://www.dralexjimenez.com

മുറിവ് സൈറ്റ്: https://personalinjurydoctorgroup.com

സ്പോർട്സ് ഉപദ്രവം സൈറ്റ്: https://chiropracticscientist.com

തിരികെ പരിക്കുള്ള സൈറ്റ്: https://www.elpasobackclinic.com

ഇതിൽ ലിങ്ക് ചെയ്തിരിക്കുന്നു: https://www.linkedin.com/in/dralexjim…

Pinterest: https://www.pinterest.com/dralexjimenez/

ട്വിറ്റർ: https://twitter.com/dralexjimenez

ട്വിറ്റർ: https://twitter.com/crossfitdoctor

ശുപാർശ: പുഷ്പത്തെ പോലെ-ആർക്സ് ® ™

പുനരധിവാസകേന്ദ്രം: https://www.pushasrx.com

ഫേസ്ബുക്ക്: https://www.facebook.com/PUSHftinessa…

പുഷ്-ആർ-റെക്സ്: http://www.push4fitness.com/team/

എന്താണ് ചിക്കൻക്രോക് രോഗികൾക്ക് കുർകുമിയെ കുറിച്ച് അറിയാൻ

എന്താണ് ചിക്കൻക്രോക് രോഗികൾക്ക് കുർകുമിയെ കുറിച്ച് അറിയാൻ

വിട്ടുമാറാത്ത വേദന യുണൈറ്റഡ് സ്റ്റേറ്റ്സിലെ ഏറ്റവും ജനപ്രീതിയാർജ്ജിച്ച അവസ്ഥകളിൽ ഒന്നാണ്, ഇത് കണക്കാക്കപ്പെടുന്നു നൂറുകോടി ദശലക്ഷം അമേരിക്കക്കാർ ഓരോ വര്ഷവും. ഇത് കാഴ്ചപ്പാടിലേക്ക് പകർത്താൻ, അർബുദം, ഹൃദ്രോഗം, പ്രമേഹം തുടങ്ങിയവരുടെ എണ്ണത്തേക്കാൾ കൂടുതലാണ് അത്, കൂടിച്ചേർന്നു.

വിട്ടുമാറാത്ത വേദനയെ ബാധിക്കുന്ന പല രോഗികളും മരുന്നുകൾക്കപ്പുറം അനാവശ്യവും ദോഷകരവുമായ സൈഡ് ഇഫക്റ്റുകൾക്ക് പരിഹാരം കാണാൻ ശ്രമിക്കുകയാണ്. ഇത് അവരെ സ്വാഭാവിക വേദന മാനേജ്മെൻറ് രീതികളിലൂടെ കൈറോഗ്രാക്റ്റ് ചികിത്സയും curcumin പോലുള്ള പ്രകൃതിദത്ത പദാർത്ഥങ്ങളും പോലുള്ളവയിലേക്ക് എത്തിച്ചു. അനേകം ആളുകൾക്ക് ഈ ചികിത്സാരീതികൾ വേദനയിൽ നിന്ന് ആശ്വാസം ലഭിക്കുകയും അവരെ കൂടുതൽ സാധാരണ ജീവിതത്തിലേക്ക് തിരികെ കൊണ്ടുവരാൻ സഹായിക്കുകയും ചെയ്യുന്നു.

ഇത് എങ്ങനെ പ്രവർത്തിക്കുന്നു? ഏറ്റവും പ്രധാനമായി, ഇത് നിങ്ങൾക്ക് വേണ്ടി പ്രവർത്തിക്കാൻ കഴിയുമോ?

എന്താണ് കർകുമിൻ?

ക്രോകമിൻ ക്രോണിക് വേദന എലോ പാസ്സോ ടി.
സ്വാഭാവിക ഹെർബൽ പുതിയ സസ്യം ഇലകളും പേപ്പർ ഉണങ്ങിയ curcumin കൂടെ മഞ്ഞൾ കാപ്സ്യൂളുകൾ

ഇഞ്ചി ഒരു ബന്ധുവാണ്. ഇത് മഞ്ഞൾ ഒരു ഘടകമാണ്. അമേരിക്കയിൽ പലപ്പോഴും curcumin ഉം മഞ്ഞും പരസ്പരം മാറി ഉപയോഗിക്കാറുണ്ട്. മഞ്ഞ നിറത്തിന് മഞ്ഞ നിറം നൽകുന്നത് curcumin ആണ്.

പലപ്പോഴും കറികളിലും മറ്റു പരമ്പരാഗത ഇന്ത്യൻ ഭക്ഷണങ്ങളിലും ഇത് കാണപ്പെടുന്നുണ്ട്. ശരീരത്തിൽ വേദനയുണ്ടാക്കുന്ന വീക്കം ഉൾപ്പെടെയുള്ള പല ആരോഗ്യപ്രശ്നങ്ങൾക്കും ഇത് ധാരാളം ഉപയോഗിക്കുന്നു. ഈ അവകാശവാദങ്ങൾ പല പഠനങ്ങളും ബാക്കിവച്ചിട്ടുണ്ട്. രുചിയുള്ള സുഗന്ധത്തിൽ നിന്ന് ലഭിക്കുന്ന ആരോഗ്യ ആനുകൂല്യങ്ങൾ വ്യക്തമാക്കുന്നു.

ഈ പഠനങ്ങൾ കാണിക്കുന്നത് curcumin ഉണ്ട് ശക്തമായ വിരുദ്ധ രാസ സ്വഭാവങ്ങൾ എന്തുകൊണ്ടാണ് അത് പ്രവർത്തിക്കുന്നതെന്ന് ഇതുവരെ പൂർണ്ണമായി മനസിലായിട്ടില്ല. ഈ വിവരങ്ങൾ വിട്ടുമാറാത്ത വേദന ഉൾപ്പെടെയുള്ള വിശാലമായ ശ്രേണികളിലേക്ക് curcumin ന്റെ ഫലപ്രാപ്തി നിർണ്ണയിക്കാൻ കൂടുതൽ പഠനങ്ങൾ നടത്താൻ പ്രേരിപ്പിച്ചു.

ആർത്രൈറ്റിസ് അഥവാ സംയുക്ത വേദന അനുഭവിക്കുന്ന ആളുകളുടെമേൽ സുഗന്ധവ്യഞ്ജനങ്ങളുടെ പ്രഭാവം ഒരു പഠനം പരിശോധിച്ചു. മഞ്ഞൾ എക്സ്ട്രാക്റ്റിന്റെ (curcumin) സപ്ലിമെൻറുകൾ മാത്രമായിരുന്നു എന്ന് കണ്ടെത്തി ഇബുപ്രോഫെൻ പോലെ ഫലപ്രദമാണ് മുട്ടു ഓസ്റ്റിയോ ആർത്രൈറ്റിസ് രോഗികളിൽ വേദന ഒഴിവാക്കുന്നതിൽ. വേദന ഉണ്ടാകുന്ന വേദന കുറയ്ക്കാൻ രോഗികൾക്ക് ആവശ്യമുള്ള ആശ്വാസം പ്രദാനം ചെയ്തു.

മെച്ചപ്പെട്ട ആരോഗ്യത്തിന് കുക്ക്മുമിൻ എടുക്കൽ

നിങ്ങൾക്ക് curcumin അല്ലെങ്കിൽ ടർമർ അനുബന്ധങ്ങൾ ലഭിക്കും, എന്നാൽ സ്റ്റാൻഡേർഡ് ഡോസ് വിവരങ്ങൾ ലഭ്യമല്ല. നിങ്ങളുടെ വീട്ടുചോദകൻ എങ്ങനെ കഴിക്കണം, ഏതൊക്കെ സപ്ലൈൻറ് ബ്രാൻഡുകൾ മികച്ചതാണെന്ന് നിങ്ങളെ ഉപദേശിക്കാൻ കഴിയും.

നിങ്ങൾ കഴിക്കുന്ന ആഹാരത്തിൽ സുഗന്ധവും ഉപയോഗിക്കാം, കൂടാതെ ആരോഗ്യപ്രശ്നങ്ങളാൽ നല്ലൊരു ബിറ്റ് ലഭിക്കും. എന്നിരുന്നാലും, curcumin അല്ലെങ്കിൽ turmeric സപ്ലിമെന്റുകളെടുക്കാൻ കൂടുതൽ ഫലപ്രദവും കൂടുതൽ സുഖകരവുമായേക്കാം, പ്രത്യേകിച്ച് നിങ്ങൾ വീക്കം വേദനയും വേദനയും കൈകാര്യം ചെയ്യുമ്പോൾ.

വളരെ കുറച്ച് പാർശ്വഫലങ്ങൾ ഉള്ളതിനാൽ കുക്ക്മുമിൻ സാധാരണയായി സുരക്ഷിതമാണ്. ഏതെങ്കിലും മരുന്നുകളോ സപ്ലിമെന്റുകളോ പോലെ, ചിലർ സുഗന്ധവ്യഞ്ജനങ്ങളോട് സംവേദനക്ഷമതയുള്ളവരും വയറിളക്കം, ഓക്കാനം എന്നിവയും അനുഭവപ്പെട്ടേക്കാം.

എന്നിരുന്നാലും, ഇത് സാധാരണയായി ഉയർന്ന അളവിൽ നടക്കുന്നു, അല്ലെങ്കിൽ രോഗിയുടെ ദീർഘകാലത്തേയ്ക്ക് അത് ഉപയോഗപ്പെടുത്തുകയും ചെയ്യുന്നു. അൾസർ ഉണ്ടെങ്കിൽ ഹൈ ഡോസുകൾ അപകടസാധ്യത നൽകും. ഇത് ചർമ്മത്തെ അലോസരപ്പെടുത്താം.

നിങ്ങൾ ഒരു ആരോഗ്യ സപ്ലിമെന്റായി നിങ്ങളുടെ ദൈനംദിന ഭക്ഷണത്തിലേക്ക് curcumin സംയോജിപ്പിച്ച് പരിഗണിച്ച് പരിഗണിക്കുകയാണെങ്കിൽ, നിങ്ങൾ അത് നിങ്ങൾക്ക് സുരക്ഷിതമാണെന്ന് ഉറപ്പാക്കാൻ ഡോക്ടർ അല്ലെങ്കിൽ ചിറാപുത്രിയോടു സംസാരിക്കണം. ഗർഭിണികളോ അല്ലെങ്കിൽ നഴ്സിംഗുകളോ ആയ സ്ത്രീകൾക്ക് ഇവ കഴിക്കാൻ പാടില്ല.

സപ്ലിമെന്റ് ഉപയോഗിക്കുമ്പോൾ പ്രമേഹം, പിത്തസഞ്ചി പ്രശ്നങ്ങൾ, രക്തസ്രാവം രോഗങ്ങൾ, വൃക്കരോഗങ്ങൾ, അല്ലെങ്കിൽ പ്രതിരോധശക്തിയുള്ള പ്രശ്നങ്ങൾ എന്നിവയുൾപ്പെടെയുള്ളവർ ശ്രദ്ധിക്കണം. അതുപോലെ, അതു നിങ്ങളുടെ ശസ്ത്രക്രിയ പോലെ നിങ്ങളുടെ ആരോഗ്യ പ്രൊഫഷണല് സംസാരിക്കാനും മുമ്പ് അതു NSAIDs, ആസ്പിരിൻ, പ്രമേഹ മരുന്നുകൾ, statins, രക്തം thinners, രക്തസമ്മർദ്ദം മരുന്നുകൾ ഉപയോഗിച്ച് ഇടപെടാൻ കഴിയും. സപ്ലിമെന്റ് മെച്ചപ്പെടുത്തുന്നതിന് അവർ നിങ്ങളുടെ ഡോസ് ക്രമീകരിക്കാം അല്ലെങ്കിൽ ചില പോഷകാഹാര ചികിത്സകൾ നിർദ്ദേശിക്കാറുണ്ട്.

നിങ്ങളുടെ ചിപ്പാക്ടർ നിങ്ങൾ കൂടുതൽ സ്വാഭാവികമായും ജീവിക്കാൻ സഹായിക്കും, വേദനയല്ലാത്ത ജീവിതവും curcumin പോലുള്ള അനുബന്ധങ്ങളും ആ പദ്ധതിയുടെ ഭാഗമായിരിക്കാം. നിങ്ങളുടെ ജീവിതത്തിലെ ഏറ്റവും മികച്ച ജീവിതത്തിലേക്ക് അവർക്ക് നിങ്ങളെ സഹായിക്കാനാകും.

വിട്ടുമാറാത്ത വേദന

മൾട്ടിപ്പിൾ സ്ക്ലിറോസിസ് ലെ പോഷകാഹാര വസ്തുതകൾ

മൾട്ടിപ്പിൾ സ്ക്ലിറോസിസ് ലെ പോഷകാഹാര വസ്തുതകൾ

പല ആരോഗ്യസുരക്ഷാ വിദഗ്ധരും രോഗികളോട് നല്ല നിർദ്ദേശിക്കാറുണ്ട് മൾട്ടിപ്പിൾ സ്ക്ലിറോസിസ് അല്ലെങ്കിൽ MS, പാൽ ഒഴിവാക്കുക. പല ഗവേഷണ പഠനങ്ങളും എം.എസ്. ക്ഷീര-പാൽ, പ്രത്യേകിച്ച് പശുവിന്റെ പാലുമായുള്ള ഉയർന്ന പരസ്പര ബന്ധം തെളിയിച്ചിട്ടുണ്ട്. ഉദാഹരണത്തിന്, പശുവിൻ പാൽ പ്രോട്ടീനുകളിൽ ഒന്നിലധികം സ്ക്ലിറോസിസ് രോഗികളുടെ പ്രതിരോധകോശങ്ങൾ ലക്ഷ്യം. ബ്യൂറോരോഫിനും ബോവിയൻ സെറം ആൽബീമിനും അല്ലെങ്കിൽ ബിഎസ്എയും ഉൾപ്പെടുന്നു. കൂടാതെ, ആ പശുവിന്റെ പ്രോട്ടീൻ പരീക്ഷണങ്ങളിലേക്കു കുത്തിവെക്കുകയും, അവരുടെ കേന്ദ്ര നാഡീവ്യൂഹങ്ങളിൽ പ്രത്യക്ഷപ്പെടാൻ കാരണമാവുകയും ചെയ്തു.

പശുവിന്റെ പാലിൽ ചില പ്രോട്ടീനുകൾ മലിലി ഒലിഗോഡെൻഡ്രോസൈറ്റ് ഗ്ലൈക്കോപ്റ്റെടിൻ അല്ലെങ്കിൽ എം.ജി.ജി എന്ന ഭാഗത്തെ അനുകരിക്കുന്നതാണ്. മൾലിൻ സ്ക്ലിറോസിസുമായുള്ള യാന്ത്രികഇൻയൂൺ പ്രതിപ്രവർത്തനം ആരംഭിക്കുന്നതായി വിശ്വസിക്കപ്പെടുന്ന മലിലിൻറെ ഭാഗമാണ്. ഇതിനു പുറമേ, പ്രതിരോധ സംവിധാനത്തെ എം.ജി.ജി ആക്രമണത്തിന് പ്രേരിപ്പിക്കുക, തുടർന്ന് അത് ഡീമെലീലിനേഷൻ ഉണ്ടാക്കുക. അമേരിക്കയിൽ കൂടുതൽ പുരുഷന്മാരും സ്ത്രീകളും ഉൾപ്പെടുന്ന മറ്റൊരു ഗവേഷണ പഠനമനുസരിച്ച്, പശുവിന്റെ പാലും ഡീജനറേറ്റീവ് ന്യൂറോളജിക്കൽ ഡിസോർഡർ പാർക്കിൻസൺസ് ഡിസസുമായി ബന്ധം നിർണയിക്കാനും തീരുമാനിച്ചു. ഡയറി ഉത്പന്നങ്ങൾ, പ്രത്യേകിച്ച് പശുവിൻപാൽ, നാഡീ കലകളിൽ സാധാരണ വിഷബാധയുണ്ടെന്ന് ഗവേഷകർ നിരീക്ഷിച്ചു.

ലാക്റ്റോസ് അസഹിഷ്ണുത സാധാരണ ജനങ്ങൾക്കിടയിൽ സാധാരണമാണ്. മെഡിറ്ററേനിയൻ, ഏഷ്യൻ, ആഫ്രിക്കൻ ജനസംഖ്യകളിൽ ഇത് വളരെ സാധാരണമാണ്. ലാക്ടോസ് അസഹിഷ്ണുതകൊണ്ട് ആളുകൾ വീക്കം, വൈക്കോൽ, വയറിളക്കം, ഓക്കാനം തുടങ്ങിയ ലക്ഷണങ്ങൾ കാണിക്കുന്നു. എംഎൽ ഉപഭോഗ ക്ഷീരോല്പാദനം ഉൽപ്പാദിപ്പിക്കുന്ന ആളുകൾക്ക് സാധ്യതയുള്ള അപകടസാധ്യതകൾ കണക്കിലെടുക്കുമ്പോൾ, ആരോഗ്യപരമായ വിദഗ്ദ്ധർ ക്ഷീരോത്പന്നങ്ങളുടെ ഉപഭോഗം ഒഴിവാക്കാൻ നിർദ്ദേശിക്കുന്നു. മൾട്ടിപ്പിൾ സ്ക്ലിറോസിസിലെ പോഷകാഹാര വസ്തുതകളെക്കുറിച്ചാണ് താഴെ കൊടുത്തിരിക്കുന്ന ലേഖനം ഉദ്ദേശിക്കുന്നത്. എം.എസ്.

വേര്പെട്ടുനില്ക്കുന്ന

ഭക്ഷണ ശീലങ്ങളും ജീവിതശൈലിയും ഒന്നിലധികം സ്ക്ലിറോസിസ് (എം.എസ്.) കാലഘട്ടത്തിൽ സ്വാധീനം ചെലുത്തുന്നുണ്ടോ എന്ന ചോദ്യത്തിന്, ഇപ്പോഴും എം.എസ് തെറാപ്പി ഭക്ഷണവും ജീവിതരീതിയും സംബന്ധിച്ച വിവരങ്ങളുമായി ബന്ധപ്പെടുത്തിയിട്ടില്ല. MS രോഗികളുടെ അവസ്ഥയെ പുനർവിചിന്തനം ചെയ്യുന്നതും MS പ്രാഥമിക പുരോഗമന MS ലെ പ്രാഥമിക പുരോഗമന ക്ഷമതയിൽ MS രോഗലക്ഷണങ്ങൾ മെച്ചപ്പെടുത്തുന്നതും ഇവിടെ സൂചിപ്പിക്കുന്നു. മനുഷ്യശരീരത്തിലെ ഉപാപചയവും വമിക്കുന്നതുമായ വഴികൾക്കും കമ്യൂണൽ ഗട്ട് മൈക്രോബയോട്ടയുടെ ഘടനയ്ക്കും ഇതുവഴി സാധിക്കും. ഉയർന്ന ഉപ്പ്, മൃഗാഹാരം, ചുവന്ന മാംസം, പഞ്ചസാര, മധുരമുള്ള പാനീയങ്ങൾ, വറുത്ത ആഹാരം, കുറഞ്ഞ ഫൈബർ, ശാരീരിക വ്യായാമത്തിൻറെ അഭാവം എന്നിവയിൽ നിന്നുള്ള പാശ്ചാത്യ-ശൈലി ഭക്ഷണങ്ങളാണ് വീക്കം വർദ്ധിക്കുന്നത്. ഈ തരത്തിലുള്ള ആഹാരത്തിന്റെ സ്ഥിരത ബയോസിന്തറ്റിക് പാറ്റേണുകളിലേക്ക് ബയോസിന്തത്തിക് പാറ്റേണുകളിലേക്കും, ഡിസ്ബിയിയോട്ടിക് ഗട്ട് മൈക്രോബറ്റോ, കുടൽ പ്രതിരോധശേഷി പരിവർത്തനത്തിനും, കുറഞ്ഞ ഗ്രേഡ് സിസ്റ്റമാറ്റിക് വീക്കം എന്നിവയിലേക്കും നയിക്കുന്നു. പച്ചക്കറികൾ, പഴങ്ങൾ, പയർവർഗങ്ങൾ, മത്സ്യങ്ങൾ, പ്രീബയോട്ടിക്സ്, പ്രോബയോട്ടിക്സ് എന്നിവയെ അടിസ്ഥാനമാക്കിയുള്ള അണുക്കൾ, ഓക്സിഡേറ്റീവ് മെറ്റബോളിസത്തെ ഉയർത്തിപ്പിടിക്കുക, പ്രോനിഫ്ലാമറ്ററി തന്മാത്രകളുടെ സമന്വയത്തെ നീക്കം ചെയ്യുക, ആരോഗ്യകരമായ സിംബയോട്ടിക് പുനഃസ്ഥാപിക്കുക സൂക്ഷ്മജീവികൾ ഇപ്പോൾ, ഭക്ഷണക്രമവും വ്യായാമവും എം.എസ്യിൽ വീർക്കുന്ന അവസ്ഥയെ സ്വാധീനിക്കുന്ന തന്മാത്ര സംവിധാനങ്ങളെക്കുറിച്ച് നമുക്ക് അറിയാം. വിരുദ്ധ-മയക്കുമരുന്ന് മരുന്ന് കഴിക്കുന്ന ഒരു പോഷകാഹാരം, രോഗപ്രതിരോധ ശേഷി ഉള്ള മരുന്നുകൾ, ക്ഷീണം സിൻഡ്രോം, അങ്ങനെ ക്ഷമയോടെയുള്ള സൗഖ്യമാക്കുകയും ചെയ്യുന്നു.

അടയാളവാക്കുകൾ: പകര ചികിത്സ, ഗാട്ട് സൂക്ഷ്മതരം, വീക്കം, ജീവിതശൈലി, മൾട്ടിപ്പിൾ സ്ക്ലിറോസിസ്, പോഷകാഹാരം

അവതാരിക

കേന്ദ്ര നാഡീവ്യൂഹം (CNS) ഒരു ദീർഘവും, തണുത്തുമുള്ളതും, സ്വയം രോഗപ്രതിരോധവ്യവസ്ഥയുമാണ് മൾട്ടിപ്പിൾ സ്ക്ലിറോസിസ് (എം.എസ്.). ഇത് മലിലിൻറെ കട്ടിയുള്ള ഫോക്കൽ ഡേഡാഡേഷൻ, ചാൻസലർ, ന്യൂറോണൽ പരിക്കുകൾ, വൈകല്യങ്ങൾ തുടങ്ങിയവയാണ്. ഓട്ടോയോജനപരമായ ടി സെൽ, ബി ലിംഫോസൈറ്റുകൾ, മാക്രോഫേജുകൾ, മസ്തിഷ്കത്തിനും വെന്റമേഡ് കോർഡ് വൈറ്റ് ദ്രാവകത്തിനും (മക് ഫാർലാൻഡും മാർട്ടിൻ, 2007; കോൺസ്റ്റന്റൈൻസ്ക്യൂ ആൻഡ് ഗ്രാൻ, ക്യുട്സൻഗ്ഗ് ആൻഡ് ലാസ്മാൻ, 2010).

ആക്റ്റിവിഡീസ് (Krumbholz et al., 2012), ആക്ടിവേറ്റഡ് ഫങ്ഷൻ (ഇൻഗ്രാം et al., 2014), സൈറ്റോകൈൻസ്, മൈറ്റോകോണ്ട്റൽ ഡിസ്ഫണ്ടക്ഷൻ (സു, അൽ, 2009), ആക്ടിവ് ഓക്സിജൻ സ്പീഷീസ് (റോ; ഗിൽഗൺ-ഷെർകി തുടങ്ങിയവരും), (MMPs; Liuzzi et al., Rossano et al., 2004), രോഗപഠനം നടത്താൻ പരസ്പരം സഹകരിക്കണം.

ക്ലിനിക്കൽ വീക്ഷണകോണിൽ നിന്ന് കുറഞ്ഞത് രണ്ട് പ്രധാന അസുഖങ്ങൾ ഉണ്ട്: പുനരധിവാസം-റിമൈറ്റിങ് എം.എസ്. (RRMS; ക്ലിനിക്കൽ കേസുകളിൽ ഏതാണ്ട് 85%) പ്രാഥമിക പുരോഗമന MS (PPMS; ക്ലിനിക്കൽ കേസുകളിൽ ഏതാണ്ട് 15%) (ദത്ത, ട്രാപ്പ്, NUMX L L L L L L L L, ubl L L et et et et et et et, ubl,,,,,,,,,,,,, al,,,,,,. സാധാരണഗതിയിൽ സെക്കൻഡറി പുരോഗമന MS (SPMS) ൽ രൂപം കൊള്ളുന്ന RRMS ൽ, ​​മസ്തിഷ്കത്തിലെ ലിസിങ്ങുകൾ വർദ്ധിക്കുന്നതും, കൂടുതലോ കുറവോ സമ്പൂർണ്ണ റിനീഷനുകളോ ഉണ്ടാകുന്നതും, പി.പി.എം.എസ്സിന്റെ രോഗപ്രതിരോധം പുരോഗമന ന്യൂറോളജിക്കൽ നാശനഷ്ടങ്ങളാൽ വിശ്രമിക്കും, റിവിഷനുകളേക്കാളും.

നിലവിൽ, ചുരുങ്ങിയത് 10 രോഗം മാറ്റുന്ന ചികിത്സാരീതികളാണ് രോഗബാധയുടെ വേഗത കുറയ്ക്കുന്നതിനും ചില വൈകല്യത്തിൻറെ ലക്ഷണങ്ങളെ തടയുന്നതിനും കണ്ടെത്തിയിട്ടുണ്ട്, പക്ഷേ ആർ ആർഎംഎസിനെ മാത്രം. എന്നിരുന്നാലും, ഓരോ കോഴ്സിലും ഓരോ കോഴ്സിലും സങ്കീർണ്ണവും സവിശേഷവുമായതിനാൽ, രോഗി ഇതേ രീതിയിൽ തെറാപ്പിക്ക് പ്രതികരിക്കുന്നില്ല (ലോലിറ്റ് et al., 2014). അതുപോലെ എല്ലായ്പ്പോഴും ചികിത്സയുടെ ഫലപ്രാപ്തിയെ വിലയിരുത്താൻ സഹായിക്കുന്ന വിശ്വസനീയമായ biomarkers ഇല്ല കൂടാതെ രോഗം നോവലിലെ അടയാളങ്ങൾ കണ്ടുപിടിക്കാൻ വളരെ പ്രാധാന്യമുണ്ട് (ഫെർണാണ്ടസ് et al., 2014).

ആർഎംഎസ്എസ്, പിപിഎംഎമ്മുകളിൽ പ്രവർത്തിക്കുന്ന പല രോഗനിർണയ രീതികൾ മൂലവും, പി.ആർ.എം.എസ്സിന്റെ കാര്യത്തിൽ പ്രതിരോധശേഷി ചികിത്സാ രീതികളുടെ പ്രതികരണമില്ലായ്മ. വീക്കം സംബന്ധിച്ച് ഇത് ശരിയായിരുന്നില്ല: വീക്കം, നാഡീവ്യൂഹം എന്നിവ തമ്മിലുള്ള ഒരു പ്രധാന ബന്ധം മസ്തിഷ്കത്തിൽ തന്നെ നിശിതവും മന്ദഗതിയിലുമാണ്. മാത്രമല്ല, സെക്കണ്ടറി, പ്രാഥമിക പുരോഗമന MS (ഫിഷർ, 2009), സജീവമായ എം.എസ്. ശിലകൾ എല്ലായ്പ്പോഴും വീക്കം (Kutzelnigg, Lassmann, 2013) എന്നിവയുമായി ബന്ധപ്പെട്ടിരിക്കുന്നു. ഇപ്രകാരം, വീക്കം രണ്ട് അസുഖങ്ങൾ ചികിത്സ ലക്ഷ്യം ആയിരിക്കണം.

ഭക്ഷണ ശീലങ്ങളും ജീവിതശൈലിയും ഉപയോഗിച്ച് വീക്കം കൂട്ടുന്നു

എന്താണ് MS- ൽ വീക്കം സംഭവിക്കുന്നത്? എം.എസ്. സങ്കീർണ്ണമായ ഒരു രോഗമാണ്, ജനിതകവും രോഗപ്രതിരോധ ഘടകങ്ങളും അതിന്റെ ഉത്ഭവത്തെ വിശദീകരിക്കാൻ പര്യാപ്തമല്ല. യഥാർത്ഥത്തിൽ, എംഎസ് ഒരു മൾട്ടിഫക്ടോളിയൽ പ്രകൃതിയും നിരവധി പാരിസ്ഥിതിക ഘടകങ്ങളും അല്ലെങ്കിൽ ഉപാപചയ സാഹചര്യങ്ങളും അതിന്റെ വളർച്ചയിൽ ഒരു പങ്കുണ്ടായിരിക്കാം (Ascherio, 2013): വൈറൽ അണുബാധകൾ (അസെരീറിയും മറ്റു പലരും, വെങ്കിടേശൻ, ജോൺസൺ, 2012), ഹെവി മെറ്റൽ വിഷബാധ (Latronico et et പുകവലി (Jafari and Hintzen, 2014), കുട്ടിക്കാലം പൊണ്ണത്തടി (Munger, 2013), കുറഞ്ഞ വിറ്റാമിൻ ഡി നില (അഷെരിയോ et al., 2013), അല്ലെങ്കിൽ തെറ്റായ ജീവിതരീതി, തെറ്റായ അടക്കമുള്ള ഭക്ഷണ ശീലങ്ങൾ (റിസ്ക്, എക്സെൽ, റിസ്ക്രോ, കൂടാതെ, റിസ്കിയോ, റോസാനോ, 2011).

മുകളിൽ വിവരിച്ച പാരിസ്ഥിതിക കാരണങ്ങളൊന്നും തന്നെ രോഗത്തെ വിശദീകരിക്കാനാവില്ല. എന്നിരുന്നാലും, ഇനിപ്പറയുന്ന പരിഗണനകൾ പകർച്ചവ്യാധി, പുകവലി പോലെയുള്ള ഭക്ഷണ ശീലങ്ങൾ, ജീവിതശൈലി എന്നിവയിൽ കൂടുതൽ ശ്രദ്ധ കേന്ദ്രീകരിക്കുന്നു, രോഗകാരണത്തെ സ്വാധീനിക്കുന്ന ഘടകങ്ങൾ:

  1. ഭൂമിശാസ്ത്രപരമായ വിതരണം: പാശ്ചാത്യരാജ്യങ്ങളിൽ ഏറ്റവും കൂടുതൽ വരുമാനമുള്ളതും മധ്യരേഖയിൽ ഏറ്റവും ദൂരെയുള്ളതുമായ എം. എസ് ആണ്. ഈ രാജ്യങ്ങളിലെ സവിശേഷതകൾ മണ്ടനായ ഒരു ജീവിതരീതിയാണ്, മൃഗങ്ങളുടെ ഉത്പന്നങ്ങൾ (പാശ്ചാത്യ ഭക്ഷണരീതി), കുറഞ്ഞ സൂര്യപ്രകാശം (WHO, MSIF, 2008) എന്നിവയാണ്.
  2. മൈഗ്രേഷൻ പ്രഭാവം: എൺപതാം വയസ്സിനു മുൻപ് കുറഞ്ഞ അളവിലുള്ള സംതരണം സംഭവിക്കുന്ന സ്ഥലങ്ങളിൽ നിന്നും കുടിയേറ്റം കുറയാത്തതിനാൽ, കുറഞ്ഞ അപകടസാധ്യത ഏറ്റെടുക്കുന്നു, ഈ പ്രായത്തിന് ശേഷമുള്ള കുടിയേറ്റം അപകടസാധ്യതയിൽ മാറ്റം വരുത്തുന്നില്ല. ഈ വശം പകർച്ചവ്യാധി അല്ലെങ്കിൽ ടോക്സികോളജിക്കൽ പാരിസ്ഥിതിക ഘടകങ്ങളേക്കാളും പോഷകാഹാരക്കുറവുമാണ് (മക്ലീഡ് et al., 15).
  3. വിറ്റാമിൻ ഡി കുറവ് ലഭ്യത: ആഹാരവും ഭൂമിശാസ്ത്രപരമായ വിതരണവുമായി ബന്ധപ്പെട്ട മറ്റൊരു പാരിസ്ഥിതിക ഘടകം വിറ്റാമിൻ ഡിയുടെ ലഭ്യതയാണ്. ഇത് അക്ഷാംശങ്ങളിൽ കുറഞ്ഞ അളവിൽ സൂര്യപ്രകാശം കുറഞ്ഞുവരുന്നതാണ്. MS ഉള്ള രോഗികൾക്ക് വിറ്റാമിൻ ഡി (അസെഖീറോയും മറ്റു പലരും) ഒരു താഴ്ന്ന ഉള്ളടക്കമുണ്ട്, എന്നാൽ ഇത് മറ്റ് വിട്ടുമാറാത്ത കോശജ്വസ്തു രോഗങ്ങൾക്കും (യിൻ, അഗ്രവാൽ, 2014) ശരിയാണ്.
  4. പോസ്റ്റുമണ്ണ് വീക്കം: ഹൈ മൃഗീരിയ കൊഴുപ്പ് / ഉയർന്ന പഞ്ചസാര, വൃത്തിയുള്ള കാർബോഹൈഡ്രേറ്റ് ഭക്ഷണക്രമം എന്നിവ പോസ്റ്റ്പാണ്ഡയൽ വീക്കം (എരിഡ്ജ് et al., ഖാനിം et al., 83, മാർജിയറിസ്, 2007) എന്നിവയുമായി ബന്ധപ്പെട്ടിരിക്കുന്നു.
  5. ഉയർന്ന ബോഡി മാസ് ഇൻഡക്സ്: 20 വയസ്സിനുമുമ്പ് ഉയർന്ന ബോഡി മാസ് ഇൻഡക്സ് (ബി.എം.ഐ), 2 × വർദ്ധിച്ച റിസ്കുമായി ബന്ധപ്പെട്ടിരിക്കുന്നു (Hedström et al., 2012). സൂക്ഷ്മജീവികളുടെ സൂക്ഷ്മനിലയുമായി BMI ബന്ധപ്പെട്ടിരിക്കുന്നു എന്ന് മനസ്സിലാക്കുക.
  6. തെറ്റായ ആഹാര ശീലങ്ങളുമായി ബന്ധപ്പെട്ട മറ്റു കോശജ്വലനങ്ങളുമായി സമാനത പുലർത്തുക: കോശജ് രോഗം (ഐ.ബി.ഡി, Cantorna, 2012): ചില വിറ്റാമിൻ ഡി കുറഞ്ഞത് പരിസ്ഥിതി ഘടകങ്ങളിൽ നിന്നും (ഡാം et al., 2013) സ്വാധീനിക്കുന്നു. കൂടാതെ, glatiramer അസറ്റേറ്റ് (GA, അല്ലെങ്കിൽ കോപ്പലിയർ 1 / കോപ്പക്സൺ) ഇരു രോഗങ്ങൾക്കും പ്രയോജനപ്രദമാണ് (Aharoni, 2013) എംഎസ് രോഗികൾക്ക് ഇടയിൽ ഐ.ബി.ഡി വർദ്ധിച്ചുവരുന്ന സംഭവങ്ങൾ.

ഭക്ഷണം എപ്രകാരമുള്ള രോഗങ്ങളുടെ കോഴ്സിനെ എങ്ങനെ ബാധിക്കുന്നു: ഒരു അടിസ്ഥാന സമീപനം

പോഷകാഹാര നിലവാരത്തെ MS- ന്റെ ഗതിയെ ബാധിക്കുമെന്ന് മുകളിൽ പറഞ്ഞ നിരീക്ഷണങ്ങൾ സൂചിപ്പിക്കുന്നു. എന്നിരുന്നാലും, MS ലക്ഷണങ്ങളെ എങ്ങനെ രോഗനിർണയം ചെയ്യാനോ മെച്ചപ്പെടുത്താനോ കഴിയുമോ എന്ന ചോദ്യം ഉയർന്നുവരുന്നു, തന്മൂലം അവർ തന്മാത്രകളെ തകരാറിലാക്കാനോ അല്ലെങ്കിൽ തന്മാത്രകളെ കുറയ്ക്കാനോ കഴിയുകയില്ല. പ്രത്യേകിച്ച്, ഭക്ഷണ തന്മാത്രകളുടെ ലക്ഷണവും എന്തെങ്കിലുമുണ്ടെങ്കിൽ തന്മാത്ര സംവിധാനങ്ങളും എന്തൊക്കെയാണെന്ന് വ്യക്തമാക്കേണ്ടത് പ്രധാനമാണ്.

അടിസ്ഥാനപരമായി, നമ്മൾ കഴിക്കുന്ന ആഹാരം നമ്മുടെ വികസനത്തിലും, സ്വഭാവത്തിലും, ആരോഗ്യസ്ഥിതിയിലും, ആയുധത്തിലും, രണ്ട് പ്രധാന ലക്ഷ്യം നടപ്പിലാക്കുന്നതിലൂടെയും വിശാലമായ ആഘാതം സൃഷ്ടിക്കുന്നുവെന്ന് നമുക്ക് പറയാം: (എ) ശരീരത്തിൻറെ കോശങ്ങളും (ബി) കാൻസൽ ഗട്ട് മൈക്രോബയോട്ടയും (ചിത്രം 1).

  • ഒരു വശത്ത്, വിവിധ തരത്തിലുള്ള ആഹാര ഘടകങ്ങളും എൻസൈമുകളും ട്രാൻസ്ക്രിപ്ഷൻ ഘടകങ്ങളും മനുഷ്യ കോശങ്ങളുടെ ആണവ റിസപ്റ്ററുകളുമായി സംവദിക്കാൻ കഴിയും. ഇത് ക്യാബബലിസത്തിന്റെയോ അനാബോളിസത്തിന്റെയോ സെല്ലുലാർ മെറ്റബോളിസത്തിന്റെ നിർദ്ദിഷ്ട പരിഷ്ക്കരണത്തിന് ഇടയാക്കുകയും നമ്മുടെ ശരീരത്തിലെ ബാഹ്യാകാശത്തിന്റെയും സ്വയം പ്രതിരോധത്തിന്റെയും പ്രതികരണങ്ങളെ (Desvergne et al., 2006) പരിഷ്കരിക്കുകയും ചെയ്യാം.
  • മറുവശത്ത്, നമ്മുടെ കുടൽ മൈക്രോഫ്ലറ്ററിലെ ഭക്ഷണത്തിന്റെയും ജീവിതശൈലിയുടെയും ആഘാതം കണക്കാക്കേണ്ടതുണ്ട്. ത്രില്ലുകളുടെ (1014) സൂക്ഷ്മകോശങ്ങൾ (നമ്മുടെ ശരീരത്തിലെ കോശങ്ങളിൽ ഏതാണ്ട് എൺപത്തിയഞ്ചാം തവണയും), ഗാട്ട് മൈക്രോബയോട്ട എന്നറിയപ്പെടുന്ന ആയിരക്കണക്കിന് വ്യത്യസ്ത സൂക്ഷ്മജീവികളുമായും ഞങ്ങൾ ജീവിക്കുന്ന മെറ്റോർഗാനിസങ്ങളാണ്. ഈ സങ്കീർണ്ണമായ ജൈവവ്യവസ്ഥ ഞങ്ങളുടെ ശരീരത്തിന്റെ ഒരു സുപ്രധാന ഭാഗമാണ്. ഞങ്ങളുടെ പ്രതിരോധ സംവിധാനത്തെയും നമ്മുടെ ഉപാപചയത്തെയും അത് സ്വാധീനിക്കുന്നു. അതിനാൽ നമ്മുടെ ആരോഗ്യത്തെ അത് ശക്തമായി സ്വാധീനിക്കുന്നു.

ആരോഗ്യം, ഗട് സൂക്ഷ്മജീവികൾക്കും മനുഷ്യർക്കുമായുള്ള അടുത്ത പരസ്പര ബന്ധവും സിംബിയോട്ടിക് ബന്ധവും ഉണ്ട്. സൂക്ഷ്മാണുക്കൾ ധാരാളം ഉപയോഗപ്രദമായ ഉപാപചയ പ്രവർത്തനങ്ങൾ നൽകുന്നു, എന്ററോപൊതുജനുകളെ പ്രതിരോധിക്കുന്നു, സാധാരണ രോഗപ്രതിരോധ പ്രവർത്തനങ്ങൾ ചെയ്യുന്നു. മനുഷ്യന്റെ കുടൽ മൈക്രോബയോട്ടയുടെ സാധാരണ അവസ്ഥയാണ് ഇബുസിയസ് (eubiosis). കുടൽ ബയോഡൈവേഴ്സിറ്റി കുറഞ്ഞുവരുന്നതും pathogenic ബാക്ടീരിയ വർദ്ധനവുമായും ബന്ധപ്പെട്ടിരിക്കുന്ന eubiosis ൽ നിന്നുള്ള വിഘടനം dysbiosis എന്നറിയപ്പെടുന്നു. ഡിസ്ബിയൈറ്റിക് ഗട്ട് മൈക്രോബറ്റാറ്റിന്റെ ഏറ്റവും സാധാരണപരമായ അനന്തരഫലമാണ് mucosal രോഗപ്രതിരോധ സംവിധാനത്തിന്റെ മാറ്റം, വീക്കം, രോഗപ്രതിരോധം, രാസവിനിമയം, അല്ലെങ്കിൽ വ്യതിചലന രോഗങ്ങൾ (Chassaing and Gewirtz, 2014).

വിവിധ തരത്തിലുള്ള ഭക്ഷണരീതികൾ വ്യത്യസ്തമായ അളവിൽ സൂക്ഷ്മജീവികളുടെ ജനസംഖ്യയും, യുബിയോസിസ് അല്ലെങ്കിൽ ഡിസ്ബിയിയോസിസ്, മൈക്രോഫിയൽ പോസിറ്റീവുകൾ എന്നിവ മാറ്റുകയും, ഒന്നോ അല്ലെങ്കിൽ മറ്റ് സൂക്ഷ്മജീവികളുടെ ജനസംഖ്യയുടെ മുൻഗണനയിലൂടെ പ്രവർത്തിക്കുകയോ ചെയ്യുന്നു. നമ്മുടെ ഭക്ഷണക്രമം ഡിസ്ബിയിയോട്ടിക് ഗട്ട് മൈക്രോബൊറ്റയിലേക്ക് മാറുന്നുണ്ടെങ്കിൽ, ഇത് കുടൽ പ്രതിരോധം, കുടൽ പ്രതിരോധശേഷി മാറ്റൽ, തുടർന്ന് സിസ്റ്റമാറ്റിക് വീക്കം, വിട്ടുമാറാത്ത വമിക്കുന്ന രോഗങ്ങൾ എന്നിവയിലേക്ക് നയിച്ചേക്കാം.

എങ്ങനെയാണ് ആഹാര ഘടകങ്ങൾ മനുഷ്യശക്തികളുടെ ഉപാപചയ പ്രവർത്തനത്തെ സ്വാധീനിക്കുകയും വീക്കം കുറയ്ക്കുകയുമൊക്കെ ചെയ്യുക

മനുഷ്യ കോശങ്ങളുടെ മെറ്റബോളിസത്തെ നെറുകയിൽ നേരിട്ട് സ്വാധീനിക്കുന്നതെങ്ങനെയെന്ന് മനസ്സിലാക്കാൻ, കോശത്തിനുള്ളിലെ കൊറോബലിസം അല്ലെങ്കിൽ അനാബോളിസത്തിൽ ഉൾപ്പെടുന്ന എൻസൈമുകളും ട്രാൻസ്ക്രിപ്ഷൻ ഘടകങ്ങളും എന്തൊക്കെയാണെന്നു വിശദീകരിക്കേണ്ടത് ആവശ്യമാണ്.

ചിത്രം 2 ലെ ഇടതുവശത്ത് കാണിച്ചിരിക്കുന്നതുപോലെ, ഓക്സിഡന്റ് മെറ്റബോളിസത്തെ രണ്ട് എൻസൈമുകളേയും ഒരു ആണവ റിസപ്റ്ററേയും നിയന്ത്രിക്കുന്നു. NAD + (Zhang et al., XXIX, Rice et al.) ആക്ടിവേറ്റഡ് ആയ Histone deyslating എൻസൈമുകളുടെ ഒരു ഗ്രൂപ്പായ AMT- സജീവമാക്കപ്പെട്ട പ്രോട്ടീൻ കൈനസ് (AMPK, സ്റ്റീൻബെർഗ്, കെംപ്, 2009), Sirtuins (SIRT) 2011). പെറോക്സിസോം പ്രോലിഫേറ്റർ-ആക്റ്റിവേറ്റഡ് റിസപ്റ്ററുകളുടെ (PPARs, Desvergne, Wahli, 2012, Burns and VandenHeuvel, 1999) എന്നിവയുടെ ഐസോറ്റിപ്പുകൾ ആണവ റിസപ്റ്ററുകളെ പ്രതിനിധാനം ചെയ്യുന്നു.

പിപിഒ ഐസോട്ടപ്പുകൾ മൈറ്റോകോണ്ട്രിയ, പെറോക്സിസ്മോമുകളിൽ ഫാറ്റി ആസിഡുകളുടെ ബീറ്റ ഓക്സൈഡേഷനിൽ ഉൾപ്പെട്ട ജീനുകളുടെ ട്രാൻസ്ക്രിപ്ഷനും, AMPK, Sirtuins പാറ്റേണുകളുമൊക്കെ ഒരു നെറ്റ് വർക് ഉണ്ടാക്കുന്നു. AMPK-Sirtuins-PPAR pathway കലോറി നിയന്ത്രണവും ഫിസിക്കൽ വ്യായാമവും, ചില ജൈവആത്മക തന്മാത്രകൾ (പോളിഫെനോൽസ്, പച്ചക്കറികളും പഴങ്ങളും, ഒമേഗ-എൻഎക്സ്എക്സ് എക്സ്-എൻ.എക്സ്.എക്സ്.എൻ നീളമുള്ള ശൃംഖലകളുപയോഗിക്കുന്ന കൊഴുപ്പ് മത്സ്യത്തിൽ അടങ്ങിയിരിക്കുന്ന ആസിഡുകൾ [PUFA]. റിഗ്രോയ്ഡ് എക്സ്-റിസപ്റ്റർ (RXR) ഉപയോഗിച്ച് ലിജ-ആക്ടിവേറ്റഡ് PPAR ഐസോടൈപ്പുകളാണ് heterodimeric കോംപ്ലക്സുകളായി രൂപംകൊള്ളുന്നത്. ഇത് പിന്നീട് 3-cis-retinoic ആസിഡ് (ആർഎ) ആക്റ്റിവേറ്റ് ചെയ്യുന്നു.

ഇതിനു വിപരീതമായി, ഊർജ്ജ-ധൂമമുളള പോഷകങ്ങളുടെ ഉയർന്ന ആകർഷണം ഊർജ്ജ-ധൂമമുളള പോഷകത്തിന്റെ മറ്റ് ഭക്ഷണങ്ങളായ Figure 2- ൽ വലതുഭാഗത്ത് കാണിച്ചിരിക്കുന്നതുപോലെ, ലൈംഗികേതരവും കോശ വളർച്ചയും ഉൾപ്പെടുന്ന അനാബോളിസത്തിന്റെ വർദ്ധനവ്, സ്റ്റീറോൾ റഗുലേറ്ററി മൂലകത്തിന്റെ പ്രവർത്തനത്തിലൂടെ ബൈബിളിൻ പ്രോട്ടീനുകൾ, SREBP-1c, SREBP-2 (Xu et al., 2013), കാർബോ ഹൈഡ്രേറ്റ് പ്രതികരിക്കുന്ന ഘടകം-ബൈൻഡിംഗ് പ്രോട്ടീൻ, ChREBP (Xu et al., 2013). SREBP-1c, SREBP-2 എന്നിവ ലിക്റ്റർ എക്സ് റിസപ്റ്ററുകൾ (LXR; മിത്രോ et al., Nelsissen et al., 2007) എന്ന ആണവ റിസപ്റ്ററുകളുടെ നിയന്ത്രണത്തിലാണ്. കൊളസ്ട്രോൾ ഡെറിവേറ്റീവ്സ് ഓക്സിസ്റ്ററോളുകളും ഗ്ലൂക്കോസുകളും സജീവമാക്കുന്ന എൽഎക്സ്ആർ ഐസോപ്പിപ്പുകൾ, SREBP-2012c സജീവമാക്കുകയും, ട്രൈസൈസ്ഗ്ഗ്ലിസറോളുകളുടെ സംയുക്ത സംവിധാനത്തിൽ SIPBP-1 ഉം കൊളസ്ട്രോളിന്റെ സിന്തസിസവും തടഞ്ഞുകൊണ്ട് ലിപിഡുകളുടെ സംവേദനത്തിൽ പ്രസക്തമായ പങ്ക് വഹിക്കുന്നു.

ഭക്ഷണവും വീക്കവും തമ്മിലുള്ള ബന്ധത്തെ മനസ്സിലാക്കുന്നതിനുള്ള കേന്ദ്രം വീക്കം, സ്വയം രോഗപ്രതിരോധം എന്നിവയിൽ ഉൾപ്പെടുന്ന രണ്ടു അപഗ്രഥന ഘടകങ്ങളാണ്: ആണവ പരിവർത്തന ഘടകം- kB (NF-kB), ആക്റ്റേറ്റർ പ്രോട്ടീൻ (AP-1; Yan and Greer, 2008). എം.എസിൽ, NF-kB, AP-1 എന്നിവ രണ്ടും സജീവമായി ഇടപെടുകയും ധാരാളം പ്രോയിന്ഫ്ലാമ്മത ജീനുകളുടെയും പ്രോണിഫോമമറ്റോണിക് മോളിക്യൂളുകളുടെ ഉത്പാദനത്തെയും പ്രേരിപ്പിക്കുകയും ചെയ്യുന്നു. എംഎസ്എസിന്റെ പ്രവർത്തനക്ഷമത കാരണം അജ്ഞാതമാണ്, പക്ഷെ, NF-kB നായുള്ള ചിത്രം 2 ൽ കാണിച്ചിരിക്കുന്നതുപോലെ ഇത് വൈറസ്, സൈക്കോകൈൻസ്, ഓക്സീറ്റീവ് സ്ട്രെസ് എന്നിവ മാത്രമല്ല, പൂരിത അമിതോഡുകൾ പോലെയുള്ള ചില ഭക്ഷണ ഘടകങ്ങളും മാത്രമല്ല അപകടം അതിനാൽ ഫാറ്റി ആസിഡുകൾ, അതിനാൽ പ്രോണിഫാംമററി ആയി കണക്കാക്കാം.

റെറ്റിനോയിഡ് എക്സ്-റിസപ്റ്റർ ഐസോട്ടപ്പുകളുടെ ആർ-ആക്റ്റേറ്റുചെയ്ത ഫോമുകളുടെ ബ്രേക്ക്ലിംഗ് ബൈൻഡിംഗ് വഴി ഫലനമില്ലാതെ എൻഎഫ്-കെ.ബി കുറയുന്നു. (RXRs; Pérez et al., XX; Zhao et al., XX; Fragoso et al., XXX ).

ചിത്രം 2 ൽ കൂടുതൽ വ്യക്തമായി ചിത്രം പോലെ കാണിച്ചിരിക്കുന്നതുപോലെ, RA-RXR- കളിലെ സജീവ രൂപങ്ങൾ പ്രത്യേക ലീഗഡ്-ആക്ടിവേറ്റഡ് ആണവ റിസപ്റ്ററുകളായ PPARs, LXRs, വിറ്റാമിൻ ഡി റിസപ്റ്റർ (വി.ആർ.ആർ) എന്നിവയുമായി ബന്ധപ്പെടുത്തിയാണ് ഹെഡറോഡിമർ ഉണ്ടാക്കുന്നത്.

മൂന്ന് ആണവ റിസപ്റ്ററുകൾ-PPAR, LXR, VDR- എന്നിവ പ്രത്യേക ലിഗാൻഡുകളിലൂടെ സജീവമാക്കണം. Figure 2 ൽ സൂചിപ്പിച്ചിട്ടുള്ളത് പോലെ ലിഗെണ്ടുകൾക്ക് പ്രത്യേക ഭക്ഷണക്രമവും, പോഷകാഹാര നിലവാരത്തിൽ മാറ്റം വരുത്താനും, ഊർജ്ജ ഹോമിയോസ്റ്റാസിസിനെ നിയന്ത്രിക്കാനും എങ്ങനെ കഴിയുന്നുവെന്നത് വ്യക്തമാക്കാം. എന്നാൽ, വിട്ടുമാറാത്ത കോശജ്വസ്തു രോഗങ്ങൾ (Heneka et al) ഷ്ഗ്ഗ്-ഗാന്ധി, ഡ്രൂ, ക്ലെൻസ്, ഫിൽഡ്മാൻ, ക്യൂനി, അൽ-ഷെൽഗെജ്, റോബിൻസ്, ഗ്രെനേ, ഏ.

അങ്ങനെ, മൂന്ന് ആണവ റിസപ്റ്ററുകളിൽ ഓരോ PPAR, LXR, VDR- എന്നിവയും RA-RXR നു ബന്ധിപ്പിക്കുന്നതിനും NF-kB തടസ്സപ്പെടുത്തുന്നതിനും കോശജ്വലന ജീനുകളുടെ പ്രകടനത്തിൽ കർശനമായ നിയന്ത്രണം ചെലുത്താനും കഴിയുന്ന ഹെറ്റോറോ കോംപ്ലക്സുകൾ രൂപകൽപ്പന ചെയ്യുന്നു, അങ്ങനെ ഉപാപചയ സംയോജിപ്പിക്കൽ വീക്കം സിഗ്നലിംഗ്. RA-RXR ന് ബന്ധിപ്പിക്കുന്നതിന് PPAR, LXR, VDR-D എന്നിവ തമ്മിലുള്ള മത്സരം ഉണ്ട് എന്ന് വ്യക്തമാണ്. എന്നാൽ ഈ മത്സരം മെറ്റബോളിസത്തിൽ മാത്രം സ്വാധീനം ചെലുത്തണം. NF-kB പ്രമേഹത്തിൽ മൂന്നിരട്ടിയോളം ദൈർഘ്യമുള്ളവയാണ്.

പുനരുല്പാദന ഘട്ടത്തിൽ പ്രോനിഫാംമിറ്ററായ തന്മാത്രകളുടെ ഉൽപ്പാദനം ഒരു ജൈവകൃഷി പ്രക്രിയയാണ്: ഹൈപ്പർ കലോറിക് ഡയറ്റുകളും കുറഞ്ഞ കാലോറി ഭക്ഷണങ്ങളും പ്രതിരോധിക്കപ്പെടുന്നു. തത്ത്വത്തിൽ, അനാബോളിസം തകരാറിലായ പ്രക്രിയകളെ പ്രോത്സാഹിപ്പിക്കും, അതേസമയം കാറ്റബോളീമിന് എന്തെല്ലാം വ്യത്യാസമുണ്ടാകും എന്നതിനെ കുറിച്ചാണ് (ചിത്രം 4).

ഗുഡ് മൈക്രോബയോട്ടത്തിന്റെയും ആൾട്ടർ ഹോസ്റ്റു-മൈക്രോബോളാ ബന്ധുവിന്റെയും ഘടനയും ജൈവവൈവിധ്യവും സ്വാധീനിക്കുന്നതെങ്ങനെ

ലൈഫ് ടൈപ്പ്, ഡൈറ്റിറി ഹാബിറ്റ്സ്, ഗുട്ട് മൈക്രോബയോട്ട കോമ്പോസിഷൻ എന്നിവയ്ക്കുള്ള ലിങ്ക്

കുടൽ മൈക്രോഫ്ലോറയുടെ ഘടന വളരെയധികം വ്യക്തികളാണ്. ഭക്ഷണ, ശാരീരിക പ്രവർത്തനങ്ങൾ, സമ്മർദ്ദം, മരുന്നുകൾ, പ്രായം തുടങ്ങിയവയെ സ്വാധീനിക്കുന്നു. നമുക്കെല്ലാവർക്കും ചുരുങ്ങിയത് 30 മുതൽ എട്ടു വരെ തരത്തിലുള്ള ബാക്ടീരിയകളാണ്.

ഭക്ഷ്യധാരയും ജീവിതരീതിയും ഗുട്ട് മൈക്രോഫ്ലറിലുള്ളതിനെ കുറിച്ചു ചർച്ച ചെയ്യുന്നതിനുള്ള ലളിതമായ മാർഗ്ഗം, ബാക്ടീരിയലൈറ്റുകളുടെയും ഫാമിലിഹുറ്റ്സ്-അക്കൗണ്ടിംഗിന്റെയും രണ്ട് ആധിപത്യ ബാക്ടീരിയ ഡിവിഷനുകളിലേക്ക് മാത്രമായി പരിമിതപ്പെടുത്താനാണ്, ദീർഘകാല ഭക്ഷണ ശീലങ്ങൾ (കാനി ആൻഡ് ഡെൽസെൻ, വു et al., XX; ലോസോപറോൺ et al., Tremololi and Bäckhed, XX, Panda & al., XXX) ബാക്റ്റീറോയ്റ്റസ് / ഫേമിക്കുകൾ (B / F) .

ഡി ഫിലിപ്പോ, അൽ. (2010) ഫ്ലോറൻസിലെ കുട്ടികളും ആഫ്രിക്കയിലെ ബുർക്കിന ഫാസോയും കാണിക്കുന്നത് ദീർഘകാല ആഹാര ശീലം മനുഷ്യ ഗുരുത്വാകർഷണത്തെ ബാധിക്കുന്ന കാര്യമാണ്.

ഈ പഠനത്തിൽ ബുർക്കിന ഫാസോ ഭക്ഷണരീതിയിൽ മില്ലറ്റ്, സോർഗം (10 ഗ്രേ ഫിബറുകൾ / ദിവസം, 662-83 കിലോ കൾസസ് / ദിവസം) എന്ന പ്ളസ്ടു പോളിസാക്രാറൈഡിന്റെ അളവ് അടിസ്ഥാനമാക്കിയുള്ളതാണ്. എന്നാൽ ഇറ്റാലിയൻ കുട്ടികളുടെ ഭക്ഷണപദാർഥങ്ങൾ പാശ്ചാത്യ രീതിയിൽ പ്രോട്ടീനുകൾ, മൃഗങ്ങളുടെ കൊഴുപ്പ്, പഞ്ചസാര, മധുരമുള്ള പാനീയങ്ങൾ, ശുദ്ധീകരിച്ച കാർബോഹൈഡ്രേറ്റുകൾ (992 ഗ്രാം ഫിബറുകൾ / ദിവസം, 5.6-1,068 കലോന്നൽ / ദിവസം). ആഫ്രിക്കയിൽ നിന്നുള്ള കുട്ടികളിൽ നിന്നും ബീജസങ്കലനത്തിന്റെ സാമ്പിളുകൾ Bacteroidetes (1,512%) - പ്രധാനമായും പ്രിവെറ്റേല ആൻഡ് എക്സ്ലൈനാബിക്റ്റർ - കുറഞ്ഞ അളവിലുള്ള ദൃക്സാക്ഷി (73%) കാണിക്കുന്നു. മറിച്ച്, ബാക്ടീറോയ്റ്റെറ്റുകളെ (12%) Firmicutes (51%) ബാധിച്ചപ്പോൾ ഇറ്റലിയിലെ കുട്ടികൾ കണ്ടു. പക്ഷേ, Bacteroidetes Prevotella, Xylanibacter എന്നിവയിൽ നിന്ന് ബാക്ട്രോയ്ഡൈഡുകളിലേക്ക് മാറി. ബാക്റ്റീറോയ്റ്റീറ്റുകളിൽ ഈ രണ്ടാമത്തെ ഭാഗം സാധാരണയായി തിരഞ്ഞെടുക്കുന്നതിനാൽ സങ്കീർണ്ണമായ ഗ്ലൈക്കനുകൾക്ക് പുറമേ ലളിതമായ ഭൗമോപരിതലങ്ങളും ഉപയോഗിക്കാം, ലളിതമായ ഭൗമോപരിതലത്തിലെ പാശ്ചാത്യ ആഹാരങ്ങളുടെ സാധാരണ ഘടകങ്ങളാണ്.

ചുരുക്കത്തിൽ, B / F അനുപാതം സങ്കീർണ്ണ കാർബോഹൈഡ്രേറ്റ്സ് (ഞങ്ങളുടെ എൻസൈമുകൾക്ക് തടസ്സമാകുന്നില്ല) സമ്പന്നമായ ഭക്ഷണവുമായി സഹകരിക്കുന്നു. കാരണം പ്രിവൊറ്റേല, ജീലാനി ബാക്ടർ തുടങ്ങിയ കോശക്റ്റീവ് ഗ്ലൈക്കനുകൾ ഇഷ്ടപ്പെടുന്നതിന് സമാനമാണ്. ബാക്ടീരിയ ഉപഭോഗ സങ്കീർണ്ണമായ ഗ്ലൈക്കൻസ് ബ്യൈറേറ്റ് ഉണ്ടാക്കുന്നു, ഇത് പ്രോനിഫാംമറ്റീമിൻ NF-kB സജീവമാക്കൽ (ചിത്രം 3).

അതേസമയം, പാശ്ചാത്യ, ഊർജ്ജ-ധൈര്യമുള്ള ആഹാരങ്ങൾ ചർമ്മത്തിന്റെ സൂക്ഷ്മതലത്തിൽ മാറ്റം വരുത്തുകയും, ഊർജ്ജം ശേഖരിക്കുകയും ഉൽപ്പാദിപ്പിക്കാൻ കൂടുതൽ അനുയോജ്യമാവുകയും, മിക്കപ്പോഴും രോഗകാരിയും (മോഷെൻ et al., 2012) എന്ന നിലയിൽ ഫേമിക്റ്റുകളുടെ ജനസംഖ്യ (Mollicutes ഉൾപ്പെടെ) വർദ്ധിപ്പിക്കുകയും ചെയ്യുന്നു.

ദി ഡിസ്ബിയൈറ്റിക് ഗട്ട് മൈക്രോബയോട്ട, ക്രോണിക് വീക്കം എന്നിവയ്ക്കിടയിലുള്ള കണ്ണി

ഡിസ്ബിയൈറ്റിക് ഗട്ട് മൈക്രോബയോട്ടയിൽ, ബി / എഫ് അനുപാതം വളരെ കുറവാണ്, കൂടാതെ ബാക്ടീറോയ്റ്റെറ്റിലുണ്ടാകുന്ന ഘടനാപരമായ ഘടനയും (ചിത്രം 5). മൈക്രോബയോളജിക്കൽ ബാലൻസ്, ഡിസിയോസിസസിൽ ഉണ്ടാകുന്ന ജൈവവൈവിധ്യത്തിന്റെ കുറവ്, മൈക്രോബയോട്ടയ്ക്കും അതിന്റെ ഹോസ്റ്റിനും ഇടയിൽ സങ്കീർണ്ണമായ ആശയങ്ങൾ തടസ്സപ്പെടുത്തുകയും കുറഞ്ഞ ഗ്രേഡ് എൻഡോടോസീമിയ, വിട്ടുമാറാത്ത കുടൽ, സിസ്റ്റൈറ്റിക് വീക്കം എന്നിവയ്ക്ക് കാരണമാകുകയും ചെയ്യും. സിസ്റ്റമാറ്റിക് വീക്കം സംഭവിക്കുമ്പോൾ, വിട്ടുമാറാത്ത ബാഹ്യാവിഷ്ക്കാരവും രോഗപ്രതിരോധ ശീലം കൂടിയ അസുഖങ്ങളും ഉണ്ടാകുന്നത് (Tilg et al., ബ്രൗൺ et al., മെയ്നാർഡ് et al., 2009).

ഡിസ്ബിയൈറ്റിക് മൈക്രോബയോട്ടയുടെ സാന്നിധ്യത്തിൽ ഗ്യൂട്ട് എൻഡോടോമൈൻ / ലിപ്പോപോളിസക്കറൈഡ് (എൽപിഎസ്) വർദ്ധിക്കുന്നു, റെഗുലേറ്ററി ടി സെല്ലുകൾ (ട്രേഗ്) വികലവും, ആറെൽ ഹൈഡ്രോകാർബൺ റിസപ്റ്ററുകളും പ്രോക്സിഫോളേറ്ററായ നൂറുകണക്കിന് സെല്ലുകളും സജീവമാവുന്നു (Cani et al., Veldhoen et al. al., 17).

LPS, mucosal barrier ന്റെ പ്രവർത്തനം ശരിയായി നയിക്കുന്നു, കൂടാതെ പ്ലാസ്മ നിലയിലുള്ള 200 pg / ml serum ന് മുകളിൽ മറ്റ് കോശങ്ങളുടെയും ബാധിക്കുന്നു. ഡിസ്ബിയിയോട്ടിക് ഗട്ട് മൈക്രോബയോട്ടയുടെ വർദ്ധിച്ച ഗട്ട് പെർഫ്യൂബിലിറ്റി ഗ്ലൂറ്റൻ, ഗ്ല്യാഡിൻ എന്നിവയ്ക്കെതിരെയുള്ള ഇഗേറ്റ് ആൻഡ് ഐ ജി ജി ആന്റിബോഡികൾ പാസ്സായതിനാൽ, MS രോഗികളിൽ (റിച്ചൽറ്റ്, ജെൻസൻ, 2004) കാണപ്പെടുന്നു.

ദി ബിസ് ദി ഡൈസിയൈറ്റിക് ഗട്ട് മൈക്രോബയോട്ട, എം.എസ്

പാശ്ചാത്യ ഭക്ഷണങ്ങളും ജീവിതരീതിയും കാരണം, മൈക്രോബയോട്ട, കുടൽ എന്നിവ തമ്മിലുള്ള ശരിയായ ആശയവിനിമയത്തിന്റെ പരാജയവും, കുറഞ്ഞ ഗ്രേഡ് എൻഡോടോക്സിമിയയും സിസ്റ്റമാറ്റിക് ഓട്ടോമോമ്യൂൺ വീക്കം ഉളവാക്കുന്നതുമായ, മൈക്രോബയോട്ടയുടെ ഭേദഗതിയുമായി ബന്ധപ്പെട്ട മോഡൽ, MS (ഫെർണാണ്ടസ് et al., റിങ്സിയോ, 2012) എന്ന രോഗാവസ്ഥയിലും. വാസ്തവത്തിൽ, മറ്റ് ദീർഘകാലാടിസ്ഥാനത്തിലുള്ള അസുഖങ്ങളുള്ള പൊതു സംവിധാനങ്ങളുമായി MS പങ്കുചേരുന്നു, എല്ലാത്തരം തെറ്റായ ജീവിതരീതിക്കും ഭക്ഷണ ശീലത്തിനുമുള്ള കുറഞ്ഞ ഗ്രേഡ് എൻഡോടോക്സിമിയയുടെ നിലനിൽപ്പിനെ അടിസ്ഥാനമാക്കി ഒരു ലാറ്റെ ഡൈസിയൈസിസ് ഉണ്ടായിരിക്കും. കൂടാതെ, ഒരു കുതിച്ചുകൃഷി-തലച്ചോറ് അച്ചുതണ്ടിന്റെ സാന്നിധ്യം, ഇപ്പോൾ ഉയർന്നുവരുന്ന ഒരു സങ്കൽപം മാത്രമാണ്, ഗ്യൂട്ട് സൂക്ഷ്മജീവിയുടെ ഇടപെടൽ സങ്കീർണ്ണമായ സി.എൻ.എസ് ഡിസോർഡേഴ്സ് (ക്രൈൻ ആൻഡ് ദിനാൻ, 2011) ഭാവിയിൽ ഫലപ്രദമായി ഫലപ്രദമായ ഒരു തന്ത്രമായിരിക്കുമെന്നാണ്.

ഗേറ്റ് മൈക്രോബയോട്ടയും എംഎസ്സും തമ്മിലുള്ള നേരിട്ടുള്ള ബന്ധം പരീക്ഷണാടിസ്ഥാനത്തിൽ ബെറെർ et al. (2011). Transgenic എലികൾ ഉപയോഗിക്കുന്നത്, ബെറെർ et al. ഓട്ടോമാറ്റിഗൻ മൈലിൻ ഒലിഗോഡെൻഡ്രോസൈറ്റ് ഗ്ലൈക്കോപ്രോടിന്റെ ലഭ്യത മൂലം മലിനീകരണ ബാക്റ്റീരിയയ്ക്ക് മെയ്ലിൻ-നിർദ്ദിഷ്ട CD4 + T സെല്ലുകളും ഡീമിലിനേഷനും ചേർന്ന് പുനരാവിഷ്കരിക്കൽ-സ്വയമേവയുള്ള സ്വയം-ഓട്ടോമ്യൂൺ രോഗം ഉയർത്താൻ കഴിയും. മറ്റൊരു പഠനത്തിൽ, പരീക്ഷണ അലർജി എൻസെഫലോമയോളൈറ്റിസ് (EAE, Yokote et al., 2008) അടിച്ചമർത്തലിലേക്ക് സൂക്ഷ്മജീവികൾ മാറാൻ നിർദ്ദേശിച്ച ആന്റിബയോട്ടിക്കുകളുടെ ചികിത്സ കാണിക്കുന്നു.

ഈ സിദ്ധാന്തത്തിന്റെ ആദ്യഘട്ടത്തിൽ ഗുരുത്വാകർഷണ ഉൽപ്പാദനവും നിർണ്ണായക പങ്കുവഹിച്ചേക്കും. കൂടാതെ മറ്റ് സി.എൻ.എസ്. ഓട്ടോമാറ്റിക് അസുഖങ്ങൾ, ഓട്ടിസം, വിഷാദം, ഉത്കണ്ഠ, സമ്മർദ്ദം തുടങ്ങിയ ന്യൂറോ സൈക്കോളജിക് ഡിസേർസറുകൾക്കും ആതിഥേയത്വ സാധ്യതയും ഉണ്ടാകാം. ഗുരുത്വാകർഷണ ബഹളികകളുടെ ഒരു പുതിയ ആശയം ഉയർന്നുവരികയാണ് (വാങ്, കാസ്പർ, 2014).

ഈ അടിസ്ഥാനത്തിൽ, ആരോഗ്യത്തിലും രോഗത്തിലുമുള്ള നട്ടിന്റെ സൂക്ഷ്മജീവികളുടെ പങ്ക് മനസ്സിലാക്കുന്നത് രോഗനിർണയത്തിനുപയോഗിക്കുന്ന അടിവയറ്റത്തിന് അടിത്തറയാകും. അത് ഭക്ഷണ ശീലങ്ങൾ ഉൾപ്പെടെ ശരിയായ ജീവിതശൈലി തിരഞ്ഞെടുക്കുന്നതിലൂടെ ഗ്യാസ് സൂക്ഷ്മതലത്തിൽ മാറ്റം വരുത്താം. കൂടാതെ, ഗ്യൂട്ട് സൂക്ഷ്മജീവിയുടെ നേരിട്ടുള്ള കൃത്രിമത്വം അഡാപ്റ്റീവ് പ്രതിരോധ പ്രതികരണശേഷി വർദ്ധിപ്പിക്കുകയും വിഘടിച്ചുണ്ടാകുന്ന സ്രവങ്ങൾ കുറയ്ക്കുകയും ചെയ്യും. ഉദാഹരണത്തിന്, MSc immunopathology (Sie et al., 17) ൽ, കുടൽ സെൽ വ്യത്യാസങ്ങൾ പ്രോത്സാഹിപ്പിക്കുന്നതും PXOXX സെല്ലുകൾ കുറയ്ക്കുന്നതുമൂലം MS രോഗികളിൽ സ്വയം രോഗപ്രതിരോധം (ഐസസ്സാഡെ-നാവികാസ് et al. , 2014).

ഈ അടിസ്ഥാനത്തിൽ, MS മോഡലുകളിൽ നിരീക്ഷിക്കുന്ന ട്രേഗ് / ധനം ബൾബുകളുടെ അഭാവവും എം എസ് രോഗികളിൽ ഉണ്ടെന്ന് കണ്ടുപിടിക്കുന്നു, പ്രധാനപ്പെട്ട ക്ലിനിക്കൽ പ്രത്യാഘാതങ്ങൾ ഉണ്ടാകും, കാരണം മൈക്രോബയോട്ട ഘടനയിലെ മാറ്റങ്ങൾ കൊണ്ട് ഈ മായാചാരം ക്രമീകരിക്കാൻ കഴിയും, അത് തിരിച്ച് മോഡുലേറ്റ് ഭക്ഷണക്രമത്തിൽ മാറ്റം വരുത്തി (ഡേവിഡ് et al., 17).

പ്രോട്ടീന്രാമറി ഡയറ്റിറി ഫാക്ടർ

MS- ൽ വീക്കം തടയുന്നതിനും, മറ്റ് വിട്ടുമാറാത്ത ബാഹ്യാവിഷ്ക്കാരങ്ങളായ രോഗങ്ങളിൽ നിന്നും വരുന്നവ ഒഴിവാക്കാൻ ഭക്ഷണത്തിന്റെ ഘടകങ്ങൾ നിയന്ത്രിക്കേണ്ടതുണ്ട്.

  • മൃഗങ്ങളുടെ ഉൽപാദിപ്പിക്കുന്ന ഫാറ്റി ആസിഡുകൾ;
  • ട്രാൻ കോൺഫിഗറേഷനിൽ ഉറക്കക്കുറവ് വരുത്തുന്ന ഫാറ്റി ആസിഡുകളും (ഹൈഡ്രജൻ ഫാറ്റി ആസിഡുകളും);
  • ചുവന്ന മാംസം;
  • മധുരമുള്ള പാനീയങ്ങൾ, മൃഗങ്ങളുടെ കൊഴുപ്പ് കൂടാതെ ശുദ്ധീകരിച്ച (കുറഞ്ഞ ഫൈബർ) കാർബോഹൈഡ്രേറ്റ്,
  • ഉൽപാദന വർദ്ധനവ്;
  • പാൽ കൊഴുപ്പ് ഗ്ലോബലി മെംബ്രൺ (MFGM പ്രോട്ടീനുകൾ) ന്റെ പശുവിന്റെ പ്രോട്ടീൻ.

മൃഗങ്ങളുടെ ഉറവിടം

പാൽ, വെണ്ണ, വെണ്ണ, മാംസം, ജൊക്കോസ് തുടങ്ങിയ ജന്തുജന്യമായ ഉത്പന്നങ്ങളുടെ ഉൽപാദനശേഷി ഫാറ്റി ആസിഡുകളാണ് പ്രധാനമായും എംഎസ് ഗതാഗതത്തെ സ്വാധീനിക്കുന്നതിനായുള്ള ഭക്ഷണത്തിന്റെ ഘടകങ്ങൾ കൂടുതലായി കണക്കാക്കുന്നത്.

സന്തുലിതമായ ജന്തുക്കളുടെ കൊഴുപ്പ് നേരിട്ട് എം എസ്സിന്റെ ആവൃത്തിയുമായി ബന്ധപ്പെടുത്തിയിട്ടുണ്ടെന്ന് സ്വാൻക് കൂട്ടിച്ചേർത്തു. എന്നാൽ, മൃഗങ്ങളുടെ കൊഴുപ്പ് നിയന്ത്രിക്കാനും എം.എസ്. ശീതീകരണത്തിന് തടസ്സമുണ്ടാകാനുമുള്ള ബന്ധം മാത്രമാണ് ഈ രോഗം ബാധിച്ചത്. (Swank and Goodwin, 1950). സ്വാൻ, ഗുഡ്വിൻ എന്നിവ പ്രകാരം, ഉയർന്ന കൊഴുപ്പ് ഭക്ഷണരീതികൾ സംഭരണ ​​ലിപിഡുകളും കൊളസ്ട്രോളിന്റെയും സമന്വയിക്കുന്നതിനും membrane fluidity കുറയുന്നതിനും capillaries സാധ്യമായ തടസ്സം ഉണ്ടാക്കുന്നതിനും, അല്ലെങ്കിൽ വീക്കം വർദ്ധിക്കുന്നതിനോ അല്ലെങ്കിൽ വീക്കം വർദ്ധിപ്പിക്കുന്നതിനോ കാരണമാകുന്നു.

കൂടുതൽ അടുത്തിടെ നടത്തിയ പഠനങ്ങൾ സൂചിപ്പിക്കുന്നത് കൊഴുപ്പ് കൊഴുപ്പ് നടക്കുന്നത് ട്രാൻസ്ക്രൈഷണറി തലത്തിൽ നിയന്ത്രിക്കപ്പെടുകയും, ജനിതക എക്സ്പ്രഷൻ, സെൽ മെറ്റാബോളിസം, വികസനം, കോശങ്ങളുടെ ഭിന്നകത എന്നിവയെ സ്വാധീനിക്കുകയും ചെയ്യുന്നു. കൂടുതലും, മൃഗങ്ങളുടെ കൊഴുപ്പിനെക്കുറിച്ചുള്ള ധാരണ മിക്കപ്പോഴും ഉയർന്ന കലോറി ഉപഭോഗവുമായി ബന്ധപ്പെട്ടിരിക്കുന്നു. ഇത് ധാരാളം വിട്ടുമാറാത്ത കോശജ്വസ്തു രോഗങ്ങൾക്കുള്ള ഒരു ഹാനികരമായ ഘടകമാണ്. അവസാനമായി, ഈ ലേഖനത്തിൽ പ്രതിപാദിച്ചിരിക്കുന്നതുപോലെ, ഒരു പൂരിത നിറയെ അധികമുള്ള കൊഴുപ്പ് ഒരു ഡിസ്ബിയിയോട്ടിക് കുടൽ സൂക്ഷ്മചികിത്സയിലേക്ക് നയിക്കുന്നു, കുടൽ പ്രതിരോധശേഷി ശമിപ്പിക്കൽ, കുറഞ്ഞ ഗ്രേഡ് സിസ്റ്റണിക് വീക്കം എന്നിവയും ചില മനുഷ്യ വൈകല്യങ്ങളുണ്ടാകാൻ ഇടയാക്കുന്നു.

ട്രാൻസ് ഫാറ്റി ആസിഡുകൾ

ട്രാൻസ്ഫോർഡ് ഫാറ്റി ആസിഡുകൾ (TFAs) അപര്യാപ്തമായ ഫാറ്റി ആസിഡുകളാണ്, ഇവ ട്രാൻസ് കോൺഫിഗറേഷനിൽ കുറഞ്ഞത് ഒരു കോണുകളില്ലാത്ത ഡബിൾ ബോണ്ടാണ് (ഭരദ്വാജ് et al., 2011).

സസ്യ എണ്ണകളുടെ ഭാഗിക ഹൈഡ്രജനനത്തിന്റെ ഉൽപ്പന്നങ്ങളായി, മൃഗങ്ങളെ കൊഴുപ്പ് മാറ്റാൻ 1960- ത്തിൽ അവതരിപ്പിക്കപ്പെട്ടു, പക്ഷേ പിന്നീട് വളരെ കുറച്ചു മാത്രമേ അത് ഉപാപചയത്തിൽ അതേ ക്ഷോഭം ഉള്ളതായി കണ്ടെത്തിയിരുന്നുള്ളൂ. പൂരിത ആസിഡുകളെപ്പോലെ കൊളസ്ട്രോൾ അടിവയറ്റിലെ കൊഴുപ്പ്, ശരീരഭാരം വർദ്ധിപ്പിക്കുന്നതിന് പ്രോത്സാഹിപ്പിക്കുക. ടിഎഫ്എഫുകൾ കഴിക്കുന്നത് ഗ്യാസ് വീക്കം കാരണമാവുകയും തന്മാത്രയിലെ ഇൻസ്ട്രുമെന്റ് സിടൂക്കോണുകളുടെ മുകൾവശം കൂടാൻ സഹായിക്കുകയും ചെയ്തു (ഒകഡയും മറ്റു ചിലരും). കൂടാതെ, ടിഎഫ്എകൾ സിസ് കോണ്ഫിഗറേഷനുളള സ്വാഭാവിക അസുഖകരമായ ഫാറ്റി ആസിഡുകളുടെ രാസവിനിമയത്തിൽ ഇടപെടുന്നു.

മാംസാഹാരവും മറ്റ് ചികിത്സയും (ഹൈഡ്രജനെഴുത്ത്) പച്ചക്കറി കൊഴുപ്പ്, മാംസം, റുമിനാൻറുകൾ, സ്നാക്സുകളിൽ നിന്നുള്ള ആഹാര ഉൽപ്പന്നങ്ങൾ എന്നിവയിൽ ടി.എഫ്.എ. ഫ്രഞ്ച് ഫ്രൈസുകളിലും മറ്റു വറുത്ത ഭക്ഷണത്തിലും അവർ ഉൾപ്പെട്ടിരിക്കാം, കാരണം അവ ഉരുളക്കിഴങ്ങിൽ രൂപം കൊള്ളുന്നു.

ചുവന്ന മാംസം

വെളുത്ത മാംസത്തേക്കാൾ ചുവന്ന മാംസത്തിൽ കൂടുതൽ ഇരുമ്പ് ഹെമി അടങ്ങിയിട്ടുണ്ട്. ഇരുമ്പ് എളുപ്പത്തിൽ nitrosylated അതു എൻഡോജനസ് nitroso- സംയുക്തങ്ങൾ രൂപീകരിക്കാൻ സുഗമമാക്കുന്നു (NOCs, Joosen et al., 2010). ചുവന്ന മാംസം കഴിക്കുന്നത് യഥാർഥത്തിൽ ഡോസിന്റെ പ്രതികരണവുമായുള്ള ബന്ധം കാണിക്കുന്നു. വെളുത്ത ഭക്ഷണത്തിന് അത്തരം ബന്ധങ്ങളില്ല. എൻ.ഒ.സി കൾ മ്യൂറ്റജെനിക് ആകുന്നു: നൈട്രൈലൈസേഷൻ ഡി.എൻ.എ നാശനഷ്ടങ്ങൾ ഉണ്ടാക്കുന്നു. പ്രോസസ് ചെയ്ത (നൈട്രൈറ്റ് സൂക്ഷിച്ചുവച്ചിരിക്കുന്ന) ചുവന്ന മാംസം റിസ്ക് വർദ്ധിപ്പിക്കുന്നു. ഉയർന്ന താപനിലയിൽ മാംസം പാചകം ചെയ്യുമ്പോൾ ഹെറ്റിയോസൈക്ലിക് ആമിനുകൾ രൂപം കൊള്ളുന്നു, എന്നാൽ ഇത് ചുവന്ന മാംസം (ജൊസെൻ et al., XXX) എന്നതിന് പ്രത്യേകം ശ്രദ്ധിക്കുന്നില്ല.

എം.എസ്. (വില്ല്യംസ് et al., 2012) എന്ന ചുവന്ന മാംസം ഉപഭോഗത്തിന്റെ സൈറ്റുകളിൽ അസാധാരണമായ ഇരുമ്പ് നിക്ഷേപം കണ്ടെത്തിയിട്ടുണ്ട്. ഇത് ഉയർന്ന-γ-GT, hs-CRP (മൊട്ടോട്ടൺ et al., 2013) എന്നിവയുമായി ബന്ധപ്പെട്ടതാണ്.

ശ്രദ്ധേയത, CMA ജീൻ ഒരു നിഷ്ക്രിയത്വത്തിന്റെ പരിവർത്തന മനുഷ്യർ അതിന്റെ പദപ്രയോഗം നീക്കം ചെയ്തു കാരണം, ഒരു പ്രധാന sialic ആസിഡ്, N- ഗ്ലൈക്കോളിനറിമണമിക് അമ്ലം (Neu5Gc) ഇല്ല. ന്യൂട്രിനോഗ്രാഫിക് ഇൻഷ്വറൻസ് സയറികളിൽ നിന്നുള്ള ന്യൂക്ലിയർ പോളിസി ഇൻഷ്വറൻസ്, പ്രത്യേകിച്ച് ചുവന്ന മാംസം, പാലുത്പന്നങ്ങൾ മുതലായവ, പ്രശ്നങ്ങൾ സൃഷ്ടിക്കും. കാരണം മനുഷ്യർ ആന്റി-ന്യൂക്യുഎൻഎംഎക്സ് ജിസിസി ആൻറിബോഡുകളെ പ്രചോദിപ്പിക്കും. ഇത് ദീർഘകാല വീക്കം (പദ്ലർ-കാരാവാനി et al., 5) വഴി സാദ്ധ്യമാണ്.

അവസാനമായി, മാംസം അരാച്ചിഡോണിക് ആസിഡ് (ഒമേഗ-എൻ.എൻ.എൻ.എക്സ്. (എൻ- 6) PUFA- യിൽ അടങ്ങിയിരിക്കുന്നു. പ്രോനിഫാംമിരിക് ഇക്കോസാനോയ്ഡുകൾ [പ്രോസ്റ്റാഗ്ലാൻഡിൻസ്, തോമബോക്സനുകൾ, ല്യൂക്കോട്രിനീനുകൾ] എന്നിവയുടെ മുൻകൂർ ആണ് ഇത്. കൂടാതെ, TH6 പാതയുടെ (Stenson, 17) പ്രവർത്തനവും സജീവമാക്കുന്നു.

ഉയർന്ന അളവിൽ ഷേഗർ, ഫൈബർ കുറഞ്ഞ അളവിൽ കഴിക്കുക

പഞ്ചസാര മധുരമുള്ള പാനീയങ്ങളും, കുറഞ്ഞ ഫൈബർ ഉള്ളടക്കവുമുള്ള ധാന്യങ്ങളിൽ ഉയർന്ന അളവിൽ കലോറി, ഗ്ലൂക്കോസ് അളവ് എന്നിവ ക്രമേണ വർദ്ധിക്കുന്നു. ഇൻസുലിൻ ഉത്പാദനം തുടർന്നങ്ങോട്ട് ബയോസിന്തറ്റിക് പാഥേകൾക്കും ആറാഡിയോഡോണിക് ആസിഡത്തിനും ഉത്തേജക മരുന്ന് ഉത്പാദനത്തിനും ഉൽപാദനത്തിനും ഇടയാക്കുന്നു.

വർദ്ധിച്ച ഡയറ്റെറ്ററി സോൾ ഇൻ ദെയർ

ഓട്ടോമാറ്റിക് അസുഖങ്ങൾ വികസിപ്പിക്കുന്നതിനുള്ള ഒരു പരിസ്ഥിതി ഘടകമാണ് ഇൻസുലിൻ സാധ്യതയുള്ള ഭക്ഷണ ഉൽപന്നമായി കണക്കാക്കപ്പെടുന്നത്. കാരണം, EAE (ക്ലൈൻവൈറ്റ്ഫീൽഡ്, അൽ., വു et al., XXX) ൽ പാത്ത്ലോണിക് തകരാറുള്ള സൈറ്റോകിനുകൾ, . MS വികസനത്തിൽ മുപ്പത് കോശങ്ങൾ ഉൾപ്പെട്ടിട്ടുണ്ട്.

പശുവിന്റെ പാൽ കൊഴുപ്പ്, പാൽ ഗ്ലോബൽ മെംബ്രെൻ പ്രോട്ടീനുകൾ

പാൽ കൊഴുപ്പ് ഗ്ലോബുൾ മെംബ്രൺ (MFGM; Riccio, 2004) എന്ന പ്രോട്ടീനുകൾ എന്ന പേരിൽ ലിപിഡുകളും പ്രത്യേക പ്രോട്ടീനുകളും നിർമ്മിച്ച ഒരു സ്തര ആഘാതം ഓക്സിഡേഷനിൽ നിന്ന് സംരക്ഷിക്കപ്പെടുന്നു. പാൽ പ്രോട്ടീനുകളിൽ എൺപതു% മാത്രം അടങ്ങുന്ന ഈ പ്രോട്ടീനുകൾക്ക് പോഷകാഹാര മൂല്യത്തേക്കാൾ വിവരമുള്ളതാണ്. മനുഷ്യകുലത്തിൽ കുഞ്ഞിൽ ദഹന, നാഡീവ്യൂഹം, രോഗപ്രതിരോധ സംവിധാനങ്ങൾ എന്നിവയുടെ ശരിയായ രൂപവത്കരണത്തിന് ഇവ ആവശ്യമാണ്. മനുഷ്യന്റെ പോഷണത്തിനായി പശുവിന്റെ പാൽ വാങ്ങുന്നതിനേക്കാൾ, പ്രായപൂർത്തിയായിടത്തും, ആവശ്യമില്ലെന്നുള്ള വിവരങ്ങളുടെ ഒഴുകുന്നു. പ്രായപൂർത്തിയായപ്പോൾ, പശുവിൻ പാൽ എന്ന എംഫഗ്എംഎം പ്രോട്ടീനുകൾക്ക് വിവരമുള്ള പങ്കില്ല. ഭക്ഷണപദത്തിൽ നിന്ന് പാൽ കൊഴുപ്പിനൊപ്പം ഇല്ലാതാക്കാം.

എം പിയുടെ പാലിൽ നിന്നും എം.എഫ്.ജി.ജി.എം പ്രോട്ടീനുകൾ നീക്കം ചെയ്യുമ്പോൾ പ്രത്യേകിച്ചും പ്രസക്തമാണ്. എം.ആർ.ജി.എം. പ്രോട്ടീന്റെ (മൊത്തം എം.എഫ്.ജി.എം.എം. പ്രോട്ടീനുകളുടെ എൺപതാം%), ബ്യൂറോരോഫിലിൻ (ബി.ടി.എൻ) ആണ് എം.എസ്.ജി.യിൽ വളരെയധികം സാമ്യമുള്ളത്. എം.എസ്. എം.എസ്. പരീക്ഷണ മോഡലുകളിൽ ഇതേ സ്വഭാവം ബി.ടി.എൻ, എം.ജി. പങ്കുവയ്ക്കുകയുണ്ടായി, എം.ജി. / ബി.ടി.എൻ ക്രോസ് റിനാക്റ്റീവ് ആന്റിബോഡികൾ എം.ടി.യിൽ ഓട്ടിസം, കൊറോണറി ഹാർട്ട് ഡിസീസുകളിൽ (CHD, റിഖീയോ, 40) കണ്ടെത്തി. ഈ അടിസ്ഥാനത്തിൽ, എം.എസ്. രോഗിയുടേത് മുഴുവൻ പശുവിന്റെ പാൽ കുടിക്കുന്നത് ഒഴിവാക്കുകയും, ചുട്ടുപഴുപ്പിച്ച പാൽ ഇഷ്ടപ്പെടുകയും വേണം.

മറ്റൊരു കാഴ്ചപ്പാട് സ്വാൻസോണിന്റെതാണ്. (2013). BTN അല്ലെങ്കിൽ BTN പോലെയുള്ള തന്മാത്രകൾ പ്രതിരോധശേഷിയിൽ ഒരു നിയന്ത്രിത പങ്കു വഹിക്കുമെന്ന് അവർ കണ്ടെത്തിയിട്ടുണ്ട്, അതിനാൽ അവർ BTN അല്ലെങ്കിൽ BTN- ന് സമാനമായ ട്രൈഗ് വികസിപ്പിച്ചെടുക്കുവാൻ ഉപകാരപ്രദമാണോ എന്ന് നിർദേശിക്കുന്നു.

ഹൈപ്പർ കലോറിക് ഡിസീസ്, പോസ്റ്റ് പ്രിൻഡിയൽ വീക്കം എന്നിവ

ഓരോ ഭക്ഷണവും കഴിഞ്ഞ്, തരത്തിലുള്ള അളവും ഭക്ഷണത്തിൻറെ അളവും അനുസരിച്ച് മിതമായ ഒരു ഓക്സിഡൻറ് സമ്മർദ്ദവും മിതമായ ഒരു കോശജ്വലനവും ഉണ്ടാകാം. ഉപ്പ് / ജന്തു കൊഴുപ്പ്, ട്രാൻസ് ഫാറ്റ്, പഞ്ചസാര, മധുരമുള്ള പാനീയങ്ങൾ തുടങ്ങിയവ കഴിക്കുന്നതിലൂടെ ഭക്ഷണത്തിനുപയോഗിക്കുന്ന ഭക്ഷണ രീതികൾ നമ്മുടെ രോഗപ്രതിരോധ / ഉപാപചയ രീതിയെ സ്വാധീനിക്കുന്നു. ഹോമിയോസ്റ്റാസിൻറെ തുടർന്നുള്ള പരാജയം വൈവിധ്യമാർന്ന രോഗപ്രതിരോധ-രാസവിനിമയ വൈകല്യങ്ങളിലേക്കു നയിച്ചേക്കാം. .

ഒന്നിച്ചുചേർന്നത്, താഴെ പറയുന്ന കാരണങ്ങൾ കൊണ്ടാണ് ഭക്ഷണത്തിൽ സ്വാധീനിച്ച സ്ട്രെസ്: (എ) കലോറി ഉപഭോഗം: ഉയർന്ന കലോറികൾ, കൂടുതൽ ഓക്സിഡയന്റ് സമ്മർദ്ദം ഉണ്ടാക്കുന്നു; (ബി) ഭക്ഷണത്തിന്റെ ഗ്ലൈസീമിക ലോഡ്: കട്ടിയുള്ള postdandially ഗ്ലൈസീമിക കൊടുമുടികൾ ആവശ്യമുള്ളതിനേക്കാൾ ഇൻസുലിൻ ഉത്പാദനം വർദ്ധിപ്പിക്കും; (സി) ലിപിഡ് പാറ്റേൺ: പൂരിത മൃഗങ്ങളെ കൊഴുപ്പ്, ട്രാൻസ്ഫോർഡ് ഫാറ്റി ആസിഡുകൾ, ഒമേഗ- 6 (n-6) നീണ്ട ശൃംഖല PUFA പോസ്റ്റ്മോഡിയൻ വീക്കം പ്രോത്സാഹിപ്പിക്കുക. താഴെപ്പറയുന്ന വിഭാഗങ്ങളിൽ റിപ്പോർട്ട് ചെയ്യപ്പെട്ടതുപോലെ, പോസ്റ്റ്പാൻഡിയൽ വീക്കം n-3 PUFA, പോളിഫെനോൽസ്, കലോറി നിയന്ത്രണം, ശാരീരിക വ്യായാമം എന്നിവമൂലം നിശിതമാണ് അല്ലെങ്കിൽ അടിച്ചമർത്തുകയാണ്.

ആൻറി-ഇൻഫാംമിറ്ററി പ്രകൃതി ബയോആക്റ്റീവ് കോണ്ടൗണ്ട്സ്: MS ടക്കെയ്ക്ക് ആൻഡ് റീസെപ്സസ് തടയുക ലേക്കുള്ള ഉപയോഗപ്രദമാണോ?

പ്രത്യുത്തര ബയോ രാസപ്രവർത്തനത്തിന് വിധേയമായ dietary molecules pathogenic മൈക്രോ ബിയർ ഏജന്റുമാരുടെ പ്രത്യാഘാതങ്ങൾ തടയാനും, കോശജ്വസ്തു തന്മാത്രകളുടെ വ്യാഖ്യാനം കുറയ്ക്കാനും കഴിയും. അതിൽ ഏറ്റവും പ്രധാനപ്പെട്ട സംയുക്തങ്ങൾ പച്ചക്കറികളിൽ നിന്നുള്ള പോളിഫെനോൽസ്, കരോട്ടിനോയ്ഡുകൾ, മത്സ്യം, എൻഡിഎൻഎൻഎൻഎക്സ് പഫ്എ, വൈറ്റമിൻ ഡി, എ, ലിപ്പോയ്ക് ആസിഡ്, സെലിനിയം, മഗ്നീഷ്യം തുടങ്ങിയ ഒളിഗോലെറ്റുകൾ പോലുള്ള ധാഘ്യമായ സംയുക്തങ്ങളാണ്.

ആൻറി ഓക്സിഡൻറില്ലാത്ത PUFA ഒഴികെയുള്ളവയെ സൂചിപ്പിക്കുന്ന മിക്ക സംയുക്തങ്ങളും അവയുടെ ആന്റിഓക്സിഡന്റ് സ്വഭാവങ്ങൾക്ക് പേരുകേട്ടതാണ്. സൂക്ഷ്മജീവികളുടെയും അങ്കണവാസിൻറെയും നാശത്തിന് കാരണമാകുന്ന ഓക്സിഡന്റ് സ്ട്രെസ്സ്, ഇൻഫോമമിറ്റീവ് പ്രക്രിയയുടെ ഏറ്റവും പ്രധാനപ്പെട്ട ഘടകങ്ങളിൽ ഒന്നാണ് എന്ന നിരീക്ഷണം അടിസ്ഥാനമാക്കിയാണ് MS ലെ ആൻറിഓക്സിഡൻറുകൾ ഉപയോഗിക്കുന്നതിനുള്ള റസിഡൽ. എന്നിരുന്നാലും, ഇപ്പോൾ വളരെ സാധാരണമായ ആൻറി ഓക്സിഡൻറിനുള്ള പ്രവർത്തനങ്ങൾക്ക് അപ്പുറത്തുണ്ടാകുന്ന അധിക ജീവശാസ്ത്രപരമായ സ്വഭാവങ്ങളുണ്ട്. വാസ്തവത്തിൽ, സൂക്ഷ്മജലപ്രതിഭകളുടെയും പൂരിത കൊഴുപ്പ് ആസിഡുകളുടെയും വിപരീതഫലങ്ങൾ പ്രതിരോധിക്കാൻ കഴിയുന്നു, പ്രോണിഫാംമിറ്റേറിയൻ തന്മാത്രകൾ, ഓക്സിഡൻറ് സ്ട്രെസ്സ്, ആൻജിയോജനനവസ്തുക്കൾ എന്നിവയുടെ വ്യാഖ്യാനത്തെ അവഗണിച്ച്.

Polyphenols

പച്ചക്കറികൾ, ധാന്യങ്ങൾ, പയർവർഗങ്ങൾ, സുഗന്ധവ്യഞ്ജനങ്ങൾ, പച്ചമരുന്നുകൾ, പഴങ്ങൾ, വീഞ്ഞു, പഴച്ചാറുകൾ, ചായ, കാപ്പി എന്നിവയിൽ അടങ്ങിയിരിക്കുന്ന എല്ലാ പോളിഫെനോൽസുകളും പ്രതിരോധ-ബാഷ്പീകൃത, ആൻറി-ആംഗിയോജനിക്, ആൻറിവൈററൽ ഗുണങ്ങളുള്ളവ, കാറ്റാബോളിക് പാഥേകൾ (ഗുപ്തയും മറ്റു പലരും, വാങ് പലരും, 2014). ഗ്ലൈക്കോസിഡ്സ്, എസ്റ്റേഴ്സ് അല്ലെങ്കിൽ പോളീമർ എന്ന രൂപത്തിൽ ചെടികളിൽ കാണപ്പെടുന്നു. കുടൽ സ്തരയിൽ പ്രവേശിക്കാൻ വളരെ വലുതാണ്. ഗ്യൂട്ട് മൈക്രോബയോട്ടയിൽ നിന്നും പുറത്തുവരുന്ന Aglycons ഗ്ലൂക്കോറോണിഡുകളും സൾഫറ്റുകളും കുടൽ, കരൾ എന്നിവയിൽ ചേർക്കുന്നു. അവരുടെ പരിഹാരവും ജൈവവാതവും വളരെ പാവപ്പെട്ടവയാണ് (μ എം; വിസിയോളി മുതലായവ., 2014).

ഘടനാപരമായ ഒരു വീക്ഷണകോണിൽ നിന്ന്, പോളിഫോനോൽസ് ഫ്ലേവനോയ്ഡുകളും നോൺ ഫ്ളനോനോയ്ഡുകളും തന്മാത്രകളാണ് (ബ്രാവോ, 1998). ഏറ്റവും പ്രധാനമായ flavonoids quercetin (ഉള്ളി, ആപ്പിൾ, സിട്രസ് ഫലം, വീഞ്ഞും; കുറഞ്ഞത് പലതും, സ്റ്റെർനഗ്ബർഗ് et al., 2007), catechins (പച്ച ചായ, ഫ്രീഡ്മാൻ, 2008), കൂടാതെ ഡൈസെസിൻ, genistein (soy; et al., 2007, Zhou et al., 2013). ഏറ്റവും പ്രധാനപ്പെട്ട nonflavonoids resveratrol (ചോക്ലേറ്റ്, ചെയുക, സരസഫലങ്ങൾ, കറുത്ത മുന്തിരി, ചുവന്ന വീഞ്ഞ്; Das ആൻഡ് ദാസ്, Xngx; ചെംഗ് et al., ഷാക്കിബ്ഇ, പലരും,) curcumin (ഇഞ്ചി കുടുംബത്തിന്റെ സുഗന്ധവ്യഞ്ജന, കറി (Prasad et al., 2014), ഹൈഡ്രോക്സിറ്റിയോസോൾ (ഒലിവ് ഓയിൽ, ഹു എട്ട് തുടങ്ങിയത്, 2007).

പോഷെഫെനോൾസ് വിൻറിലെ വിൻറുകളുടെ പ്രത്യാഘാതം അവയുടെ രാസഘടന (Liuzzi et al., 2011) അനുസരിച്ചായിരിക്കും എന്ന് കണ്ടെത്തിയിട്ടുണ്ട്. അങ്ങനെ, ഫ്ളാവനോയ്ഡുകളുടെയും മിശ്രിതം (nonflavonoids) എന്ന മിശ്രിതം ഒരു പോളിഫിനോൾ മാത്രമുള്ളതിനേക്കാൾ കൂടുതൽ ഫലപ്രദമാകാം.

പഠനവിധേയമാക്കിയ പോളിഫിനോളുകൾക്ക് ക്യൂറോസെറ്റിനും റിവേവർട്രോളിനും രണ്ട് ഉദാഹരണങ്ങൾ ഉണ്ട്. ക്യുർസെറ്റിൻ പ്രധാനമായും ഗ്ലൂക്കോസൈഡാണ്. ഇതിന്റെ പല ഫലങ്ങളും ഇന്റർഫെറോൺ β ന്റെ സംഖ്യകളാണ്. ക്വേർസെറ്റിൻ വിഷം അല്ല, എന്നാൽ അതിന്റെ ഓക്സിഡേഷൻ ഉത്പാദനം ക്യൂർസെറ്റിൻ ക്വിനോൺ വളരെ പ്രോട്ടീന്റെയും ഗ്ലൂത്തോട്യോണിന്റെയും ഗ്രൂപ്പുകളെ പ്രതികൂലമായി ബാധിക്കുന്നു. ഇത് വിഷബാധമാവുകയും ചെയ്യും (ബൂട്ടിസ് മറ്റുള്ളവർ, 2008). ലിപ്പോക്സിക് ആസിഡ് അഥവാ എൻ-അസറ്റിലൈസെസ്റ്റിനൊപ്പം ചേർക്കുന്നത് വിഷലിപ്തമായ ഇഫക്റ്റുകൾ പരിമിതപ്പെടുത്താം.

കരൾ വിസർജ്ജ്യമാണത്. ഇത് പ്രധാനമായും ഡുവോഡിനത്തിൽ വളരെ ചുരുങ്ങിയ അളവിൽ മാത്രമേ ആഗിരണം ചെയ്യപ്പെട്ടിട്ടുള്ളൂ. അതിന്റെ സാന്ദ്രതയെ ആശ്രയിച്ച്, റെസ് വ്രേട്രോൾ, necrosis അല്ലെങ്കിൽ അപ്പോപെറ്റൊസിസ് വഴി ധാരാളം വൈറസ് കോശങ്ങളുടെ മരണത്തെ പ്രേരിപ്പിക്കാൻ കഴിയും. ഇതുമായി ബന്ധപ്പെട്ട് റെവ വെട്രാളിന്റെ ന്യൂറോ പ്രോട്ടോക്റ്റീവ് ഇഫക്ടുകൾ ഉണ്ടെന്നാണ് പൊതുവെ കരുതപ്പെടുന്നത്. എന്നിരിക്കിലും ഇത് പരീക്ഷണാത്മക MS-പോലുള്ള രോഗങ്ങളെ (Sato et al., 2013) വർദ്ധിപ്പിക്കുമെന്ന് റിപ്പോർട്ട് ചെയ്യപ്പെട്ടിട്ടുണ്ട്. റിവേവാറ്രോളിന് 10-XNUM M (മനുഷ്യ മസ്തിഷ്മ കോശങ്ങളുടെ പ്രചാരം), 5-XNUM മില്ലിമീറ്റർ (പ്രോലിഫെഡറേഷൻ തടഞ്ഞത്) എന്നിവയുടെ സാന്ദ്രതയിൽ വിപരീത ഫലങ്ങളാണുണ്ടാകുന്നതെന്നതിനാൽ ഈ പൊരുത്തക്കേടുകൾ വിവോയിൽ ഇൻസ്ട്രോ അല്ലെങ്കിൽ ബയോവെയറിൽ ഉപയോഗിക്കുന്ന വ്യത്യസ്ത സാന്ദ്രീകരണത്തിന് കാരണമാകാം. നമ്മുടെ അനുഭവത്തിൽ, റിസർ വട്രോറിലാകട്ടെ, ന്യൂട്രോട്രോളിന്റെ പ്രഭാവം, കോർട്ടിക്കൽ ന്യൂറോണുകൾ സംസ്കാരത്തിൽ വളരെ കുറഞ്ഞ അളവിൽ മാത്രമാണ്, എന്നാൽ ഉയർന്ന സാന്ദ്രതയിൽ ഇത് വിഷബാധമൂലമുണ്ടാകാം. എന്നാൽ ഓക്സീറ്റീവ് സമ്മർദ്ദത്തിന്റെ കാര്യത്തിൽ, റീസൽട്രോളിൽ ഉയർന്ന സാന്ദ്രതകളിലെയും ന്യൂറോ പ്രോട്ടോക്റ്റീവ് പ്രോപ്പർട്ടികൾ ഉണ്ട്.

വിറ്റാമിൻ ഡി, വിറ്റാമിൻ എ, കരോട്ടിനോയ്ഡുകൾ, മറ്റ് വിറ്റാമിനുകൾ, ഒളിഗോലെമെന്റുകൾ എന്നിവ

MS ലെ സപ്ലിമെൻറുകളിൽ ഉപയോഗപ്രദമായ മറ്റു സംയുക്തങ്ങളും ഘടകങ്ങളും വിറ്റാമിൻ ഡി, എ, ഇ, സി, ബിഎക്സ്എൻഎക്സ് (മാസ്റ്റ്രോണാർഡി, അൽ, നം), നയാസിൻ (പെൻബെത്തി, സുണോട, എൺപത്), സെലിനിയം (ബോസാലീസ് , 12) മഗ്നീഷ്യം (ഗാലാൻഡ്, 2004).

വിറ്റാമിൻ ഡി രോഗപ്രതിരോധ-മോഡുലറായ റോളുകളുണ്ട്. എം.എസ്. (സ്മോണ്ടേഴ്സ് et al., Pierrot-Deseilligny, XXX; Cantorna, X; Ascherio et al., XXX) പോലുള്ള വിട്ടുമാറാത്ത കോശജ്വസ്തു രോഗങ്ങളുടെ ചികിത്സയ്ക്ക് ഏറ്റവും പ്രോത്സാഹിപ്പിക്കുന്ന ഭക്ഷണ തന്മാത്രയെ പ്രതിനിധാനം ചെയ്യുന്നു. ചില രാജ്യങ്ങളിൽ സൂര്യപ്രകാശത്തിന് അപര്യാപ്തമായതിനാൽ വിറ്റാമിൻ-ഡിഎൻഎൻഎക്സ്-ന്റെ ലഭ്യത കുറയ്ക്കാനും ലോകത്തിലെ എം എസ്സിന്റെ പ്രത്യേക ഭൂമിശാസ്ത്രപരമായ വിതരണത്തിനും കാരണമാകുമെന്നാണ് പൊതുവേ കരുതപ്പെടുന്നത്. ചില രാജ്യങ്ങളിൽ സജീവമായ വിറ്റാമിൻ ഡി അഭാവം എം. എന്നിരുന്നാലും, സജീവ വിറ്റാമിൻ ഡി കുറഞ്ഞ അളവിൽ മാറ്റം വരുത്തുന്നത്, സൂര്യപ്രകാശത്തിന്റെ സാന്നിധ്യം മാത്രമല്ല മാറ്റം വരുത്തിയേക്കാവുന്ന ഉപാപചയപ്രവർത്തനത്തിന്റെയോ അല്ലെങ്കിൽ പ്രവർത്തനത്തിന്റേയോ കാരണമാകാം. വാസ്തവത്തിൽ, ശരീരഭാരം കുറയ്ക്കുന്നതിന് അല്ലെങ്കിൽ ഫലപ്രദമല്ലാത്ത ഫലങ്ങളെ കാണിക്കുന്ന വിറ്റാമിൻ ഡി.എൻ.എൻ.എക്സ്.എക്സ് (cholecalciferol) സപ്ലിമെന്റേഷൻ ഫലമായി അതിന്റെ അഡ്മിനിസ്ട്രേഷൻ ശേഷി കുറയുന്നു.

സൂര്യപ്രകാശത്തിനു ശേഷം രൂപം പ്രാപിച്ച വിറ്റാമിൻ D3 (cholecalciferol), P25 എൻസൈമുകൾ CXP3NUMX അല്ലെങ്കിൽ CYP450R27 വഴി 1- (OH) D2 (calcidiol) മുതൽ ഹൈഡ്രോക്സൈലേറ്റുചെയ്തത്, തുടർന്ന് വൃക്കയിൽ സജീവമാക്കി CYP1B27 മുതൽ 1, 1- (OH ) XXX D25 (കാല്വിട്രിയോള്). വൈറ്റമിൻ ഡിയുടെ സജീവ രൂപം, CYP2NUM മുതൽ 3, 24- (OH) 1 (calcitroic acid) CYPX വഴി നിർജ്ജീവമാക്കിത്തീർക്കുന്നു. ഇതിനർത്ഥം സജീവമായ വിറ്റാമിൻ ഡി യുടെ അളവ് CYP1B24,25 ഉം അതിന്റെ CYP3A3 (Schuster, 27) ഉം മുഖേനയുള്ള സിന്തസിസിൻറെ ആപേക്ഷിക നിരക്കുകളെയെല്ലാം ആശ്രയിച്ചിരിക്കുന്നു എന്നാണ്. എന്റോഗിയോണസ് സംയുക്തങ്ങളും xenobiotics കൊണ്ട് സൃഷ്ടിച്ച ഉയർന്ന CYP1A24 എക്സ്പ്രഷൻ, വിറ്റാമിൻ ഡിയുടെ താഴ്ന്ന നിലവാരത്തിലേക്ക് നയിക്കുകയും, വിട്ടുമാറാത്ത കോശജ്വസ്തു രോഗങ്ങൾക്കും അർബുദത്തിനും കാരണമാക്കുകയും ചെയ്യുന്നു. വൈറ്റമിൻ ഡി അഡ്മിനിസ്ട്രേഷൻ വഴി വിറ്റാമിൻ ഡിയുടെ അളവ് വളരെ പ്രധാനമാണ്. വൈറ്റമിൻ ഡി അളവ് കുറവായിരിക്കും എങ്കിൽ, CYP1XX mRNA ന്റെ പ്രകടനം പരിശോധിക്കണം, കൂടാതെ CYP2011B24, CYP1NUMX പ്രവർത്തനങ്ങളും അവയുടെ നിരോധനവും നിർണയിക്കണം (ചീലിനിനി et al., 24, Kósa et al., XXX).

മറ്റൊരു പ്രധാന വശം വി. വിറ്റാമിൻ ഡി -12, എക്സ്-ദി-ഡൈഡ്രോഡൈക്സിവിറ്റമിൻ ഡി-ബൈൻഡ്സ് VDR- യുടെ സജീവ മെറ്റബോളിറ്റ്, സങ്കീർണ്ണമായ VDR-D ദീർഘകാല രോഗങ്ങൾക്ക് സാധ്യതയുള്ള പ്രക്രിയകളിൽ ഉൾപ്പെട്ടിരിക്കുന്ന പല ജീനുകളുടെയും പ്രകടനത്തെ നിയന്ത്രിക്കുന്നു. എക്സെർ-ഡിഎക്സ്ആർ, ബിഎസ്എൻഎൽ, എസ്ടിഎക്സ്എൽ എന്നിവയ്ക്ക് അനുസൃതമായി, VDR-D സങ്കീർണ്ണ ഘടനയിൽ LPAR- സജീവമാക്കപ്പെട്ട PPAR- കൾ അല്ലെങ്കിൽ LXR- കളുമായി മത്സരിക്കുന്നു. Heterodimeric കോംപ്ലെക്സ് പ്രോഫിഫോമമിറ്ററി ട്രാൻസ്ക്രിപ്ഷൻ ഫാക്റ്റർ NFkB ലേക്ക് ബന്ധിപ്പിക്കുകയും, പ്രോനിഫാംമറ്റോണിക് തന്മാത്രകളുടെ സമന്വയത്തെ താഴെയിടുകയും ചെയ്യുന്നു. ഈ സന്ദർഭത്തിൽ, എം.എസ്. കോഴ്സിലുള്ള വിറ്റാമിൻ ഡി ഉപഭോഗത്തിന്റെ ഫലപ്രാപ്തിയെ വിലയിരുത്തുമ്പോൾ, അടുത്ത കാലത്തുണ്ടാകുന്ന പോൾമോഫിഫിസങ്ങൾ വിഡ്ഡിയർ, അമിത വണ്ണം, ഗേറ്റ് ചലിക്കാനുള്ള മാറ്റം (അൽ-ദാഗ്രി തുടങ്ങിയവയുമായി ബന്ധപ്പെട്ടവയാണ്. , 1).

VDR-D, Sirtuin SIRT-XXX (ഒരു കൂട്ടം, XIX, Polidoro et al., XXX) ആക്ടിവേറ്റ് ചെയ്യുന്നതിൽ വൈറ്റ് ഡി ഡി സെൽ മെറ്റബോളിസത്തിൽ സ്വാധീനം ചെലുത്തുന്നു എന്നതിനാൽ, മറ്റു പല ആഹാര സാധനങ്ങളും: അണ്ഡ്രേലറ്റ് ഓക്സിഡേറ്റീവ് മെറ്റബോളിസവും ഡൈ നെഗ്രസുലേറ്റ് വീക്കം.

അവസാനമായി, മനുഷ്യന്റേയും പരീക്ഷണാത്മകമാതൃകകളിലുമുള്ള വ്യത്യാസങ്ങൾ തമ്മിൽ വ്യത്യാസങ്ങളുണ്ടെന്ന് പരിഗണിക്കേണ്ടതുണ്ട്. വാസ്തവത്തിൽ, മനുഷ്യരിൽ, എലികളിൽ നിന്ന് വ്യത്യസ്തമായി, പൊണ്ണത്തടി, വിറ്റാമിൻ ഡി നിലയം (Bouillon et al., 2014) എന്നിവയുമായി ബന്ധപ്പെട്ടിരിക്കുന്നു.

കരോട്ടിനോയ്ഡുകൾക്കിടയിൽ ഏറ്റവും പ്രധാനപ്പെട്ടത് ലൈക്കോപിൻ (തക്കാളി, വെള്ളം തണ്ണിമത്തൻ, പിങ്ക് മുന്തിരിപ്പഴം, റാവു, റാവു, 2007). വളരെ ശക്തമായ ആൻറി ഓക്സിഡൻറാണ് കൂടാതെ ലൈക്കോപിൻ ബീറ്റാ കരോട്ടിൻ, റിട്രോയിനൈഡ് ആസിഡ് നൽകുന്നത്, രണ്ടാമത്തേതിന് ആർഎക്സ്ആർ റിസീപ്റ്ററിനെ (ചിത്രം 2) സജീവമാക്കാം. ആഹാരത്തിലെ കരോട്ടിനോയ്ഡുകൾ, വിറ്റാമിൻ സി, വിറ്റാമിൻ ഇ എന്നിവയുടെ ഉയർന്ന അളവുകൾ സ്ത്രീകളിൽ എം എസ്സിന്റെ സാധ്യത കുറയ്ക്കില്ല (Zhang et al., 2001), ലൈക്കോപ്പൈൻ, വിറ്റാമിൻ എ എന്നിവയുടെ വീക്കം വീശിക്കാതിരിക്കാനാവില്ല.

വെജിറ്റബിൾസ്, സീഫർട്ട്, ഫിഷ് ഓയിൽ എന്നിവയിലെ ഒമേഗ-എൻഎക്സ്എക്സ്-എൻഎക്സ്എൻഎൽ എസൻഷ്യൽ ഫാറ്റി ആസിഡുകൾ, പോളീ-അനായാറ്റേറ്റഡ് ഫാറ്റി ആസിഡുകൾ

n-3 അവശ്യ ഫാറ്റി ആസിഡുകൾ (EFA), PUFA മൃഗങ്ങളുടെ ഉത്പന്നങ്ങളുടെ പൂരിത ആസിഡുകൾക്ക് സാധുതയുള്ള ഒരു ബദൽ പ്രതിനിധാനം ചെയ്യുന്നു.

പച്ചക്കറികളും സസ്യ എണ്ണകളും അവശ്യ ഫാറ്റി ആസിഡുകൾ ലിനോലിക് ആസിഡ് (n-6), ലിണോലോനിക് ആസിഡ് (n-3) എന്നിവ അടങ്ങിയിട്ടുണ്ട്. N-6, N-3 ഫാറ്റി ആസിഡുകൾക്ക് വിപരീതഫലങ്ങൾ ഉണ്ട്. ഭക്ഷണത്തിൽ അവയുടെ സാന്നിധ്യം തുലാകണം (ഷ്മിത്സ് ആൻഡ് എക്കർ, 2008). എന്നിരുന്നാലും, പാശ്ചാത്യ ആഹാരത്തിൽ, N-6 / N-3 അനുപാതം 6- ൽ നിന്ന് 9-ാം തവണ വരെ വർദ്ധിച്ചിരിക്കുന്നു, ഇത് ഹൃദയ സംബന്ധമായ അസുഖങ്ങൾ വർദ്ധിക്കുന്നതിലേക്കും നയിക്കുന്നു. വാസ്തവത്തിൽ, ലിനോളൈക്ക് ആസിഡ് ആറാച്ചിഡോണിക് ആസിഡ് (15: 20) രൂപകൽപ്പനയിലേയ്ക്ക് നയിക്കുന്നു. പ്രോസ്റ്റാമ്പാമിമിക് ഇക്കോസാനോയ്ഡ്സ് പ്രോസ്റ്റാഗ്ലാൻഡിൻസ് -4, ലുക്കോട്രിയൻസ് -3, ആൻഡ് ടൈംബോക്സനൻസ് -83 എന്നിവ. ഈ eicosanoids സംയുക്തം ഇൻസുലിൻ, ആസ്പിരിൻ, അതുപോലെ n-2 ലിനോലെനിക് ആസിഡനിൽ നിന്നും ഉരുത്തിരിഞ്ഞുണ്ടാകുന്ന n-4 ലോംഗ്-ചെയിൻ PUFA EPA (eicosapentaenoic ആസിഡ്), DHA (docosahexaenoic ആസിഡ്) തുടങ്ങിയവയാണ്.

ഡി.എച്ച്.എ, ഇപിഎ എന്നിവ കടൽ വിഭവങ്ങളിലും മത്സ്യ എണ്ണയിലും കാണപ്പെടുന്നു. രണ്ടെണ്ണം ശ്രദ്ധേയമായ വിരുദ്ധ, വിരലടയാളം, പ്രതിരോധ-മോഡുലേഷൻ പ്രവർത്തനങ്ങൾ, അവയുമായി താരതമ്യപ്പെടുത്താവുന്നതാണ് (കാൾഡർ, എക്സ്.എൻ.എക്സ്, ഫാറൂവി മുതലായവ.). n-2006 PUFA ഹാനികരമായ പ്രക്രിയകൾ തടയും ഫാറ്റി ആസിഡുകളും കൊളസ്ട്രോളിന്റെ സമന്വയവും, പകരം അവർ ഫാറ്റി ആസിഡുകളുടെ ഓക്സീകരണം ഉത്തേജിപ്പിക്കുന്നു. ഈ അടിസ്ഥാനത്തിൽ, MS, N-2007 അനിവാര്യമായ ഫാറ്റി ആസിഡുകൾ (EFA), n-3 PUFA തുടങ്ങിയ ശാരീരികമായ വീക്കം രോഗങ്ങളിൽ n-3 ഫാറ്റി ആസിഡുകളിലുടനീളം ഭക്ഷണത്തിൽ ഉൾപ്പെട്ടിരിക്കണം. തലച്ചോറിലെ ഉയർന്ന സാന്നിധ്യത്തിൽ ഡി.എച്ച്.എയും, MS ലെ രോഗികളിൽ കുറവുണ്ടാകുമെന്നതും ശ്രദ്ധേയമാണ്.

LPS സജീവമാക്കിയ സംസ്ക്കരിച്ച സൂക്ഷ്മാത്മക മൈഗ്രകളിൽ, മത്സ്യ എണ്ണ, ഇന്റർറോൺ- β പോലെ വളരെ ഫലപ്രദമാണ്, MMP-9 (ജെലാറ്റിനസ് ബി) എന്ന ആശയം, ന്യൂറോ-വീക്കം (Liuzzi et al., 2004, 2007) എന്ന ഒരു പ്രധാന മധ്യസ്ഥൻ. കൂടാതെ, N-3 PUFA എം.എം.പി- 9 നിലവാരത്തിൽ കുറച്ചു ക്ലിനിക്കൽ ട്രയലുകളിൽ കുറയുകയും ചെയ്തു. ഇത് സൂചിപ്പിക്കുന്നത് എൻ- 3 PUFA MS- ൽ നല്ലൊരു പരിപൂരക ചികിത്സ ആയിരിക്കുമെന്നാണ്. (Weinstock-Guttman et al., 2005; Mehta et al., 2009 ; ഷിന്റ്ടെ മറ്റുള്ളവർ, 2009). ഫിഷ് എണ്ണയും ആരോഗ്യമുള്ള എലി പ്യൂഡുകളിൽ മോട്ടോർ പെർഫോർണൻസ് മെച്ചപ്പെടുത്താനും കണ്ടെത്തിയിട്ടുണ്ട് (കൊളുച്ചിയ et al., 2009).

എൻ.എക്സ്.എൻ. എക്സ്.എൻ.എക്സ്. പി.എഫ്.എ ആക്റ്റ് എപിപി കെ, കോക്സ് എൻസൈമുകളിൽ ആസ്പിരിൻ ഉപയോഗിച്ച് വ്യത്യസ്ത സംവിധാനങ്ങളോടെ പ്രവർത്തിക്കുന്നു. ശ്രദ്ധേയത, ആസ്പിരിൻ സാന്നിധ്യത്തിൽ, ഇപിഎയും ഡിഎച്ച്എയും സെല്ലുലാർ വീക്കം കുറച്ചും വേദനയും കുറയ്ക്കാൻ കഴിയുന്നതുമായ പരിഹാരങ്ങൾ, പ്രതിരോധം, മരീസിൻസ് എന്നിവ പുതിയ വിരുദ്ധ ബാഹ്യ സമ്മർദ്ദതന്ത്രങ്ങൾ രൂപീകരിക്കുന്നു (Xu et al., Xxxxxxxxxxxxxx; സെർഹും ചിയാങ്ങും, 3). ഇത് MS ലെ പോഷക ഇടപെടലുമായി ബന്ധപ്പെട്ട പ്രസക്തമായ ഒരു കാര്യമായിരിക്കാം. തീർച്ചയായും, MS- മായി ബന്ധപ്പെട്ട ഇൻഫാംമിറേഷൻ പ്രക്രിയകൾ കുറഞ്ഞ അനുപാതം ഒമേഗ-എൻ.എക്സ്.എക്സ് (വിരുദ്ധ-വീക്കം) / ഒമേഗ 2010 (വീക്കം) PUFA എന്നിവയ്ക്കായും സാധ്യതയുണ്ട്. ഇതുമൂലം തയാറാക്കിയ മിസൈലുകൾ ലിപ്പോക്സിൻ, resolvins, വീക്കം അടിച്ചമർത്തുക അതിനാൽ ഒമേഗ-എൻ.എക്സ്.എൻ.എക്സ്. പ്യൂഎഫ്എയുടെ അഡ്മിനിസ്ട്രേഷൻ ആസ്പിരിൻ അല്ലെങ്കിൽ നേരിട്ട് ലിപ്പോക്സിൻ, റിസർവിൻസ്, പ്രൊഡീനുകൾ തുടങ്ങിയവ മുഖേനയും മറ്റു ന്യൂറോയ്ൻഫ്രോമമിറ്റീവ് രോഗങ്ങളുടെയും തടയുന്നതിനും ചികിത്സിക്കുന്നതിനും ഒരു പുതിയ സമീപനം ഉണ്ടാക്കാം. കൂടാതെ, EPA, DHA (Yanai et al., 2013) എന്നിവയിൽ നിന്നും P2013 CYP എൻസൈമുകൾ നിർമിക്കുന്ന മറ്റ് വിരുദ്ധ-വിഘടിപ്പിക്കുന്നതും ആന്റിനയോജനിക് ഇക്കോസാനോയ്ഡുകളും നിർമ്മിക്കാം. ഈ സന്ദർഭത്തിൽ, n-3 / n-6- ന്റെ രാസവിനിമയത്തിൽ സ്റ്റാമിനുകൾ പ്രതികൂലമായി ഇടപെടാൻ സാധ്യതയുള്ളതായി കണക്കാക്കേണ്ടതുണ്ട്, കാരണം അവർ n-3 / n-450 അനുപാതം കുറയ്ക്കാൻ കഴിയും. ഇപ്രകാരം, സ്റ്റാറ്റിനുകളുമായുള്ള ചികിത്സ N-2014 PUFA അനുബന്ധവുമൊത്ത് (ഹാരിസ് മറ്റുള്ളവരും, 3) ബന്ധപ്പെടുത്തിയിരിക്കണം.

വിത്ത് എണ്ണകൾ, സൂര്യകാന്തി, സോണ്, സോയാബീൻ, എള്ള് മുതലായവയിൽ n-6 ഫാറ്റി ആസിഡുകളെ അപേക്ഷിച്ച് കൂടുതൽ N-XXX ഫാറ്റി ആസിഡുകളെ ഉൾക്കൊള്ളുന്നു. അതിനാൽ അവരുടെ അനുമാനം മാസിയിലും പരിമിതമാക്കും. പ്രോക്സിഫോമമിക് ഇക്കോസാനോയിഡ് ഉല്പാദനത്തിന്റെ അളവ് പരിമിതപ്പെടുത്താനായി. മറുവശത്ത് കൊക്കോട്ട് ഓയിൽ ധാരാളം പൂരിത ആസിഡുകൾ അടങ്ങിയിട്ടുണ്ട്. പച്ചക്കറി എണ്ണകളിൽ ഒലീവ് ഓയിലുകൾ നല്ല അനുപാതത്തിനായി പൂരിത, അപൂരിത കൊഴുപ്പുള്ള ആസിഡുകൾക്ക് യോജിച്ചതായിരിക്കണം. ആന്റിഓക്സിഡന്റ് ഹൈഡ്രോക്സിറ്റിയോസോൾ അടങ്ങിയിരിക്കുന്നതിനാൽ.

ഭക്ഷണസാധനങ്ങൾ പോലെ Thiolic സംയുക്തങ്ങൾ

MS- യുടെ പരസ്പര ചികിത്സക്കായി ഉപയോഗിക്കാവുന്ന സാധ്യമായ ആഹാര സാധനങ്ങൾ കണക്കിലെടുത്ത് α-lipoic ആസിഡ് (എഎൽഎ), ഗ്ലൂടത്തിയോൺ, എൻ-അസെറ്റലിസിസ്റ്റീൻ (എൻഎസി) എന്നിവ പോലുള്ള thiol groups (-SH) അടങ്ങിയിരിക്കുന്ന സംയുക്തങ്ങൾ കണക്കിലെടുക്കണം.

പോളിഫെനോൽസ്, ALA (സാലൈൻടൺ et al., ഹരിത സസ്യങ്ങളും ജന്തുജന്യ സംസ്ക്കാരങ്ങളും) ഇമൻമോമോഡലോറാലിറ്റി, വീക്കം വിരുദ്ധ സ്വഭാവങ്ങൾ ഉണ്ട്. ബി.എ.ബി. യുടെ സമഗ്രതയെ സ്ഥിരപ്പെടുത്തുന്ന ALA, CAMP ന്റെ ഉത്പാദനവും പ്രോട്ടീൻ കൈനസ്സിന്റെ പ്രവർത്തനവും ഉത്തേജിപ്പിക്കുകയും ചെയ്യുന്നു. എതിരെ NAC ന് ന്യൂറോളജിക്കൽ ഡിസോർഡറുകളിൽ ഉപയോഗപ്രദമാകും. BBB വഴി കടന്നുപോകുകയും അത് വീക്കം പരിരക്ഷിക്കുകയും ചെയ്യുന്നു (ബാർസസാദ് ഷാഹൈഫോർ et al., 2008).

മെഡിറ്ററേനിയൻ ഡയറ്റ്

അടുത്തിടെയുള്ള വ്യവസ്ഥാപിതമായ അവലോകനവും പരിശോധനകളും പരിശോധിക്കുക, മെഡിറ്ററേനിയൻ ഭക്ഷണരീതികൾ വീക്കം, ഹൃദയ സംബന്ധമായ അസുഖം കുറയ്ക്കൽ എന്നിവ കുറയ്ക്കുകയും എൻഡോതെഷിയൽ പ്രവർത്തനങ്ങൾ (സ്മിംഗ്ഷാക്കിൽ, ഹോഫ്മാൻ, 2014) മെച്ചപ്പെടുത്തുകയും ചെയ്യുന്നു. യഥാർത്ഥത്തിലുള്ള മെഡിറ്ററേനിയൻ ഭക്ഷണത്തിൽ ഇപ്പോൾ വിവരിച്ചിരിക്കുന്നതിൽ നിന്നും അൽപം വ്യത്യസ്തമാണ് എന്ന് നിങ്ങൾ വിചാരിക്കുന്ന പോലെ ഈ കണ്ടെത്തലുകൾ പ്രോത്സാഹജനകമാണ്.

മെഡിറ്ററേനിയൻ ഭക്ഷണക്രമം അധിക കരീന ഒലിവ് ഓയിൽ, ശുദ്ധീകരിക്കപ്പെടാത്ത ധാന്യങ്ങൾ, പയർവർഗം, വൈവിധ്യമാർന്ന പച്ചക്കറികൾ (പ്രത്യേക തക്കാളി) പഴങ്ങൾ, പാലുൽപന്നങ്ങൾ (കൂടുതലും പാക്കോറിനോ ചീസ്, റിക്കറ്റോ, മോസ്ജെരെല്ല, തൈര്) എന്നിവയുടെ ഉപയോഗം അടിസ്ഥാനമാക്കിയുള്ളതാണ്. മത്സ്യം, ഫിഷറി ഉത്പന്നങ്ങൾ, മൃഗങ്ങളുടെ കൊഴുപ്പ്, ഇറച്ചി എന്നിവയുടെ കുറഞ്ഞ ഉപഭോഗം. എന്നാൽ, ഇപ്പോൾ മെഡിറ്ററേനിയൻ ഭക്ഷണത്തിൽ പാസ്ത, റൊട്ടി എന്നിവ വളരെ ഉയർന്ന അളവിൽ ഉപയോഗിക്കുന്നു, അതായത് ഗ്ലൂറ്റൻ കൂടുതൽ കഴിക്കുന്നത്.

ഒരിക്കൽ, ശരിയായ മെഡിറ്ററേനിയൻ ഭക്ഷണത്തിൽ, തെക്കൻ ഇറ്റലിയിൽ മാംസം ആഴ്ചയിൽ രണ്ടു തവണയോ മൂന്നു തവണയോ കഴിച്ചിരുന്നു, ഒലിവെണ്ണ മാത്രം പാചകം (അധിക-കന്യക ഗുണവും ഏറ്റവും സാധ്യമായ അസംസ്കൃതവും) ഉപയോഗിച്ചിരുന്നു, എന്നാൽ പ്രത്യേകിച്ച് ഗ്ലൂറ്റൻ കഴിക്കുന്നത് ഇപ്പോഴത്തെ ഉപഭോഗവുമായി താരതമ്യം ചെയ്യുക. പാചകം ക്ലാസിക് ഹോം തയാറാക്കിയ തക്കാളി സോസിനൊപ്പം കഴിച്ചു. പക്ഷേ, പരുത്തിക്ക് മറ്റ് ഗ്ലൂറ്റൻ-ഫ്രീ ഭക്ഷണങ്ങളുമായി പലപ്പോഴും മിശ്രിതമായിരുന്നു. ഏറ്റവും സാധാരണമായ പാചക പാസ്തയും ഉരുളക്കിഴങ്ങും ആയിരുന്നു; പച്ച പയർ, ആർട്ടികോക്ക്, പടിപ്പുരക്കതകിന്റെ, വഴുതന, turnips, അല്ലെങ്കിൽ കാബേജ് ഒന്നുകിൽ പാസ്ത; പച്ചക്കറികളും പയർവർഗ്ഗങ്ങളുമൊക്കെ പാസ്ത (മൈനസ്ട്രോൺ: പച്ചക്കറി സൂപ്പ്); മുട്ടക്കോഴികൾ, പയർ അല്ലെങ്കിൽ പയറ് എന്നിവ ഉപയോഗിച്ച് പാസ്തയും. ഇന്ന് പഞ്ചസാര മധുരമുള്ള പാനീയങ്ങൾ അറിഞ്ഞിരുന്നില്ല. ഗ്ലൂട്ടൻ സമ്പന്നമായ ഭക്ഷണത്തിന്റെ ഉയർന്ന അനുമാനങ്ങൾ നോൺസിയാക് അസിംപോമമിക് ഗ്ലൂറ്റൻ സെൻസിറ്റിവിറ്റി, മ്യൂക്കോസൽ കുടൽ ക്ഷതം, ഗട്ട് മൈക്രോബയോട്ടയിലെ മാറ്റങ്ങൾ, കുറഞ്ഞ ഗ്രേഡ് കുടൽ വീക്കം എന്നിവയിലേയ്ക്ക് നയിച്ചേക്കാം. സമാപനത്തിൽ, മെഡിറ്ററേനിയൻ ഭക്ഷണക്രമം നല്ലതാണ്, എന്നാൽ ഗ്ലൂറ്റൻ കഴിക്കുന്നത് പരിമിതമാവുകയും പൂർണ്ണ ധാന്യങ്ങൾ ആയിരിക്കണം.

കോശജ്വലനവും നശിപ്പിക്കാനുള്ള ലൈഫ്സ്റ്റൈൽ

പുകവലി

പുകവലി ഉളവാക്കുന്ന സ്വാധീനത്തെക്കുറിച്ച് ഏതാനും പഠനങ്ങൾ മാത്രമാണ് നടത്തിയത്, അതിന്റെ ഫലം വൈരുദ്ധ്യമാണ്, ഒരുപക്ഷേ അതിന്റെ ഫലങ്ങൾ മറ്റ് ഘടകങ്ങളിൽ നിന്ന് കണ്ടുപിടിക്കാൻ എളുപ്പവുമാണ്. വില്ല്യം എ. (2014) പുകവലി-റിപ്പപ്സ് നിരക്ക് അല്ലെങ്കിൽ രോഗം പ്രവർത്തനം തമ്മിലുള്ള ബന്ധം കണ്ടെത്തി, എന്നാൽ പുകവലിക്കാർ നോൺ പുകവലിക്കാത്തതിനെക്കാൾ ആരോഗ്യമുള്ള ഒരു ജീവിത നിലവാരം കുറയുന്നു, ഒപ്പം Manouchehrinia et al. (2013) പുകവലി കൂടുതൽ ഗുരുതരമായ രോഗങ്ങളുമായി ബന്ധപ്പെട്ടതായി കണ്ടെത്തി.

എന്നിരുന്നാലും, Figure 2 ൽ കാണിച്ചിരിക്കുന്നതുപോലെ, സിഗരറ്റ് സ്മോക്ക് എം.എസ്സിന്റെ ഗതി മോശമാകുമെന്ന് പ്രതീക്ഷിക്കാം, കാരണം ഇത് Sirtuins (Caito et al., 2010) ന്റെ വിരുദ്ധ വിസർജ്ജന പ്രവർത്തനത്തെ തടയുന്നു. സിഗരറ്റ് പുകയാൽ ഉണ്ടാകുന്ന ഓക്സിഡേറ്റീവ്, കാർബോണിൾ സ്ട്രെസ് റെസ് വ്രാട്രോൾ (ലിയു, അൽഖുൻഎക്സ്, 2014) വഴി തിരിച്ചുവരുന്നു.

ആൽക്കഹോൾ ഉപഭോഗം (പ്രോമിനിക്കൽ)

സമീപകാല പഠനങ്ങൾ കാണിക്കുന്നത് മദ്യപാനം (ബിയർ, വൈൻ അല്ലെങ്കിൽ മദ്യം) ഉപഭോഗത്തിന് എംഎസ് റിസ്കിനു (മസാഡ et al., XED, ഹേഡ്സ്ട്രോം et al., XXX) ബന്ധപ്പെട്ടതല്ല. എന്നിരുന്നാലും, ചിത്രം 2013 ൽ കാണിച്ചിരിക്കുന്നതുപോലെ, മദ്യപാനം Sirtuin SIRT2014 എന്നതിനെ തടയുകയും SREBP-2c (നിങ്ങൾ ഞങ്ങളും പലതും, 1) ന്റെ ട്രാൻസ്ക്രിപ്ഷൻ പ്രവർത്തനം സജീവമാക്കുകയും ചെയ്യും, അങ്ങനെ ആൻറിഡിയൊയ്റ്റിക് മെറ്റബോളിസത്തിന്റെ ചെലവിൽ ലിപിഡുകളുടെയും വീക്കുകളുടെയും ജൈവസങ്കലനം പ്രോത്സാഹിപ്പിക്കുക.

എത്തനോളിന്റെ മറ്റ് രണ്ടു വശങ്ങളും പരിഗണനയിലുണ്ട്. ഒന്നാമതായി, എഥനോളിലെ രാസവിനിമയം എൻ.എ.ഡി.എ.യിലേക്ക് ധാരാളം NAD + തന്മാത്രകളെ പരിവർത്തിക്കുന്നു, ഇത് സേർർട്ടിനുകളുടെ പ്രവർത്തനത്തിന് ആവശ്യമായ NAD + ന്റെ പരിധിക്ക് പരിധി നൽകുന്നു. രണ്ടാമതായി, P450 എൻസൈമുകളുടെ ഒരു ഉപരിതലമായി എത്തനോൾ മരുന്നുകളുടെ ഉപാപചയവുമായി ഇടപെടുന്നു, അവ ഒരേ എൻസൈമുകളാൽ രൂപാന്തരപ്പെടുന്നു. ഇതിന്റെ ഫലം നീണ്ടതും മയക്കുമരുന്നുകളുടെ വർദ്ധനവുമാണ്. മൊത്തത്തിൽ, മദ്യം ഒരു രാസപദാർത്ഥമായി കണക്കാക്കപ്പെടുന്നു. ഇത് സാധാരണ മെറ്റബോളിസവുമായി ഇടപെടുന്നതും രോഗശമന പ്രക്രിയയെ സഹായിക്കുന്നു, രോഗിയുടെ ക്ഷേമത്തെ മെച്ചപ്പെടുത്താനുള്ള സാധ്യതയും സങ്കീർണ്ണമാക്കുന്നു.

കലോറി നിയന്ത്രണം (കോശജ്വലനം)

ഹൈ-കലോറി ഉപയോഗം, ഉത്തേജിത കാർബോഹൈഡ്രേറ്റ്സ്, പഞ്ചസാര വർദ്ധന ഇൻസുലിൻ അളവിൽ സമ്പന്നമായ ഭക്ഷണം എന്നിവ പ്രോത്ഫുമമിറ്റോ തന്മാത്രകളുടെയും ഫ്രീ റാഡിക്കലുകളുടെ ഉത്പാദനം ഉൾപ്പെടെയുള്ള ബയോസിന്തേശിസുകളെ പ്രോത്സാഹിപ്പിക്കുന്നു. ഭക്ഷണം കഴിക്കുന്നതിലൂടെയോ അല്ലെങ്കിൽ ഇടവിട്ടുള്ള ഉപവാസത്തോ കുറവോ ലഭിച്ചതോ ആയ കലോറി നിയന്ത്രണം (ഒരു ദിവസം മറ്റൊന്നുമില്ലാതെ), SIRT1 (ചാം et al., 2011) എന്ന നിലവാരത്തെ ഉയർത്തുന്നു. AMP- യുടെ നിലവാരം വർദ്ധിപ്പിക്കുകയും AMPK വർദ്ധിപ്പിക്കുകയും ചെയ്യുന്നു, വർദ്ധിപ്പിക്കൽ adiponectin നിലകൾ വർദ്ധിപ്പിക്കുകയും അല്ലെങ്കിൽ (ലീയും ക്വാക്കും, 2014) അതിന്റെ റിസീപ്റ്ററുകൾ സജീവമാക്കുക, ഓക്സിഡേറ്റീവ് കേടുപാടുകൾ, ലിംഫോസൈറ്റ് സജീവമാക്കൽ, MS (പിസിസി, കൂടാതെ, 2008, 2013) പരീക്ഷണ മോഡലുകളുടെ പുരോഗതി ഇല്ലാതാക്കുന്നു. ഒരേ ടാർഗെറ്റുകളിൽ പ്രവർത്തിക്കുമ്പോൾ, കലോറി നിയന്ത്രണം (agonists) (റെസ് വ്രാട്രോൾ, മറ്റ് പോളിഫീനോൽസ്) എന്നിവയെ മിശ്രണം ചെയ്യാൻ കഴിയും (SIRT1, AMPK).

ശാരീരിക വ്യായാമം (മയക്കുമരുന്ന് വിരുദ്ധം)

ശാരീരിക വ്യായാമം എം.എസ് രോഗികളെ സംബന്ധിച്ചിടത്തോളം ഏറെക്കുറെ സ്വീകരിച്ച ഒരു സമ്പ്രദായമാണ്. സാധാരണ ക്ഷീണം മൂലമുള്ള ലക്ഷണങ്ങൾ കുറയ്ക്കുന്നതിനും വൈകല്യത്തിൻറെ തുടക്കം തടയുന്നതിനും കുറയ്ക്കുന്നതിനും ഇത് പ്രയോഗിക്കുന്നു. എന്നാൽ വ്യായാമത്തിന്റെ പ്രാധാന്യം ലളിതമായ പേശികളുടെ പ്രവർത്തനങ്ങൾക്ക് അപ്പുറമാണ്. ഭക്ഷണ, വ്യായാമം, തെറാപ്പി, സാമൂഹിക കൈമാറ്റം എന്നിവയിൽ സമഗ്രമായ ഒരു പരിതഃസ്ഥിതിയിൽ മാത്രമേ ഇത് കണക്കിലെടുക്കാനാവൂ, എല്ലാ എംഎസ് രോഗികളുടെയും (ഗാക്കിയസ്, കാസക്സിയ, 2013).

മനുഷ്യന്റെ ദീർഘകാല രോഗങ്ങളെ വ്രണപ്പെടുത്തുന്നതിനോ തടയാനോ ലോകാരോഗ്യ സംഘടന (DNA) വഴി വ്യായാമവും വ്യായാമവും പ്രാക്ടീസ് ചെയ്യുന്നതാണ്.

ഒരു തന്മാത്രയിൽ നിന്ന്, ഫിസിക്കൽ വ്യായാമം പ്രോട്ടീൻ കീനേസ് എ എം പി കെ ആക്സിസും AMPK-Sirtuins-PPAR-δ ശൃംഖലയും, ഓക്സിഡേറ്റീവ് മെറ്റബോളിസത്തെ പരിപോഷിപ്പിക്കാനും, പുനർജ്ജീവിപ്പിക്കുന്ന ബയോസിന്തത്തിക് പാറ്റേണുകളും വീക്കം (നാർക്കർ et al., 2008) ഉം ഉപയോഗിച്ച് ഫലപ്രദമായി പ്രഭാവം നൽകുന്നു. ഊർജ്ജ ബാലൻസിൽ AMPK ഒരു പ്രധാന പങ്കു വഹിക്കുന്നത് പോലെ, അതിന്റെ അഗസ്റ്റോണിസ്റ്റുകളെക്കുറിച്ച് പരാമർശിക്കേണ്ടത് പ്രധാനമാണ്. 2 ടൈപ്പ് ഡയബറ്റീസിനുപയോഗിക്കുന്ന മയക്കുമരുന്ന് പോലുള്ള മെൻഡ്രോമിൻ, AMPK അഗസ്റ്റോണിസ്റ്റുകൾ തുടങ്ങിയവ ശാരീരിക പ്രവർത്തനങ്ങളുടെ ഫലമായി അനുകരിക്കുകയോ വർദ്ധിപ്പിക്കുകയോ ചെയ്യും. ഇത് പരീക്ഷണാത്മകമായ എൻസെഫലൈറ്റിസ് (നാത്ത്, അൽ -3, 2009) ഫലപ്രദമാണ്.

ശാരീരിക വ്യായാമം ജീവന്റെ നിലവാരത്തിൽ സ്വാധീനം ചെലുത്തുന്നു, അത് വിരുദ്ധ രസതന്ത്രം (ഫ്ലോറിഡൊ, 2014) ഉൽപ്പാദിപ്പിക്കാൻ കഴിയും. കൂടാതെ, ഫിസിക്കൽ വ്യായാമം ലെപ്റ്റിന്റെ പ്ലാസ്മയുടെ അളവ് കുറയ്ക്കുന്നു. ലെപ്റ്റിൻ റിസെപ്റ്ററുകൾ (Yasari et al., 2009) ലെ ജീൻ എക്സ്പ്രഷൻ, adiponectin levels ഉം adiponectin receptors പ്രവർത്തനം (ലീയും Kwak, 2014) വർദ്ധിപ്പിക്കും.

കലോറി നിയന്ത്രണവുമായി ശാരീരിക വ്യായാമത്തിൻറെ അസോസിയേഷൻ ഗണ്യമായി കുറയ്ക്കുന്നതിന് കാരണമാകും (റീഡ് മറ്റുള്ളവരും, 2010).

മുതിർന്ന C57BL / 6 ജെ ആണവനിലയത്തിൽ നടത്തിയ അടുത്തിടെയുള്ള പഠനങ്ങൾ കാണിക്കുന്നത് മസ്തിഷ്ക മൈറ്റോകോൺട്രിറിയൽ പ്രവർത്തനം, potentiate neuroplasticity, potentiate neuroplasticity, മാനസിക വളർച്ച മെച്ചപ്പെടുത്തുന്നു, കാരണം ഇത് തുറന്ന വയലിൽ ഉത്കണ്ഠ പോലുള്ള പെരുമാറ്റങ്ങൾ കുറയുകയും വാൽ ആന്റിഡിപ്രസന്റ് പോലെയുള്ള പ്രഭാവം വർദ്ധിപ്പിക്കുകയും ചെയ്യുന്നു. സസ്പെൻഷൻ ടെസ്റ്റ് (അഗ്യൂയർ et al., 2014). എലികളിൽ നടത്തിയ മറ്റ് പഠനങ്ങളിൽ വ്യായാമം ഗട്ട് ബാക്ടീരിയയുടെ ഘടനയും വൈവിധ്യവും മാറ്റാൻ സഹായിക്കുമെന്ന് കാണിച്ചു തരുന്നു. (പെറ്റ്രിസ് et al., 2014).

ഈ കാരണങ്ങളാൽ, പുനരധിവാസ പരിപാടിയിൽ സാധ്യമെങ്കിൽ എം എസ് രോഗികൾക്ക് ശാരീരികമായ വ്യായാമങ്ങൾ നടത്താം (ബ്രൈക് നടത്തം, നീന്തൽ അല്ലെങ്കിൽ നൃത്തം).

എം.എസ്. സോറിലുള്ള പോഷകാഹാര ചികിത്സാ വിചാരണകൾ

നിർഭാഗ്യവശാൽ, MS ലെ പോഷകാഹാര ക്ലിനിക്കൽ പരീക്ഷണങ്ങൾ വളരെ കുറവാണ്. അവയിൽ ചിലത് സപ്ലിമെന്റ്സ് (സ്വങ്ക് ആൻഡ് ഗുഡ്വിൻ, 2003) അല്ലെങ്കിൽ ഒമേഗ-എൻഎക്സ്എക്സ് കൊഴുപ്പ് സപ്ലിമെൻറുകൾ (നഡ്വിക്, പലരും, വെൻസ്റ്റോക്ക്-ഗട്ട്മാൻ തുടങ്ങിയവരും) കൂടാതെ കുറഞ്ഞ അളവിലുള്ള ഭക്ഷണം കൊഴുപ്പിന്റെ അളവ് അടിസ്ഥാനമാക്കിയുള്ളതാണ്. വൈറ്റമിൻ ഡി, അല്ലെങ്കിൽ മീൻ ഓയിൽ (n-3 PUFA), അല്ലെങ്കിൽ ലിപ്പോയിക് ആസിഡ് എന്നിവ മാത്രമായിരുന്നു സിംഗിൾ ഡയറി സപ്ളിമെന്റുകളുടെ അടിസ്ഥാനത്തിലുള്ളത്. സിംഗിൾ പോളിഫിനോൾസിനുണ്ടായിരുന്ന ക്ലിനിക്കൽ ടെസ്റ്റുകൾ ക്യാൻസറിൽ മാത്രമാണ് നടപ്പിലാക്കിയത്. ഭക്ഷണ ശീലങ്ങൾ ഒരുമിച്ച് ഉപയോഗിച്ചിട്ടില്ലാത്തതിനാൽ ഒരിക്കലും ഭക്ഷണ കുറിപ്പുമായി ബന്ധപ്പെടുത്തിയിട്ടില്ല.

ഒന്നിച്ചുചേർന്നത്, എം.എസ്. പോഷകാഹാരത്തിൻറെ പങ്കിനേക്കുറിച്ച് വ്യക്തമാക്കുന്നതിനുള്ള ക്ലിനിക്കൽ ശ്രമങ്ങൾ, മോശം ഗുണനിലവാരത്തെക്കുറിച്ചോ, കൃത്യമായ ഫലങ്ങൾക്കോ ​​(ഫരിനോട്ടി et al. പ്രത്യേകിച്ച്, Farinotti et al. അവരുടെ കൊക്രൻ റിവ്യൂയിൽ (2007), എൻ.എൻ.എൻ.എൻ. പ്യുഎഫ്എ പോലുള്ള അനുബന്ധ ഘടകങ്ങൾ എം.എസ്. ലെ പ്രധാന ചികിത്സയുടെ ഫലങ്ങളിൽ വലിയ സ്വാധീനം ചെലുത്തുന്നതായി തോന്നുന്നില്ല. PUFA അനുബന്ധത്തിൽ നിന്നും ഒരു യഥാർത്ഥ ഫലം വിലയിരുത്തുന്നതിന് ലഭ്യമായ വിവരങ്ങൾ അപര്യാപ്തമാണ് അല്ലെങ്കിൽ നിശ്ചയദാർഢ്യത്തോടെ കണക്കാക്കപ്പെട്ടു. ചില പഠനങ്ങളിൽ, ഒമേഗ -303 ഫാറ്റി ആസിഡുകളുമായി താരതമ്യപ്പെടുത്തുമ്പോൾ ചെറിയ ചില സാധ്യതകൾ കണ്ടെത്തിയിട്ടുണ്ട്. സാധാരണയായി, ട്രയൽ നിലവാരത്തെ പാവപ്പെട്ടതായി കണ്ടെത്തി. പ്രധാനമായും ക്ലിനിക്കൽ ഫലങ്ങളുടെ അഭാവം മൂലം അർഹത മാനദണ്ഡങ്ങൾ പാലിക്കാത്തതിനാൽ വിറ്റാമിൻ അനുബന്ധനത്തിലെ പഠനങ്ങൾ വിശകലനം ചെയ്തില്ല. അതിനാൽ, വൈറ്റമിൻ സപ്ലിമെന്റേഷൻ, എം.എസ്. ലെ ആൻറിഓക്സിഡൻഷ്യൽ സ ദായം ​​എന്നിവയുടെ ആനുകൂല്യങ്ങളും അപകടസാധ്യതയും സംബന്ധിച്ച തെളിവുകൾ കുറവാണ്.

നിർദ്ദേശങ്ങൾ പോഷകാഹാരത്തിനുള്ള ഒരു ഇടവേളയിൽ MS: ദി ചോയിസ് ഓഫ് ഡയറ്റ് ആൻഡ് ഡയറ്ററി സപ്ലിമെന്റുകൾ

അവസാനം, MS ലെ പോഷകാഹാര ഇടപെടലിന്റെ ലക്ഷണം വീക്കം നിയന്ത്രിക്കേണ്ടതാണ്. ഈ അവലോകനത്തിൽ കാണിച്ചിരിക്കുന്നതുപോലെ, പ്രധാനമായും പ്രഭാതശക്തിയെ നിയന്ത്രിക്കുന്നതും, കുടൽ സൂക്ഷ്മജീവികൾ, കുടൽ, സിസ്റ്റൈറ്റിക് വീക്കം, പ്രതിരോധശേഷി എന്നിവയെ നിയന്ത്രിക്കാനും കഴിയും. ഇത് ഒരു ദീർഘകാല ആഹാര ശീലം, ഒരു ഹൈപ്പോകോരിക ഭക്ഷണക്രമം, പ്രീബയോട്ടിക്സ്, പ്രോബയോട്ടിക്സ്, ഭക്ഷണ ശീലങ്ങൾ എന്നിവയിലൂടെ നേടാം.

ഈ ലേഖനത്തിൽ റിപ്പോർട്ടു ചെയ്തിരിക്കുന്നതുപോലെ, ആരോഗ്യകരമായ ഭക്ഷണ തന്മാത്രകൾ, കലോറി നിയന്ത്രണം, വ്യായാമം എന്നിവ കാർബോബിളിസത്തിലേക്ക് നയിക്കുന്ന സെൽ മെറ്റബോളിസത്തെ നേരിട്ട് നയിക്കുന്നു, പ്രത്യേക എൻസൈമുകൾ, ആണവ റിസപ്റ്ററുകൾ, ട്രാൻസ്ക്രിപ്ഷണൽ ഘടകങ്ങൾ എന്നിവയുമായി വിവിധ തലങ്ങളിൽ ഇടപെടുന്നതിലൂടെ അനായാസം ആൻഡ് വീക്കം കുറയ്ക്കാൻ കഴിയും. കൂടാതെ, ഫൈബറുമായി സഹകരിച്ച്, അവർക്ക് കുടൽ ഡിസ്ബിയൊസിസ് രോഗപ്രതിരോധ മരുന്നായി മാറാൻ കഴിയും.

ഫലമായി, പച്ചക്കറികൾ, മുഴുവൻ ധാന്യങ്ങൾ, പയർവർഗങ്ങൾ, പഴങ്ങൾ, മത്സ്യം എന്നിവ അടിസ്ഥാനമാക്കിയുള്ള കുറഞ്ഞ കലോറി ഭക്ഷണം (1,600-83 കിലോ കലോറി), രോഗികളുടെ വളർച്ചയെ മന്ദീഭവിപ്പിക്കുകയും, എം.എസ്. രോഗികളുടെ ക്ഷേമത്തെ മെച്ചപ്പെടുത്തുകയും, ഹൈപ്പർ കലോറിക് ഡയറ്റുകളും ഉപ്പ്, പൂരിത മൃഗങ്ങളെ കൊഴുപ്പ്, വറുത്ത ആഹാരം, പഞ്ചസാര-മധുരമുള്ള പാനീയങ്ങൾ എന്നിവ പോസ്റ്റ്പാൻഡിയൽ വീക്കം, സിസ്റ്റമാറ്റിക് കുറഞ്ഞ ഗ്രേഡ് വീക്കം എന്നിവയിലേയ്ക്ക് നയിച്ചേക്കാം.

പ്രീബയോട്ടിക്സ്, പ്രോബയോട്ടിക്സ്, പ്രത്യേക വിറ്റാമിനുകൾ (ഡി, എ, ബിഎക്സ്എൻഎക്സ്, നിക്കോട്ടിനിക് ആസിഡ്), ഒളിഗോലെമെന്റ്സ് (മഗ്നീഷ്യം, സെലിനിയം), പോളീനോനോൾസ്, എൻ- എൻ.എൻ.എക്സ്.എഫ്.എഫ്.എ, ലിപ്പോയിക് ആസിഡ് തുടങ്ങിയ പോഷകഗുണങ്ങളും ഭക്ഷണമായി സംയോജിപ്പിക്കേണ്ടതാണ്.

ഇൻസുലിൻ, തവിട്, ലാക്പോസ്കുറോസ്, ഒലിഗുഫ്റോക്രോസ്, കൊളോനോസൈറ്റുകളുടെ മുൻഗണന പോഷകങ്ങൾ, എൻഎഫ്- കെബി പ്രവർത്തനരഹിതമാക്കാനുള്ള ശേഷിയുണ്ടാകണം MS എന്ന പ്രീബയോട്ടിക്സ്. കുടൽ മൈക്രോബയോട്ടത്തിന്റെ ഘടന മാറ്റാൻ ഉപയോഗിക്കാവുന്ന ലാക്ക്കോകോളസ് ലാക്റ്റിസ്, ബീജിയോടൈബറിനിയം ലാക്റ്റിസ്, ക്ലോസ്റ്റീരിയം ബ്യൂട്ടറിക് മുതലായ പ്രോബയോട്ടിക്സ് ഉപയോഗിക്കാം. പ്രീബയോട്ടിക്സ്, പ്രോബയോട്ടിക്സ് എന്നിവയുടെ സംയോജനമാണ് ഉത്തമം. കുടൽ ചുമതലകളും ഭാരം എപ്പോഴും നിയന്ത്രണം ആയിരിക്കണം.

ഗ്യൂട്ട് എബ്യൂസിസ് പുനരുജ്ജീവിപ്പിക്കുവാനുള്ള കൂടുതൽ കഠിനമായ ചികിത്സാരീതിയും മയക്കുമരുന്ന് വീക്കം കുറയ്ക്കുന്നതുമെങ്ങിലും സൂക്ഷ്മ മൈക്രോബയോ ട്രാൻസ്പ്ലാൻറേഷനിൽ (FMT, സ്മിറ്റ്സ് et al., 2013) പ്രതിനിധാനം ചെയ്യാവുന്നതാണ്. ഈ രീതി വളരെ ഫലപ്രദമാണെങ്കിലും ഇപ്പോഴും പ്രാധാന്യം അർഹിക്കുന്നു, തികച്ചും സുരക്ഷിതമല്ല, ഒരു വിധത്തിലും വെറുപ്പുളവാക്കുന്നു. ഈ ഫീൽഡ് ഫെൽക്കർ ട്രാൻസ്പ്ലാൻറുകളേക്കാൾ കൂടുതൽ നീങ്ങണം, ഒരു പ്രത്യേക അവസ്ഥയ്ക്ക് അത്യാവശ്യമായിരിക്കുന്ന ജീവികളെ തിരിച്ചറിയുകയും, എഫ്ടിടി ("ഗ്യാസ്ട്രോഎൻറോളജി ആൻഡ് ഹെപ്പാറ്റോളജിയിലെ ക്രിട്ടിക്കൽ വ്യൂകൾ", 2014) എന്നതിനേക്കാൾ വളരെ ലളിതമായി ആ ജീവികൾ ലഭ്യമാക്കുകയും വേണം.

ശരീരത്തിലെ സാധാരണ ഘടകങ്ങളായ ഒമേഗ-എൻഎക്സ്എക്സ് പി.എഫ്.എ ഒഴികെയുള്ള ഡയറ്ററി അനുബന്ധങ്ങൾ പോഷകാഹാര ഇടപെടൽ ആരംഭത്തിൽ അല്ലെങ്കിൽ ആരോഗ്യപ്രശ്നത്തിന്റെ സുഖം സുഗമമാക്കുന്നതിന്, പുനരാവിഷ്കരണ ഘട്ടത്തിൽ ഉപയോഗപ്രദമാണ്, എന്നാൽ അവരുടെ ഉപയോഗം ഒരു പരിമിത കാലയളവിലേക്ക് മാത്രമായി പരിമിതപ്പെടുത്തിയിരിക്കണം (3 - 3 മാസങ്ങൾ). ഇത് പോളിഫിനുകൾക്ക് പ്രത്യേകിച്ച് സാധുവാണ്. പോളിഫെനോൽസ് തങ്ങളുടെ ജൈവാവശിഷ്ടം, അവയുടെ ജൈവ ഇഫക്റ്റുകൾ എന്നിവയെ സംബന്ധിച്ചുള്ള അറിയപ്പെടുന്ന തന്മാത്രകളല്ല, പ്രത്യേക ഭക്ഷണരീതികൾ അവരുമായി കൂട്ടിച്ചേർത്ത് ഉപയോഗിക്കേണ്ടതാണ്. ഒരു വശത്ത്, അവർ കോശജ്വലന പ്രക്രിയകളിലൂടെ പ്രോയിന്ഫ്രാമിയറി തന്മാത്രകളുടെ സിന്തസിസിനെ തരംതാഴ്ത്തുക; മറുവശത്ത്, സെല്ലുകൾ വിശ്രമിക്കുന്നതിൽ സെൽ പ്രവർത്തനം ഉത്തേജിപ്പിക്കാൻ കഴിയും, എന്നാൽ സ്ഥിരമായ ഉത്തേജനം ആരോഗ്യകരമായ കോശങ്ങളുടെ അപ്പോപ്പോസിസിസിനെ പ്രേരിപ്പിക്കും. ഒരുമിച്ച് കണക്കാക്കുന്നത്, ശുദ്ധീകരിക്കപ്പെട്ട പോളിഫീനോൾസ് നിർവഹണം പ്രാഥമികചികിത്സ പരിശോധനകൾ അടിസ്ഥാനമാക്കി, അവരുടെ ഫലപ്രാപ്തിയെ പരിശോധിക്കുക, അവരുടെ ദീർഘകാല സുരക്ഷിതത്വവും ശരിയായ അളവും നിർണ്ണയിക്കുക.

സാധാരണഗതിയിൽ, വിരുദ്ധ രൂക്ഷമായ ഭക്ഷണങ്ങളും ഭക്ഷണ ശീലങ്ങളും ഉള്ള പോഷകാഹാര ഇടപെടലുകൾ പ്രോൻഫ്ളാംമിറ്ററി സംയുക്തങ്ങളുടെ ജൈവസങ്കലനം കുറയുകയും അതുമൂലം രോഗപ്രതിരോധ ശേഷി കുറയ്ക്കുന്ന മരുന്നുകളുടെ ഉപയോഗം കൂടുതൽ ഫലപ്രദമാവുകയും തുടർന്ന് ക്രയോൺ ക്ഷീണം രോഗിയുടെ ലക്ഷണങ്ങളെ ലഘൂകരിക്കുകയും, ക്ഷമയോടെ കാത്തിരിക്കുക. എന്നിരുന്നാലും, ഭക്ഷണങ്ങളും ഭക്ഷണ ശീലങ്ങളും മരുന്നായി കണക്കാക്കാനും ചികിത്സയുടെ പകരക്കാരനായി ഉപയോഗിക്കാനും പാടില്ല. അതുപോലെ, പ്രോൻഫാംമാറ്റിറ്ററിറ്റി ഭക്ഷണം വിഷമായില്ല, അത് പൂർണ്ണമായും ഒഴിവാക്കേണ്ടതില്ല. നിങ്ങൾ ആരോഗ്യകരമായ ഒരു അവസ്ഥയിൽ ആണെങ്കിൽ നിങ്ങൾക്ക് റിസ്ക് അല്ലെങ്കിൽ കുറ്റബോധമില്ലാത്ത ഒരു നല്ല സ്റ്റീക്ക് അല്ലെങ്കിൽ വറുത്ത ആഹാരം കഴിക്കാം. ദീർഘകാലാടിസ്ഥാനത്തിലുള്ള തെറ്റായ ഭക്ഷണ ശീലങ്ങൾ എന്തൊക്കെയാണ്?

ഡോ ജിമനെസ് വൈറ്റ് കോട്ട്

മൾട്ടിപ്പിൾ സ്ക്ലിറോസിസ് അഥവാ എം.എസ്., ദീർഘകാലത്തെ പുരോഗമന ലക്ഷണമാണ്. ആരോഗ്യപ്രശ്നങ്ങളുടെ ക്ലിനിക്കൽ പദപ്രയോഗത്തിൽ പല ഘടകങ്ങളും പലപ്പോഴും ഉൾപ്പെട്ടിട്ടുണ്ടെന്ന് എം എസ്സിന്റെ രോഗസാദ്ധ്യത തെളിയിക്കുന്നു. എങ്കിലും, നിരവധി ഗവേഷണ പഠനങ്ങൾ പ്രാഥമികമായി ഒന്നിലധികം സ്ക്ലിറോസിസ് വികസനം ന് ഭക്ഷണത്തിന്റെ പങ്ക് വിശകലനം ചെയ്തിരിക്കുന്നു. മൾട്ടിപ്പിൾ സ്ക്ലിറോസിസ് രോഗികളിലെ ഡയറി ഉപഭോഗം തമ്മിലുള്ള പരസ്പര ബന്ധമുണ്ടെന്ന് നിരവധി വർഷങ്ങളായി ആരോഗ്യപരിപാലന പ്രൊഫഷണലുകൾ വിശ്വസിച്ചിരുന്നു. വിവിധ ഗവേഷണ പഠനങ്ങൾ പ്രകാരം, പശുവിന്റെയും മൾട്ടിപ്പിൾ സ്ക്ലിറോസിസ് ബാധകളുടെയും ഇടക്കുള്ള ഒരു വലിയ പരസ്പരബന്ധം കണ്ടെത്തിയത്, MS ന്റെ മൾട്ടിഫാക്ടോറിയൽ ഇഡിക്കോളജിയിൽ പാൽ ഉത്പന്നങ്ങളുടെ പങ്കാളിത്തം നിർദേശിക്കുന്നു. ഡോ. അലക്സ് ജിമനേസ് DC, CCST

നിഗമനങ്ങളിലേക്ക്

അപ്പോൾ, ഒറ്റനോട്ടത്തിൽ, വിട്ടുമാറാത്ത രോഗാതുരമായ രോഗങ്ങളുടെ സ്വഭാവസവിശേഷതകൾ MS ലെന് തോന്നുന്നില്ല, അത് തെറ്റായ ആഹാര ശീലം, ജീവിതശൈലി, അല്ലെങ്കിൽ ഡിസ്ബിയൈറ്റിക് ഗട്ട് മൈക്രോബയോട്ട എന്നിവയുമായി ബന്ധപ്പെട്ടതാണ്. ഭക്ഷണം അല്ലെങ്കിൽ കുടൽ മൈക്രോബാറ്റയുടെ അവസ്ഥയുമായി ബന്ധപ്പെട്ടിരിക്കുന്ന രോഗത്തിൻറെ വർദ്ധനവിൽ ഒന്നുമില്ല. വാസ്തവത്തിൽ, MS യിൽ പോഷകാഹാര സ്വാധീനത്തെക്കുറിച്ച് ഞങ്ങൾ പഠനത്തിന് തുടങ്ങിയപ്പോൾ, അവ തമ്മിൽ ഒരു യഥാർത്ഥ ബന്ധം നിലനിൽക്കാൻ കഴിയുമെന്നതിന്റെ ചെറിയൊരു തെളിവുപോലുമുണ്ടായിരുന്നില്ല. എം.എസ്. ലെ സൂക്ഷ്മചക്രികയുടെ ഉൾപ്പെടുത്തൽ എന്ന ആശയം വളരെ ഊഹക്കച്ചവടമാണ്. ഇന്നുവരെ, ഭക്ഷണശീലങ്ങൾ എം എസ്സിന്റെ സ്വാധീനത്തെ സ്വാധീനിക്കുന്ന ആശയം ഇപ്പോഴും സ്വയം സ്ഥാപിക്കാൻ പ്രയാസകരമാണ്. അങ്ങനെയല്ല ഭക്ഷണ ശീലങ്ങളുടെ സ്വാധീനം ഏതാണ്ട് സ്വീകരിച്ചിട്ടുള്ളതും, കൂടുതൽ വികേന്ദ്രീകൃതമായ ഒരു ഉപാപചയത്തിലും (സെഫീരിഡ് മറ്റുള്ളവരും, 2014) ആയി കണക്കാക്കപ്പെടുന്ന കാൻസറിലാണെങ്കിലും, മറ്റ് പല രോഗശമനത്തിന് കാരണമാകുന്നത് ഹൃദ്രോഗം, രോഗം എന്നിവയാണ്.

നിലവിൽ, എംഎസ് തെറാപ്പി ഏതെങ്കിലും പ്രത്യേക ഭക്ഷണവുമായി ബന്ധപ്പെട്ടതല്ല, കാരണം രോഗത്തിന്റെ പോഷകാഹാരത്തെക്കുറിച്ച് അറിവില്ലായ്മ കാരണം. എന്നിരുന്നാലും, എം എസ്സിലെ ഭൂരിഭാഗം രോഗികളും പരഗ്നാത്മകവും ഇതര ചികിത്സാരീതികളും (കാം) തിരയുന്നു, പ്രത്യേകിച്ച് ഡോക്ടറുടെ ഉപദേശം കൂടാതെ മിക്കവാറും ഭക്ഷണ ശീലങ്ങൾ മാറ്റാൻ ശ്രമിക്കുന്നു (സ്ക്വാർസ് et al., 83, leong et al., 2008 ). അവരുടെ ഭക്ഷണശൈലിയിലെ ഒരു ചോദ്യാവലിയിൽ എം.എസ്. രോഗികൾക്ക് നൽകുന്ന ഡാറ്റയെ അടിസ്ഥാനമാക്കിയുള്ള ഒരു സമീപകാല പഠനഫലം ആരോഗ്യകരമായ മാനസികാരോഗ്യ ഘടകങ്ങളെ മികച്ച ശാരീരികവും മാനസികവുമായ ആരോഗ്യവുമായി ബന്ധപ്പെട്ട ജീവിത നിലവാരവും വൈകല്യത്തിൻറെ താഴ്ന്ന നിലവാരവും (ഹട്ഗ്കിസ് എറ്റ് ., 2009). എം എസ് ഉൾപ്പെടെയുള്ള പോഷകാഹാര ഇടപെടലിന്റെ ക്രമരഹിതമായ നിയന്ത്രിത പരീക്ഷണങ്ങളുടെ ആവശ്യകതയെ ഈ ദൌത്യത്തെ ശക്തിപ്പെടുത്തുന്നു. പോഷകാഹാര ചികിത്സകൾ പരസ്പരപൂരകങ്ങളായിരിക്കണം, എന്നാൽ ചികിത്സയ്ക്കു പകരം ബദലല്ല, ഇത് ഒരു ഹോളിസ്റ്റിക് സമീപനത്തിന്റെ ഭാഗമായിരിക്കുകയും, മെഡിക്കൽ നിയന്ത്രണത്തിൻ കീഴിൽ നടത്തപ്പെടുകയും വേണം.

ഇതുവരെ ക്ലിനിക്കൽ പരീക്ഷകളിൽ നിന്നും ഒരു വിവരവും ലഭ്യമല്ല എന്നതിനാൽ, നമ്മുടെ പ്രവർത്തനം, തന്മാത്രാ തലത്തിൽ ഭക്ഷണ വസ്തുക്കളുടെയും ജീവിതശൈലികളുടെയും അറിയപ്പെടുന്നതും സ്ഥാപിച്ചതുമായ പ്രഭാവത്തിൻറെ അടിസ്ഥാനത്തിൽ ഭക്ഷണ സാധ്യതകളെ യുക്തിസഹമാക്കുക എന്നതാണ്. ചിത്രം 2 ൽ രേഖപ്പെടുത്തിയ ഡാറ്റ പൂർണ്ണമായും പൂർത്തിയായിട്ടില്ല എന്നാൽ പോഷക ഇടപെടലുകൾക്കായുള്ള മാർഗ്ഗനിർദ്ദേശങ്ങൾ നൽകാൻ സഹായകമാകും. തത്വത്തിൽ, proinflammatory ഭക്ഷണ വലതുഭാഗത്തും ചിത്രം 2 ചുവടെ കാണിച്ചിരിക്കുന്ന പോലെ biosynthetic ആൻഡ് വീക്കം വഴികൾ, ആധിപത്യം, ആന്റി-വീക്കം ഭക്ഷണവും ഓക്സിഡേറ്റീവ് മെറ്റബോളിസം upregulates അതേസമയം അനായാസവും വീക്കം കുറച്ചു.

ഈ ലേഖനത്തിൽ കാണിച്ചിരിക്കുന്നതുപോലെ കലോറി നിയന്ത്രണം, വ്യായാമം, പ്രത്യേക ഭക്ഷണക്രമ ഘടകങ്ങൾ എന്നിവ സെല്ലുലാർ മെറ്റബോളിസത്തിൽ (ചിത്രം 2) പ്രവർത്തിക്കുകയും, ഗട്ട് സൂക്ഷ്മജീവിയുടെ ഘടന (ചിത്രം 5) എന്ന ഘടനയെ സ്വാധീനിക്കുകയും ചെയ്യുന്നുവെന്ന് മനസ്സിലാക്കുന്നതിലൂടെ ഉചിതമായ പോഷകാഹാര ഇടപെടൽ രോഗത്തിന്റെ ഗതിവിഗതികൾ മെച്ചപ്പെടുത്തും, അതുകൊണ്ട് MS ലെ സാധ്യമായ ചികിത്സാകേന്ദ്രമായി കണക്കാക്കാവുന്നതാണ്. RRMS, PPMS എന്നിവയിൽ വീക്കം ഉണ്ടാകുന്നത് പോലെ, പോഷകാഹാര ഉപവിഭാഗങ്ങൾ രോഗത്തിന്റെ രണ്ട് രൂപങ്ങൾക്കും സൂചിപ്പിക്കുന്നു. PPMS കേസിൽ ഇത് വളരെ പ്രധാനമാണ്, അത് ഇപ്പോൾ സൌജന്യമായി ലഭ്യമല്ല. അതുപോലെ, പ്രത്യേക ആഹാര ശീലം പോലെ തന്നെ ഹാനികരമായതും താഴ്ന്ന നിലവാരത്തിലുള്ള വീഴ്ചയുടെ ദീർഘവും നിലനില്ക്കുന്നതുമായേക്കാം, ഒരു തെറ്റായ ഭക്ഷണക്രമം MS ലെ വിശ്രമത്തിനു കാരണമായ ഘടകമായി കണക്കാക്കാം.

സെൽ മെറ്റബോളിസത്തിലും ഗുട്ട് മൈക്രോബയോട്ടയിലുമുള്ള രോഗത്തിൻറെ സാധ്യതയും, രോഗത്തെ സംബന്ധിച്ചുളള സാദ്ധ്യതയെ കുറിച്ചും ഉള്ള പ്രാധാന്യം നമുക്ക് ഇപ്പോൾ മനസ്സിലാക്കിയിട്ടുണ്ട്. പക്ഷേ, പോഷകാഹാരത്തിൻറെയും ഗുരുത്വാകർഷണത്തിൻറെയും പങ്ക് മനസ്സിലാക്കാൻ മാത്രമായിരുന്നു ഞങ്ങൾ. എംഎസ്യിലും ഹോസ്റ്റിന്റെ രോഗപ്രതിരോധ സംവിധാനത്തിലൂടെയും, പ്രത്യേകിച്ച് കുടൽ വിദൂര സ്ഥലങ്ങളിൽ, ഗട്ട് മൈക്രോബാറ്റയുടെ പരസ്പര വ്യവഹാര സ്വഭാവം കണക്കിലെടുത്തും വളരെയേറെ പ്രവർത്തനങ്ങളുണ്ട്.

ഈ അടിസ്ഥാനത്തിൽ, എംഎസ് ഗവേഷണത്തിലെ ഭാവിയിലെ ഭാവി താഴെപ്പറയുന്ന കാര്യങ്ങൾ പരിഗണിക്കും: (എ) ഗട്ട് സൂക്ഷ്മതല ഘടന വിലയിരുത്തുക; (ബി) കുടൽ പ്രതിരോധ സംവിധാനത്തിൽ വൈകല്യങ്ങൾ വിലയിരുത്തുക; (സി) പോളിഫിനോൾസ്, വൈറ്റമിൻ ഡി മെറ്റബോളിസത്തിന്റെ പങ്ക് വ്യക്തമാക്കുക; (ഡി) AMPK, Sirtuins, PPAR, അല്ലെങ്കിൽ നേരിട്ട് NF-kB എന്നിവയിൽ ആഹാര ഘടകങ്ങൾ, പച്ചമരുന്നുകൾ, മരുന്നുകൾ എന്നിവയുടെ സ്വാധീനം പഠിക്കുക. PPAR-γ അഗണിസ്റ്റുകൾ thiazolidinediones (Bernardo et al., 2009), AMPK അഗസ്റ്റോണിസ്റ്റ് മെറ്റ്ഫോർമിൻ (നാഥ് et al., 2009) തുടങ്ങിയ തരം II പ്രമേഹം ചികിത്സിക്കാൻ ചില മരുന്നുകൾ ഉപയോഗിച്ചിരുന്നു. ആന്റി-വീക്കം തടയുന്ന ഘടകങ്ങൾ; (ഇ) ഭക്ഷണ ശീലങ്ങളും എംഎസ് മരുന്നുകളും തമ്മിലുള്ള സാധ്യമായ ഇടപെടലുകൾ നിർവചിക്കുക; (എഫ്) രോഗചികിത്സയിൽ ആരോഗ്യകരമായ ഭക്ഷണരീതി പിന്തുടരാനുള്ള പ്രാധാന്യം പഠിക്കുന്നതിനായി ഒരു പ്രചരണത്തെ പ്രോത്സാഹിപ്പിക്കുക, ഉദാഹരണത്തിന്, രോഗികളിൽ നാരുകൾ അല്ലെങ്കിൽ സങ്കീർണ്ണ കാർബോ ഹൈഡ്രേറ്റുകൾ ഉൾപ്പെടുത്തി പ്രോബയോജിംഗുകൾ പ്രോബയോട്ടിംഗും പ്രോബയോട്ടിക്സുമായി കൂട്ടിച്ചേർത്ത്, പ്രോ-ഫിൽമിമിറ്ററി n-3 കൊഴുപ്പുകളെ , മാംസം, മൃഗസംവിധാന ഉപയോഗം എന്നിവ പരിമിതപ്പെടുത്തുന്നു. മുളീ കാറ്റ്സൻ (6) വിവരിച്ചതുപോലുള്ള നല്ല പാചകവിധികളുടെ തിരഞ്ഞെടുക്കൽ, ഭക്ഷണത്തെ കൂടുതൽ സ്വീകാര്യമാക്കാം.

മൊത്തത്തിൽ, പ്രതിരോധ-മോഡുലറായ പരമ്പരാഗത എംഎസ് തെറാപ്പികൾ വിജയിച്ചിട്ടുണ്ട്; എന്നിരുന്നാലും, അറ്റകുറ്റപ്പണികൾ സുരക്ഷിതമായി സൂക്ഷിക്കാൻ കഴിയുന്ന മരുന്നുകൾ ഇപ്പോഴും കാണുന്നില്ല. പോഷകാഹാര മാർഗ്ഗനിർദ്ദേശങ്ങളും ശാരീരിക പ്രവർത്തന അവസരങ്ങളും നൽകിക്കൊണ്ട് ആളുകൾക്ക് ആരോഗ്യത്തോടെ തുടരാൻ ഞങ്ങളെ സഹായിക്കാൻ കഴിയും. നിമിഷ നേരംകൊണ്ട്, എം എസ്സുള്ള രോഗികളുടെ ക്ഷേമത്തിനായി മാത്രം നല്ല പ്രതീക്ഷകൾ ഉണ്ട്. ഞങ്ങൾ കഥയുടെ തുടക്കത്തിൽ മാത്രമാണ്.

ചുരുക്കം

മന്ദഗതിയിലായ MS- ഉം പ്രാഥമിക പുരോഗമന MS- ഉം രൂക്ഷമായ രോഗങ്ങൾ ആയതിനാൽ, സെൽ മെറ്റബോളിസവും ഗോട് മൈക്രോബയോട്ടയുമൊക്കെയുള്ള അവരുടെ പ്രവർത്തനത്തിലൂടെ പ്രോൻഫ്ലാമ്മററി അല്ലെങ്കിൽ ആന്റി-വീക്കം ദഹനവ്യവസ്ഥയും ജീവിതശൈലിയും സ്വാധീനിക്കാനാകും. എം.എസ്. രോഗികൾക്ക് പോഷകാഹാരം നൽകുന്നത് നല്ലതാണ്.

വൈരുദ്ധ്യമുള്ള താൽപ്പര്യങ്ങളുടെ പ്രഖ്യാപനം

ഈ ലേഖനത്തിന്റെ ഗവേഷണത്തിനും ഉടമസ്ഥതയ്ക്കും അല്ലെങ്കിൽ പ്രസിദ്ധീകരിക്കലിനും ഉത്തരവാദിത്തമുണ്ടായിരുന്നില്ലെന്ന് എഴുത്തുകാർ പ്രഖ്യാപിച്ചു.

ഫണ്ടിംഗ്

ഗവേഷണം, രചയിതാവ്, കൂടാതെ / അല്ലെങ്കിൽ ഈ ലേഖനത്തിന്റെ പ്രസിദ്ധീകരണത്തിനുവേണ്ടിയുള്ള സാമ്പത്തിക പിന്തുണയുടെ രചയിതാവിന് രചയിതാക്കൾ വെളിപ്പെടുത്തി: ഈ പ്രോജക്ടിനെ പ്രോജക്ട് "ആരോഗ്യവാനായ" എന്ന പദ്ധതിക്കായി 2007 / R / 15 ൽ നൽകിയിട്ടുള്ള മൾട്ടിപ്പിൾ സ്ക്ലിറോസിസ് (FISM) മൾട്ടിപ്പിൾ സ്ക്ലിറോസിസ് ലെ പോഷകാഹാര ഇടപെടലിനുള്ള മോളിക്യുലർ ബേസിസ്, "പ്രോജക്ടിനായി 2010 / R / 35 പ്രോജക്ടിനുള്ള പ്രോസ്പെക്റ്റീവ് ഫുഡുകൾ," പ്രോജക്ടിനായുള്ള "മൾട്ടിപ്പിൾ സ്ക്ലിറോസിസ് പോഷകാഹാര വസ്തുതകൾ: എന്തുകൊണ്ട് അവർ പിആർ-ൽ പ്രാധാന്യം അർഹിക്കുന്നു

വിവിധ ഗവേഷണ പഠനങ്ങൾ എം.എസ്, പാല്, പ്രത്യേകിച്ച് പശുവിന്റെ പാലു തമ്മിലുള്ള ഉയർന്ന പരസ്പരബന്ധം തെളിയിച്ചിരിക്കുന്നതിനാൽ മൾട്ടിപ്പിൾ സ്ക്ലിറോസിസ് അഥവാ എം.എസ്. ഒന്നിലധികം സ്ക്ലിറോസിസ് രോഗികളുടെ രോഗപ്രതിരോധം വഴി പശുവിന്റെ പാൽ പ്രോട്ടീനുകൾ സാധാരണയായി ലക്ഷ്യം വച്ചുകൊണ്ടിരിക്കുകയാണെന്നതാണ് ഇതിന് കാരണം. കൂടാതെ, പശുവിന്റെ പാലിൽ ചില പ്രോട്ടീനുകൾ മെയ്ലിൻ ഒലിഗോഡെൻഡ്രോസൈറ്റ് ഗ്ലൈക്കോപ്റ്റെടിൻ അല്ലെങ്കിൽ മോയ്ജിൻറെ ഭാഗമായി അനുകരിക്കുന്നു. ഇത് മഗ്നീഷ്യന്റെ സ്വയം നിയന്ത്രണം മൂലം മഗ്നീഷനെ നശിപ്പിക്കാനും നശിപ്പിക്കാനും രോഗപ്രതിരോധ വ്യവസ്ഥ തടസ്സപ്പെടുത്താൻ സഹായിക്കുന്നു. നാഷണൽ സെന്റർ ഫോർ ബയോടെക്നോളജി ഇൻഫർമേഷൻ (എൻസിബി) യിൽ നിന്നും ലഭിച്ച വിവരങ്ങൾ. ഞങ്ങളുടെ വിവരങ്ങളുടെ പരിധി ചിതറായും അസാധാരണമായ ആരോഗ്യ പ്രശ്നങ്ങളിലേക്കും പരിമിതപ്പെടുത്തിയിരിക്കുന്നു. വിഷയം ചർച്ച ചെയ്യാൻ, ഡോക്ടർ ജിമെനെസ് ചോദിക്കാൻ മടിക്കരുത് അല്ലെങ്കിൽ ഞങ്ങളെ ബന്ധപ്പെടുക 915-850-0900 .

ഡോ. അലക്സ് ജിമെനെസ് ക്യൂറാണ്

ഇതിൽ നിന്നും റെഫറൻസ്: Ncbi.nlm.nih.gov/pmc/articles/PMC4342365

പച്ച കോൾ ഇപ്പോൾ ബട്ടൺ എച്ച് .png

കൂടുതൽ വിഷയം ചർച്ച: അക്യുട്ട് ബാക്ക് വേദന

പുറം വേദന ലോകവ്യാപകമായി തൊഴിലാളിയുടെ വൈകല്യവും നഷ്ടപ്പെടാത്ത ദിവസങ്ങളും ഏറ്റവും കൂടുതലായ കാരണങ്ങൾ. ഡോക്ടർ ഓഫീസ് സന്ദർശനങ്ങൾക്കുള്ള രണ്ടാമത്തെ ഏറ്റവും സാധാരണ കാരണം ചൂണ്ടിക്കാട്ടുന്നു, ഉയർന്ന ശ്വാസകോശബാധയുള്ള അണുബാധകൾ മാത്രം. ജനസംഖ്യയിൽ ഏതാണ്ട് എൺപതു ശതമാനം പേർക്ക് അവരുടെ ജീവിതകാലം മുഴുവൻ ഒരു വേദന ഒരിക്കൽ അനുഭവപ്പെടും. നട്ടെല്ല്, സന്ധികൾ, കട്ടിലുകൾ, പേശികൾ തുടങ്ങി മൃദുവായ ടിഷ്യൂകൾ കൊണ്ട് നിർമ്മിച്ച സങ്കീർണമായ ഘടനയാണ് നട്ടെല്ല്. പരുക്കുകളും ഒപ്പം / അല്ലെങ്കിൽ അഴുകിയ അവസ്ഥകളും ഹാർനിയേറ്റഡ് ഡിസ്ക്കുകൾ, ഒടുവിൽ മുടി വേദനയുടെ ലക്ഷണങ്ങളായി മാറുന്നു. സ്പോർട്സ് പരിക്കുകൾ അല്ലെങ്കിൽ വാഹനാപകടങ്ങൾ പലപ്പോഴും മുടി വേദനയ്ക്ക് ഇടയാക്കുന്നു, ചിലപ്പോൾ ചലനങ്ങളുടെ ലളിതമായ വേദനയ്ക്ക് വേദനയേറിയ ഫലങ്ങൾ ഉണ്ടാകാം. ഭാഗ്യവശാൽ, ചികിൽസാകൃതിയിലുള്ള സംരക്ഷണം പോലെയുള്ള ബദൽ ചികിൽസാരീതികൾ, നട്ടെല്ലിൽ മാറ്റം വരുത്താനും നട്ടെല്ലിൽ മാറ്റം വരുത്താനും സഹായകരമാകും, ഇത് ആത്യന്തികമായി വേദനയുടെ ആശ്വാസം വർദ്ധിപ്പിക്കും.

കാർട്ടൂൺ പേപ്പർ ബോയുടെ ബ്ലോഗ് ചിത്രം

EXTRA EXTRA | പ്രധാന വിഷയം: ശുപാർശ എൽ പാസോ, TX ച്യൂയിപോർട്ട് സ്ട്രക്ചർ

***

മൾട്ടിപ്പിൾ സ്ക്ലിറോസിസിൽ വ്യായാമം, രോഗപ്രവണത

മൾട്ടിപ്പിൾ സ്ക്ലിറോസിസിൽ വ്യായാമം, രോഗപ്രവണത

മൾട്ടിപ്പിൾ സ്ക്ലിറോസിസിന്റെ വളർച്ച മന്ദഗതിയിലാക്കാൻ കഴിയുമോ? മൾട്ടിപ്പിൾ സ്ക്ലിറോസിസ് അല്ലെങ്കിൽ MS, കേന്ദ്ര നാഡീവ്യൂഹത്തിലെ നാഡീകോശങ്ങൾ എന്ന മരുന്നുകൾ മൂലമുണ്ടാകുന്ന നാശനഷ്ടങ്ങൾ, അല്ലെങ്കിൽ സിഎൻഎസ് പോലുള്ള നാശനഷ്ടമായ ഒരു ന്യൂറോളജിക്കൽ രോഗമാണ് ഇത്. മൾട്ടിപ്പിൾ സ്ക്ലിറോസിസ് സാധാരണ ലക്ഷണങ്ങൾ വേദന, ക്ഷീണം, ദർശനം നഷ്ടപ്പെടൽ, ദുർബലമായ ഏകോപനം എന്നിവയാണ്. പല തരത്തിലുള്ള പരിക്കുകളെയും കൂടാതെ / അല്ലെങ്കിൽ അവസ്ഥകളിലെയും ചികിത്സാരീതികളാണ് വ്യായാമം പലപ്പോഴും ശുപാർശ ചെയ്യുന്നത്. മൾട്ടിപ്പിൾ സ്ക്ലിറോസിസ് ലക്ഷണങ്ങളുടെ മാനേജ്മെൻറ് മെച്ചപ്പെടുത്താനും രോഗത്തിൻറെ പുരോഗതി കുറയ്ക്കാനും വ്യായാമം നിർണ്ണയിച്ചിട്ടുള്ളതിനാൽ കൂടുതൽ തെളിവുകൾ ആവശ്യമായി വരുന്നു. വ്യായാമത്തിന് മൾട്ടിപ്പിൾ സ്ക്ലിറോസിസ് രോഗബാധയെ ബാധിക്കുകയും രോഗികളുടെ ജീവിതനിലവാരം ഉയർത്തുന്നത് എങ്ങനെയെന്ന് കാണിക്കുന്നതായാണ് അടുത്ത ലേഖനം ഉദ്ദേശിക്കുന്നത്.

വേര്പെട്ടുനില്ക്കുന്ന

മൾട്ടിപ്പിൾ സ്ക്ലിറോസിസ് (എം.എസ്.) പാത്തോളജിയിൽ സ്വാധീനം ചെലുത്താനുള്ള ശേഷി (അല്ലെങ്കിൽ ശാരീരിക പ്രവർത്തനങ്ങൾക്ക്) എംഎസ് രോഗികളിൽ വേഗത കുറയ്ക്കാൻ സാധിക്കുമെന്ന് നിർദ്ദേശിക്കപ്പെട്ടിട്ടുണ്ട്. ശാരീരിക വ്യായാമത്തെ (അല്ലെങ്കിൽ പ്രവർത്തനം), എം.എസ്. രോഗം പുരോഗമനവുമായി ബന്ധിപ്പിക്കുന്ന സാഹിത്യം തിരിച്ചറിയുന്നതിനാണ് ഈ സാഹിത്യ അവലോകനം ലക്ഷ്യമിടുന്നത്. PubMed, SweMed +, Embase, Cochrane ലൈബ്രറി, PEDRO, SPORTDiscus, ഐഎസ്ഐ വെബ് ഓഫ് സയൻസ് എന്നിവയിൽ താഴെപറയുന്ന ഡേറ്റാബെയിസുകളിൽ ഒരു സമ്പ്രദായ സാഹിത്യ തിരയൽ നടത്തി. ഫിറ്റ്നസ് സ്റ്റാറ്റസും MRI കണ്ടെത്തലുകളും തമ്മിലുള്ള ബന്ധം വിലയിരുത്തുന്നതിന് (1) ക്രോസ്-സെമിനാർ പഠനങ്ങൾ, (2) ക്രോസ്-സെക്ഷണൽ ആൻഡ് ലോഡ്യൂഡിനൈനൽ പഠനങ്ങളിൽ (3) വ്യതിയാന വ്യായാമ പഠനങ്ങൾ (4) വ്യായാമം / ശാരീരിക പ്രവർത്തനവും വൈകല്യവും / റിസപ്സ് നിരക്ക് തമ്മിലുള്ള ബന്ധം വിലയിരുത്തൽ, ഒടുവിൽ, (1) നീളൻ വ്യായാമം MS ന്റെ പരീക്ഷണാത്മക യാന്ത്രികഇൻമെൻ എൻസെഫലോമൈമിറ്റീസ് (EAE) മൃഗ മാതൃക ഉപയോഗിക്കുന്നു. രോഗം പുരോഗമനത്തെ ക്ലിനിക്കൽ നടപടികളിലൂടെ വിലയിരുത്തുന്നതിൽ നിന്നുള്ള വിവരങ്ങൾ (2) ഒരു വ്യായാമത്തിന്റെ വ്യായാമത്തിന്റെ ഫലത്തെ പിന്തുണയ്ക്കില്ല; എന്നിരുന്നാലും, എംആർഐ ഡാറ്റ (3), രോഗിയുടെ റിപ്പോർട്ട് ഡാറ്റ (4), EAE മോഡൽ (XNUMX) എന്നിവയിൽ നിന്നുള്ള വിവരങ്ങൾ വ്യായാമത്തിന്റെ വ്യായാമത്തിൻറെ ഫലമായി ഉണ്ടാകുമെന്നാണ് സൂചിപ്പിക്കുന്നത്, എന്നാൽ തെളിവുകളുടെ ഉറവിടം കൃത്യമായ നിഗമനങ്ങളിലേക്ക് പരിമിതപ്പെടുത്തുന്നു. എം.എസ്. രോഗികളിലെ വ്യായാമത്തിന്റെ (അല്ലെങ്കിൽ ശാരീരിക പ്രവർത്തനങ്ങൾ) ഒരു രോഗത്തിന്റെ സാധ്യതയെ ചില തെളിവുകൾ പിന്തുണയ്ക്കുന്നുണ്ടെന്ന് ഉറപ്പുവരുത്തിയിരുന്നു, പക്ഷേ ഇത് ഉറപ്പു വരുത്താൻ മെച്ചപ്പെട്ട മാർഗ്ഗനിർദ്ദേശങ്ങൾ ഉപയോഗപ്പെടുത്തുന്നതിനുള്ള ഭാവി പഠനങ്ങൾ ആവശ്യമാണ്.

അടയാളവാക്കുകൾ: വ്യായാമ പ്രവർത്തനങ്ങൾ, വ്യായാമം ചികിത്സ, ശാരീരിക പ്രവർത്തികൾ, പരിശീലനം

അവതാരിക

മൾട്ടിപ്പിൾ സ്ക്ലിറോസിസ് (എം.എസ്.) ആണ് ക്ലിനിക്കൽ ആൻഡ് പത്തോളജിക് കോംപ്ലക്സ് ആന്റ് അലേർട്ടർ എട്ടിഗോളറിസ് (കാന്റാറി, 2003). നൂറ് ദശലക്ഷം ആളുകളുടെ മൊത്തം ജനസംഖ്യയുള്ള 2008 യൂറോപ്യൻ രാജ്യങ്ങളിൽ, എം.എസ്.സൊബോക്കി (et al. 28]. ഈ അസുഖം പുരോഗമനകരമാണ്, എന്നാൽ എല്ലാ MS രോഗികളുടെയും 466% ൽ കൂടുതൽ രോഗബാധയുള്ളത്, 380,000- ലധികം വർഷക്കാലം [Koch-Henriksen et al. 2007], രോഗം നഷ്ടപ്പെട്ടു ജീവൻ നഷ്ടപ്പെടുത്തിയ വർഷങ്ങളുടെ എണ്ണം 80 മുതൽ 35 വരെ [Ragonese et al. 1998]. ദീർഘകാലം നീണ്ടുനിൽക്കുന്ന, ദീർഘവും നീണ്ടു നിൽക്കുന്നതുമായ രോഗമാണ് എംഎസ് പുനരധിവാസത്തിന് ഒരു സ്വതന്ത്ര ജീവിതരീതിയും ജീവിതവുമായി ബന്ധപ്പെട്ട ജീവിത നിലവാരവും നിലനിർത്തുന്നതിൽ ഒരു പ്രധാന ശിക്ഷണം നൽകുന്നു [തമസ്വാദ, 5]. കഴിഞ്ഞ ഏതാനും ദശാബ്ദങ്ങളിൽ എം.എസ്. രോഗികൾക്ക് ശാരീരിക വ്യായാമം ശുപാർശ ചെയ്യുന്നതു സാധാരണഗതിയിൽ സ്വീകരിച്ചിട്ടുണ്ട്. സത്ർലാൻഡ്, ആൻഡേഴ്സൺ, 10]. എം.എസ്. ഡൽഗസ് മറ്റു ചിലരിൽ ശാരീരികവും മാനസികവുമായ പ്രവർത്തനങ്ങളിൽ വ്യായാമം നന്നായി സഹിഷ്ണുത കാണിക്കുന്നു. 2008]. വ്യായാമം ഓരോരോ രോഗബാധയുണ്ടാക്കാൻ കഴിയുമോ അല്ലെങ്കിൽ വ്യായാമത്തെ ദൌർലഭ്യം മൂലം ഉണ്ടാകുന്ന പ്രഭാവം തടസ്സപ്പെടുത്താൻ കഴിയുമോ എന്നത് ഒരു തുറന്ന ചോദ്യമാണ്. എന്നിരുന്നാലും, മിക്കവാറും വ്യായാമങ്ങൾ പല രോഗികളും സ്വീകരിച്ച നിർജീവജീവിതത്തിന്റെ ഫലങ്ങളെ (ഗാർണറും വിഡ്രിക്കും, 1998; കെന്റ്-ബ്രൌൺ തുടങ്ങിയവരും. 2001; Ng, Kent-Braun, 2008; സ്റ്റുട്ട്ബെർഗെൻ, 2003]. എന്നിരുന്നാലും, എം.എസ്.ക്യാം പുരോഗതിയെ സ്വാധീനിക്കാനുള്ള കഴിവ് വ്യായാമ പ്രക്രിയയെ മന്ദീഭിപ്പിച്ചുകൊണ്ട് [Heesen et al. 1997; Le-Page et al. 1997; വൈറ്റ് കാസ്റ്റിലോനോ, 1997 ബി]. മസ്തിഷ്ക പ്രവർത്തനത്തിൽ സ്വാധീനം ചെലുത്താൻ കഴിവുള്ള മറ്റു കഴിവുകളും വ്യായാമം ചെയ്യുക വഴി, മോട്ടിലും സഹപ്രവർത്തകരും ചുരുക്കിപ്പറഞ്ഞാൽ, മുതിർന്നവരിലെ വ്യായാമങ്ങളിലോ അല്ലെങ്കിൽ ഡിമെൻഷ്യയോ ഇല്ലാതെ വ്യായാമം ചെയ്യുന്നത് ഒരു നിയന്ത്രണ വ്യവസ്ഥയുമായി ബന്ധപ്പെട്ട മാനസിക വളർച്ചയെ നയിക്കുന്നു [മോൾൽ et al. 2006 ബി]. ഇതിനെ അടിസ്ഥാനപ്പെടുത്തി എം.എസ്. രോഗികളിലെ ചില കണ്ടെത്തലുകളെ അടിസ്ഥാനപ്പെടുത്തി, എം.എസ്. രോഗികളിലെ വിദഗ്ദ്ധ പ്രവർത്തനങ്ങൾ മെച്ചപ്പെടുത്താൻ വ്യായാമം ചെയ്തേ മതിയാവൂ. എന്നിരുന്നാലും, MS ൽ ഫിസിക്കൽ എക്സർസൈസ് കൂടുതൽ രോഗബാധയുണ്ടോ എന്ന് പരിശോധിച്ചിട്ടില്ല.

ഈ പ്രധാന വിഷയത്തെക്കുറിച്ച് കൂടുതൽ ഉൾക്കാഴ്ച നേടാൻ എം.എസ്. രോഗികളിലെ രോഗബാധയിലേയ്ക്കോ അല്ലെങ്കിൽ MS ന്റെ പരീക്ഷണാത്മക യാന്ത്രികഇൻമെൻ എൻസെഫലോമൈമൈറ്റിസ് (ഇഎഇഇ) മൃഗ മാതൃകയിൽ വ്യായാമത്തെ (അല്ലെങ്കിൽ ശാരീരിക പ്രവർത്തി) ബന്ധപ്പെടുത്തുന്ന പഠനങ്ങളേയും ലക്ഷ്യമിട്ടുകൊണ്ടുള്ള ഒരു വ്യവസ്ഥാപിത സാഹിത്യ അന്വേഷണം ഞങ്ങൾ നടത്തി. അവലോകനത്തിന്റെ ഒരു ദ്വിതീയ ഉദ്ദേശ്യം ഈ ലിസ്റ്റിലെ ഭാവി പഠന ദിശകൾ നിലനിൽക്കുന്നുണ്ടെങ്കിൽ ഈ ലിങ്ക് വിശദീകരിക്കാനുള്ള സംവിധാനങ്ങളെക്കുറിച്ച് ചർച്ച ചെയ്യുക എന്നതാണ്.

രീതികൾ

എം എസ് സംബന്ധിച്ച പ്രസക്തമായ ലേഖനങ്ങളെ തിരിച്ചറിയുന്നതിനും 4 സെപ്റ്റംബർ XXX വ്യായാമം ചെയ്യുന്നതിനും വേണ്ടി സമഗ്ര സാഹിത്യ തിരയൽ (PubMed, SweMed +, Embase, Cochrane ലൈബ്രറി, PEDRO, SPORTDiscus, ISI വെബ് ഓഫ് സയൻസ്) വഴി ഉൾപ്പെടുത്തിയിട്ടുള്ള സാഹിത്യം തിരിച്ചറിഞ്ഞു. 'മൾട്ടിപ്പിൾ സ്ക്ലെറോസിസ്' അല്ലെങ്കിൽ 'പരീക്ഷണാത്മക ഓട്ടോമിന്മെൻറ് എൻസെഫലോമൈലിറ്റീസ്' എന്ന വിഷയത്തിൽ സബ്ജക്ട് ഹെഡ്ഡിംഗ്സ് വ്യായാമം, വ്യായാമം തെറാപ്പി, ഫിസിക്കൽ എഡ്യൂക്കേഷൻ ആൻഡ് ട്രെയിനിംഗ്, ഫിസിക്കൽ ഫിറ്റ്നസ്, മോട്ടോർ ആക്റ്റിവിറ്റി, . പ്രസിദ്ധീകരിച്ച വർഷം, പ്രായപരിധിയിലെ വിഷയങ്ങളെ സംബന്ധിച്ച പരിമിതികൾ ഒന്നും നൽകിയില്ല. സാധ്യമെങ്കിൽ, വ്യത്യസ്ത ഡാറ്റാബേസുകളിൽ തിരയൽ നടത്തുമ്പോൾ അവഗണനകളും അഭിപ്രായങ്ങളും പുസ്തകത്തിലെ അദ്ധ്യായങ്ങളും ഒഴിവാക്കപ്പെട്ടു. ഈ തിരയൽ 2011 പ്രസിദ്ധീകരണങ്ങളും നൽകി. ശീർഷകവും അമൂർത്തവും അടിസ്ഥാനമാക്കിയുള്ള ഈ പ്രസിദ്ധീകരണങ്ങളുടെ ഒരു പ്രദർശനം തുടർന്നുള്ള വായനയ്ക്ക് പ്രസക്തമായ 547 പ്രസിദ്ധീകരണങ്ങളാണ് വെളിപ്പെടുത്തിയത്. ഈ 133 പ്രസിദ്ധീകരണങ്ങളുടെ റഫറൻസ് ലിസ്റ്റുകൾ തിരച്ചിൽ വഴി പിടിച്ചെടുക്കാത്ത കൂടുതൽ പ്രസക്തമായ പ്രസിദ്ധീകരണങ്ങൾക്കായി പരിശോധിച്ചു. ഇതിന്റെ ഫലമായി ആറു പ്രസിദ്ധീകരണങ്ങളിൽ വന്നു. (N = 133), അവലോകനങ്ങൾ (n = 139), അവലോകനങ്ങൾ (n = 65), കോൺഫറൻസ് അബ്സ്ട്രാക്റ്റുകൾ (n = 3), ഇംഗ്ലീഷിൽ (n = 22) എഴുതപ്പെടാത്ത ലേഖനങ്ങൾ എന്നിവയിൽ നിന്ന് ഒഴിവാക്കി അന്തിമ വിശകലനം (ചിത്രം കാണുക 8). പ്രസക്തമായ ക്രോസ്-സെക്ഷണൽ ആൻഡ് രേഖാംശ പഠനങ്ങൾ ഉൾപ്പെടുത്തി.

ഗോൾഡ്മാനും സഹപ്രവർത്തകരും പറയുന്നത് എം.എസ്. ലെ രോഗപ്രതിരോധം (അല്ലെങ്കിൽ പ്രവർത്തനങ്ങൾ) പ്രതിഫലിപ്പിക്കുമെന്ന് കരുതുന്നതിനുള്ള നടപടികൾ ഗൌരവമുള്ളതും ആത്മനിഷ്ഠവുമായ ഫലപ്രാപ്തിയോടൊപ്പം വിലയിരുത്തുകയാണ്. 2010]. വികസിപ്പിച്ച വൈകല്യ നില സ്കെയിൽ (EDSS), മൾട്ടിപ്പിൾ സ്ക്ലറോസിസ് ഫങ്ഷണൽ കമ്പോസിറ്റ് (എംഎസ്എഫ്സി), (എംഎൻഐഎക്സ്), എം.ആർ.ഐ. രോഗപ്രതിരോധ ശേഷി പ്രതിഫലിപ്പിക്കുന്നതിനോ, വൈകല്യമുള്ളവയോ, വൈകല്യങ്ങളുള്ളതോ ആയ വൈകല്യത്തെപ്പറ്റിയുള്ള വൈകല്യങ്ങൾ പ്രതിഫലിപ്പിക്കുന്നതാണ് രോഗലക്ഷണ നടപടികൾ. രോഗശയ്യയിലുണ്ടായ രോഗശമനം സംബന്ധിച്ച പഠനങ്ങളും ഈ വിഭാഗത്തിൽ ഉൾപ്പെടുത്തിയിട്ടുണ്ട്. കൂടാതെ, പഠനസംബന്ധിയായ പഠനങ്ങളായ എം എസിന്റെ ഇഎംഇ മൃഗ മൃഗപാലക മാതൃക (1) പ്രയോഗിക്കുന്ന പഠനങ്ങൾ അടങ്ങിയിരിക്കുന്നു. ഈ ചട്ടക്കൂടിനെ അടിസ്ഥാനമാക്കി പ്രാദേശികവൽക്കരിച്ച ലേഖനങ്ങൾ താഴെ പറയുന്ന നാല് വിഭാഗങ്ങളായി തിരിച്ചിട്ടുണ്ട് (പട്ടിക കാണുക 2):

  1. രോഗം പുരോഗമന ചികിത്സാ നടപടിക്രമങ്ങളുമായി വിലയിരുത്തുന്നു (n = 12);
  2. രോഗം പുരോഗമിച്ചു നോൺക്ലിനിക് അളവുകൾ പരിശോധിച്ചു (n = 2);
  3. രോഗം റിപ്പോർട്ട് ചെയ്യപ്പെട്ട നടപടികളുമായി രോഗനിർണ്ണയപരിശോധന (n = 10);
  4. മൃഗീയ പഠനങ്ങളിൽ പരിശോധിച്ച രോഗം പുരോഗണി (n = 3).

ഫലം

രോഗപ്രതിരോധം ക്ലിനിക്കൽ നടപടികളുമായി ബന്ധപ്പെട്ടിരിക്കുന്നു

3-3 മുതൽ ആഴ്ചയിൽ നീളുന്ന ഘടനാപരമായ വ്യായാമ ഇടപെടലുകൾ മൂല്യനിർണ്ണയം നടത്തുന്ന അനേകം പഠനങ്ങൾ ഫലപ്രദമായി രോഗപ്രതിരോധം പ്രതിഫലിപ്പിക്കുന്ന ക്ലിനിക്കൽ സ്കെയിലുകളിൽ ഉൾപ്പെടുന്നു. ബാധകമായ ക്ലിനിക്കൽ സ്കെയിലുകളിൽ EDSS [Bjarnadottir et al. 26; ഡൽഗാസ് et al. 2007; ഫ്ലിംലെഡ് et al. 2009; ഗോൽസാരി മുതലായവ 2010; പെടാജൻ et al. 2010; പിലുട്ടി et al. 1996; റോജേഴ്സ് മറ്റുപേരും. 2011; റോബർഗ്ഗ് et al. 1999; വൈറ്റ് et al. 2004], എംഎസ്എഫ്സി [പിലുട്ടി et al. 2004; റോബർഗ്ഗ് et al. ഗ്ലൈസ് ന്യൂറോജിക്കൽ ഡിസബിലിറ്റി സ്കേലെൻ (ജിഎൻഡിഎസ്) [കിളിഫ് ആൻഡ് അശ്ബേൺ, 2011; വാൻ ഡെൻ ബെർഗ് et al. 2005], ഫങ്ഷണൽ ഇൻഡിപെൻഡൻസ് മെഷർ (ഫിം) [റോബർഗ്ഗ് et al. 2005]. എൻഡഎസ്എസ് പ്രയോഗിക്കുന്ന പഠനങ്ങൾ സാധാരണഗതിയിൽ എൻഡുറൻസ് ട്രെയിനിംഗിനു ശേഷം ഏതെങ്കിലും മാറ്റം കാണുന്നില്ല [പീറ്റാജൻ et al. 2006; പിലുട്ടി et al. 2005; റോജേഴ്സ് മറ്റുപേരും. 1996], പ്രതിരോധ പരിശീലനം [Dalgas et al. 2011; ഫ്ലിംലെഡ് et al. 1999; വൈറ്റ് et al. 2009] അല്ലെങ്കിൽ സംയോജിത പരിശീലന ഇടപെടലുകൾ [Bjarnadottir et al. 2010; റോബർഗ്ഗ് et al. 2004]. സംയോജിത പരിശീലനത്തിന്റെ (ആഴ്ചപ്പതിപ്പ് / ആഴ്ചയിൽ) ആഴ്ചയിൽ നടത്തിയ എൻഎച്ച്എസ്എസിന്റെ സ്കോർ മെച്ചപ്പെടുത്തുന്നതിന് ഗോൽസാരിയും സഹപ്രവർത്തകരും നടത്തിയ ഒരു പഠനം മാത്രമായിരുന്നു EDSS സ്കോർ [Golzari et al. 2007]. ഈ കണ്ടെത്തൽ ദീർഘകാല പഠനത്തിൽ (2004 ആഴ്ച) സ്ഥിരീകരിച്ചിട്ടുമില്ല [റോബർഗ്ഗ് et al. 8] കൂടിച്ചേർന്ന പരിശീലനത്തിൻറെ ഫലങ്ങളെ വിലയിരുത്തുകയും ചെയ്യുന്നു. റോബർബും സഹപ്രവർത്തകരും നടത്തിയ പഠനത്തിൽ, EDSS, FIM എന്നിവയിൽ യാതൊരു സ്വാധീനവും കണ്ടെത്തിയില്ല. എന്നാൽ എം.എസ്.എഫ്.സിയിൽ ഒരു ചെറിയ പ്രയോജനം കണ്ടു. ഏതാനും പഠനങ്ങൾ ജിഎൻഎൻഎസ് ഉപയോഗപ്പെടുത്തി, ആഴ്ചയിൽ ചുരുങ്ങിയത് ആഴ്ചയിൽ ചുരുങ്ങിയത്, 3 ആഴ്ചകൾ പൂർത്തിയായ പരിശീലനത്തിന്റെ ഒരു ഫലവും റിപ്പോർട്ടുചെയ്തിട്ടില്ല [1]. 2010].

പതിവ് വ്യായാമങ്ങൾ സംബന്ധിച്ച വ്യായാമങ്ങളടങ്ങിയ വ്യായാമങ്ങളിൽ, പതിമൂന്നാം നൂറ്റാണ്ടു മുതൽ ആഴ്ചയിൽ, EDSS സ്കോറുകളിൽ ഫലപ്രദമാകുന്നില്ല. ചില ക്ലിനിക്കൽ സ്കെയിലുകൾ (എംഎസ്എഫ്സി, ജിഎൻഎസ്എസ്) പ്രയോഗിക്കുമ്പോൾ കുറച്ച് പഠന പഠനങ്ങൾ നല്ല ഫലം നൽകുന്നു.

രോഗപ്രതിരോധ നടപടികൾ നോൺ-ക്ലിനിക്കൽ മെഷീനുകളിൽ വിലയിരുത്തുക

എം.ആർ.ഐ. (പ്രകാശ് et al. അപേക്ഷാഫാറിക്കൽ) ഉപയോഗിച്ച് ബ്രോഡ് ഫംഗ്ഷനിലും ഘടനയിലും കാർഡിയോർ കോസ്മെട്രിറ്റി ഫിറ്റ്നസിന്റെ ഫലങ്ങളെ കുറിച്ച് പ്രകാശ്, സഹപ്രവർത്തകർ നടത്തിയ പഠനങ്ങൾ വിലയിരുത്തിയിട്ടുണ്ട്. XXX, 2007]. ഒരു പഠനം [പ്രകാശ് et al. എം എസ് രോഗികളുടെ മസ്തിഷ്കപ്രകടനത്തിൽ കാർഡിയോറോരോസ്ററി ഫിറ്റ്നസിന്റെ സ്വാധീനം അന്വേഷിച്ചു. പഠനത്തിനായി റിസപ്ഷൻ ചെയ്ത MS-MS കളിൽ ഇരുപത്തിരണ്ട് പെൺകുട്ടികൾ റിക്രൂട്ട് ചെയ്തു. ഫിറ്റ്നസ് മൂല്യനിർണ്ണയത്തിലൂടെ (VO2009 കൊടുമുടി) എല്ലാ പങ്കെടുക്കുന്നവരും പോയിന്റ് ചെയ്ത വിഷ്വൽ സീരിയൽ അക്സസിഷൻ ടെസ്റ്റ് (പിവിഎസ്എടി) നടപ്പിലാക്കുന്ന സമയത്ത് ഒരു എൻഎക്സ്എക്സ്-ടി എംആർഐ സിസ്റ്റത്തിൽ സ്കാൻ ചെയ്തു. ഉയർന്ന ഫിറ്റ്നസ് ലെവലുകൾ പിവിസേറ്റിന്റെ സമയത്ത് വേഗത്തിലുള്ള പ്രവർത്തനവുമായി ബന്ധപ്പെട്ടിരുന്നു. മസ്തിഷ്ക കോർട്ടക്സിലെ ഒരു പ്രത്യേക പ്രദേശത്തെ കൂടുതൽ റിക്രൂട്ട് ചെയ്യാവുന്നതും (വലത് ഇൻഫീരിയർ ഫ്രോട്ടൽ ഗൈറസ് [IFG], മിഡ് ഫ്രോട്ടൽ ഗൈറസ് [MFG] എം.എസ്.എന്.എന് ആന്റിയ്ക്ക് വിഘാതമാകുകയാണു് പിവിഎസ്എറ്റിന്റെ പ്രവര്ത്തനത്തിനുപയോഗിക്കുന്ന തുക. ഇതിനു വിപരീതമായി, ഫിറ്റ്നസിന്റെ താഴ്ന്ന നിലവാരത്തിൽ മുൻകാല സിങ്കൂൾറ്റൽ കോർട്ടക്സിൽ (ACC) മെച്ചപ്പെട്ട പ്രവർത്തനങ്ങളുമായി ബന്ധപ്പെട്ടിരുന്നു, ചെറിയ തോതിൽ എം സ്കോളർഷിപ്പ് ചെയ്യുന്നവരുടെ തകരാറുകൾ വർദ്ധിക്കുന്നതിനുള്ള വലിയ തോതിലുള്ള പോരാട്ടത്തിന്റെ സാന്നിധ്യം പ്രതിഫലിപ്പിക്കുന്നു. എം എസിന്റെ ഫലമായുണ്ടാകുന്ന മാനസിക വിഭ്രാന്തിയെ പ്രതിരോധിക്കാൻ കൂടുതൽ കോർട്ടിങ്ങൽ വിഭവങ്ങളുടെ വികസനത്തെ സഹായിക്കുന്നതിനുള്ള ഇടപെടലായി എയ്റോബിക് പരിശീലനത്തെ പിന്തുണയ്ക്കുന്നതായി ഫലങ്ങൾ രചിച്ചിട്ടുണ്ട്. ധാരാളം പാശ്ചാത്യ പരീക്ഷണങ്ങളിൽ, പാസ്റ്റഡ് ഓഡിറ്ററി സീരിയൽ അക്സീഷൻ ടെസ്റ്റ് (പിഎഎസ്എടി) മാത്രം, വ്യായാമത്തിന് പൊതു മാനസികാരോഗ്യ പ്രവർത്തനത്തിന്റെ ഫലങ്ങളിൽ ഫിറ്റ്നസ് ഒരു സ്വാധീനവും ഇല്ലെന്ന് അഭിപ്രായപ്പെടുന്നവരെ നയിക്കുന്ന VO2007 പിക്ചറിന് മോശം സഹകരണം (p = 2) കാണിക്കുന്നു.

പ്രകാശ്, സഹപ്രവർത്തകർ എന്നിവരുടെ മറ്റൊരു പഠനത്തിൽ ഗ്രേഡിയൻസ് ഫിറ്റ്നസ് (Voxxxxxxxxxxxxxxxxxxxxxxxxxxxx), ചാരനിറത്തിലുള്ള വിഷാംശങ്ങൾ (വൈറ്റമിൻ ഇൻഫ്രാഫീ വൈറസ്), വെളുത്ത ദ്രവ്യാഗ്രഹത്തിന്റെ അളവുകൾ (ഇവ രണ്ടും ഈ രോഗവുമായി ബന്ധപ്പെട്ടവയാണ്) പഠിച്ചു [പ്രകാശ് et al. 2]. ഗ്രേ വീണും വെളുത്ത ദ്രവ്യവും വിശകലനം ചെയ്യുന്ന ഒരു വക്സൽ അധിഷ്ഠിത സമീപനം, ഒരു എച്ച്എംഎൻഎക്സ്-എം എം ആർഐഐ സിസ്റ്റത്തിൽ നിന്ന് തലച്ചോറിൽ പ്രയോഗിച്ചു. കൂടുതൽ വ്യക്തമായി 2009 സ്ത്രീ എംഎസ് രോഗികൾക്ക് ഉയർന്ന ഫിറ്റ്നസ് സൂക്ഷിച്ചു ഗ്രേ മെറ്റീരിയൽ സംയുക്തവും വെളുത്ത ദ്രവ്യത്തിന്റെ സമ്പൂർണ്ണതയും ബന്ധപ്പെട്ടിരിക്കുന്നു എന്ന് പരിശോധിച്ചു. കാർഡിയോസോറസ്ററേറ്ററി ഫിറ്റ്നംഗും പ്രാദേശിക ഗ്രേ മെറ്റീരിയൽ വോള്യങ്ങളും തമ്മിലുള്ള സങ്കീർണ്ണമായ ബന്ധം ഉയർന്ന ഫോക്കൽ ഫൈനറൽ അൻസോട്രോപ്പിയുടെ മൂല്യങ്ങൾ റിപ്പോർട്ട് ചെയ്യപ്പെട്ടിട്ടുണ്ട്. സംസ്കരിക്കപ്പെട്ട ചാരനിറത്തിലുള്ള ദ്രവ്യമാനവും വൈറ്റ് ഗാർഡ് ട്രാക്റ്റ് ഇന്റഗ്രിറ്റിയും സംസ്കരണ വേഗതയുടെ അളവുകൾ മെച്ചപ്പെടുത്തുന്നതിന് സഹായിച്ചിട്ടുണ്ട്. ഡാറ്റായുടെ ക്രോസ്-സെക്ഷണൽ സ്വഭാവം തിരിച്ചറിഞ്ഞ്, മുൻകാലങ്ങളിൽ നിരീക്ഷിക്കപ്പെട്ട ഘടനാപരമായ കുറവുകളെ ഒരു ഫിഫ്നസ്സ് ഫലപ്രദമായി സ്വാധീനിക്കുന്നുണ്ടെന്നും, എം.എസ്. ന്യൂറോണൽ ഇന്റഗ്രിറ്റി കാത്തുസൂക്ഷിക്കുകയും, അങ്ങനെ ദീർഘകാല വൈകല്യം കുറയ്ക്കുകയും ചെയ്യുന്നു.

എം.എസ്.ആർ രോഗികളിൽ മസ്തിഷ്ക പ്രവർത്തനത്തിലും ഘടനയിലും കാർഡിയോറോരോസ്ഫറേറ്ററി ഫിറ്റ്നസ് ഒരു സംരക്ഷക ഫലമാണെന്ന് പറയുന്നത് (എഫ്) എംആർഐ പഠനങ്ങൾ വ്യക്തമാക്കുന്നു. എന്നിരുന്നാലും, നിലവിലുള്ള ചില പഠനങ്ങളുടെ ക്രോസ്-സെക്ഷൻ സ്വഭാവം ഒരു ബന്ധ ബന്ധത്തിന്റെ നിലനിൽപ്പിനെ സംബന്ധിച്ച നിഗമനങ്ങളെ പരിമിതപ്പെടുത്തുന്നു.

രോഗപ്രയോഗം റിപ്പോർട്ടുചെയ്ത നടപടികളുമായി രോഗനിർണ്ണയം നടത്തുക

വ്യായാമം അല്ലെങ്കിൽ ശാരീരിക പ്രവർത്തനവും രോഗബാധിതമായ രോഗചികിത്സയ്ക്കും ഇടയാക്കിയ നിരവധി രോഗങ്ങൾ രോഗപ്രതിരോധ നടപടികളിൽ പ്രയോഗിക്കുന്ന വൻതോതിൽ ചോദ്യമീമാം പഠനങ്ങളിൽ ശ്രദ്ധിച്ചിട്ടുണ്ട്.

ഒരു വലിയ വിവരണാത്മക രേഖാംശ സർവേയിൽ സ്റ്റ്യൂഫ്ബെർഗെൻറും സഹപ്രവർത്തകരും ഫങ്ഷണൽ പരിമിതികൾ, വ്യായാമ പെരുത്വങ്ങൾ, ജീവിതനിലവാരം എന്നിവയിൽ ഉള്ള വ്യത്യാസത്തെ പരിശോധിച്ചു [സ്റ്റുറ്റ്ബെർഗൻ et al. 2006]. 600- ൽ കൂടുതൽ MS രോഗികൾ വർഷം തോറും നിരവധി വർഷങ്ങൾ പൂർത്തിയാക്കി. ലോട്ടന്റ് കർവ് മോഡലിംഗ് പ്രയോഗിച്ച് സ്വയം റിപ്പോർട്ട് ചെയ്ത രേഖാംശ അളവുകൾ വിശകലനം ചെയ്തു. എം.എസ്.എസിന്റെ പ്രവർത്തനത്തെ അപര്യാപ്തതാ പ്രവർത്തനനിരതമായ അളവുകോൽ നൽകി. ജീവിതശൈലി പ്രൊഫൈൽപ്രചരണത്തിന് പ്രോത്സാഹിപ്പിക്കുന്ന ആരോഗ്യം ഒരു വ്യായാമ പെരുമാറ്റം നൽകി. ആദ്യ ടെസ്റ്റ് പോയിന്റിൽ (ബേസ്ലൈൻ ടെസ്റ്റ്) ക്രോസ് സെക്ഷണൽ ഡേറ്റായും ഫങ്ഷണൽ പരിമിതികളും വ്യായാമ പെരുമാറ്റങ്ങളും തമ്മിൽ ഗുരുതരമായ പ്രതികൂലമായ സഹകരണം (r = -5) കാണിച്ചു. പഠനത്തിൻറെ ആരംഭത്തിൽ, ഉയർന്ന അളവിലുള്ള പ്രവർത്തന പരിമിതികൾ വ്യായാമം പഠനത്തിലെ രേഖാമൂല വിവരം പറയുന്നത് വ്യായാമ പെരുമാറ്റങ്ങളിലുള്ള മാറ്റങ്ങളുടെ നിരക്ക് വർദ്ധിപ്പിക്കൽ വ്യായാമ പെരുമാറ്റരീതിയിൽ മാറ്റം വരുത്തുന്നത് (r = -0.34). മറ്റു വാക്കുകളിൽ പറഞ്ഞാൽ, വ്യായാമ പെരുമാറ്റത്തിലെ വർദ്ധനവ്, ഫങ്ഷണൽ പരിമിതികളിൽ മാറ്റം വരുത്തുന്ന കുറവ് നിരക്കിനെ സൂചിപ്പിക്കുന്നു. വ്യായാമത്തിന്റെ തുടക്കം മുതൽ തുടരുന്ന വ്യായാമങ്ങൾ തമ്മിൽ പരസ്പര ബന്ധമൊന്നും കണ്ടില്ലെന്ന് കണ്ടെത്തി, വ്യത്യസ്ത എംഎസ്എസുകളുള്ള എംഎസ്എസുള്ളവർ ദീർഘകാലാടിസ്ഥാനത്തിൽ ദീർഘകാലാടിസ്ഥാനത്തിലുള്ള വ്യായാമത്തിന്റെ വേഗത കുറയ്ക്കാൻ സാധ്യതയുണ്ടെന്ന് അഭിപ്രായപ്പെട്ടു.

എം.എസ്. രോഗികളിൽ ശാരീരിക പ്രവർത്തനങ്ങൾ, ലക്ഷണങ്ങൾ, പ്രവർത്തന പരിമിതികൾ, വൈകല്യങ്ങൾ എന്നിവ തമ്മിലുള്ള ബന്ധത്തെക്കുറിച്ച് മോട്ടിലും സഹപ്രവർത്തകരുടെയും പഠനം വിശദീകരിച്ചിട്ടുണ്ട്. ഒരു ക്രോസ്-സെക്ഷണൽ പഠനത്തിലാണ് [മോൾ et al. എൺപത് ദിവസം MSM എക്സ്ക്ലൂസീവ് സ്ക്വാഡുകളിൽ XENX ദിവസത്തിനുള്ളിൽ (MS- ബന്ധപ്പെട്ട സിംപ്രോം ചെക്ക്ലിസ്റ്റ്), ഫിസിക്കൽ ആക്റ്റിവിറ്റി (ഗോഡിൻ ലെയ്ജ് ടൈം എക്സർസൈസ് സുവഹനീയവും എക്സ്.എൻ.എക്സ്. ആക്സിലറോമീറ്റർ ഡാറ്റയും) എന്നിവ ശേഖരിച്ചിട്ടുണ്ട്. മാതൃകാ ഡാറ്റയ്ക്കു ശേഷം ലക്ഷണങ്ങളും ശാരീരിക പ്രവർത്തികളും തമ്മിലുള്ള നേരിട്ടുള്ള ബന്ധം കണ്ടെത്തി (r = -2006) സൂചിപ്പിക്കുന്നത്, വലിയ അളവിലുള്ള ലക്ഷണങ്ങൾ ശാരീരിക പ്രവർത്തനങ്ങൾ കുറയുന്നതിന് കാരണമാകുന്നു എന്നാണ്. എന്നിരുന്നാലും, ക്രോഡീകരണരീതി രൂപകല്പനയുടെ ദിശയെക്കുറിച്ചുള്ള അനുമാനങ്ങൾ തടയുന്നു, ശാരീരിക പ്രവർത്തനങ്ങൾ ശാരീരിക പ്രവർത്തന പങ്കാളിത്തത്തെ ബാധിക്കുന്നതിന്റെ ലക്ഷണങ്ങളെ സ്വാധീനിക്കും. ശാരീരിക പ്രവർത്തനവും, ലക്ഷണങ്ങളും തമ്മിലുള്ള ഒരു മിതമായ വിപരീത പരസ്പര ബന്ധത്തെ കണ്ടെത്തിയപ്പോൾ (r = -196) ശാരീരിക പ്രവർത്തനനിലവാരം വളരെ കുറവാണെങ്കിൽ കുറച്ചു ലക്ഷണങ്ങളെ സൂചിപ്പിക്കുന്നു. ശാരീരിക പ്രവർത്തനങ്ങളും ലക്ഷണങ്ങളും തമ്മിൽ ഒരു ദ്വിദിശയിലുള്ള ബന്ധം നിലനിന്നിരുന്നുവെന്നതിനുള്ള കാരണം എഴുത്തുകാരെ നയിച്ചു.

താഴെക്കൊടുത്തിരിക്കുന്ന ചോദ്യാവലി പഠനങ്ങളിൽ മോട്ടിലും സഹപ്രവർത്തകരും ശാരീരിക പ്രവർത്തികൾ (ഗോഡ്ൻ ലേഷേഴ്സ് ടൈം എക്സർസൈസ് സവ്ർണ്ണർ ആൻഡ് എക്സ്എംഎക്സ് എക്സ്പെക് ആക്സിലറോമീറ്റർ ഡാറ്റ), ലക്ഷണങ്ങൾ (സിംപ്റ്റം ഇൻവെൻററി, എംഎസ്സി സിംപ്രോം ചെക്ക്ലിസ്റ്റ്) എന്നിവയെ പ്രവർത്തനപരമായ പരിമിതികളും വൈകല്യവും (വൈകി-ലൈഫ് ഫങ്ഷൻ ആൻഡ് ഡിസെബബിലിറ്റി) ഇൻവെൻററി) 100 എം എസ് രോഗികൾക്ക് [മോൾൽ et al. 7, 133 ബി.]. നാഗി (2007) മുന്നോട്ടുവെച്ച ഡിമാൻഡ്മെന്റ് മോഡൽ അടിസ്ഥാനമാക്കിയുള്ള ഒരു മാതൃക പ്രൈമറി മോഡലായി പരിശോധിച്ചു. ശാരീരിക പ്രവർത്തനവും ലക്ഷണങ്ങളും മോശമായി പ്രതിഫലിപ്പിക്കുന്നതും (r = -2008) കൂടുതൽ ശാരീരിക പ്രവർത്തനങ്ങളുള്ളവർക്ക് കൂടുതൽ മെച്ചപ്പെട്ടതും (r = 1976 ). ശാരീരിക പ്രവർത്തനങ്ങൾ നാഗിയുടെ ഡിസെലെമെന്റ് മോഡൽ (നാഗിഎംഎക്സ്എക്സ്എക്സ്) അനുസരിച്ച് ശാരീരിക പ്രവർത്തനങ്ങൾ കുറഞ്ഞുവെന്ന വൈകല്യവുമായി ബന്ധപ്പെട്ടു പ്രവർത്തിക്കുന്നുവെന്നാണ് (എൻജി.എൻ.എൻ.എക്സ്.എക്സ്.) എന്നാൽ, വീണ്ടും ബന്ധങ്ങളുടെ ദിശയിൽ ക്രോസ്-സെക്ഷണൽ ഡിസൈൻ പരിമിതമായ കൃത്യമായ നിഗമനങ്ങൾ.

മുതലാളിയും സഹപ്രവർത്തകരും പിന്നീട് രേഖപ്പെടുത്തപ്പെട്ട ഒരു രേഖാധിഷ്ഠിത (കേസ് റിപ്പോർട്ട്) പഠനമനുസരിച്ച്, ലക്ഷണങ്ങൾ വഷളാകുകയും, ശാരീരിക പ്രവർത്തനങ്ങളുടെ വ്യാപ്തി 3- to- 5- ലും (മോട്ട് et al. 2008a]. MS പഠനത്തിന്റെ 51 വിഷയങ്ങളിലുള്ള ലക്ഷണങ്ങളിൽ (ഇന്റർനാഷണൽ ഫിസിക്കൽ ആക്റ്റിവിറ്റീസ് ആക്റ്റിവിറ്റീസ് [IPAQ]) എന്ന ലക്ഷണങ്ങളുടെ തകരാറുകൾ വളരെ ഗൗരവമായി ബന്ധപ്പെട്ടതാണ്. എം എസ് രോഗികൾക്കിടയിൽ ശാരീരിക നിഷ്ക്രിയാവസ്ഥയെ കുറിച്ചുള്ള ഒരു വിശദീകരണമായി രോഗലക്ഷണങ്ങൾ ലക്ഷ്യം വെക്കുന്നു, എന്നാൽ കാരണം, ആ ബന്ധവും ബന്ധവും തുടർന്നും സാധ്യമല്ല. ഫലങ്ങളുടെ അടിസ്ഥാനത്തിൽ ശാരീരിക പ്രവർത്തനങ്ങൾ പ്രോത്സാഹിപ്പിക്കുന്നതിന് മാനസിക രോഗലക്ഷണങ്ങൾ വളരെ പ്രധാനപ്പെട്ടതാണെന്ന് മാത്രമല്ല, ശാരീരിക പ്രവർത്തനങ്ങളുടെ മുൻകാല സംഭവവും തുടർന്ന് ലക്ഷണങ്ങൾ ഉണ്ടായിരിക്കുമെന്നും നിർദേശിക്കുന്നു.

അതിനു ശേഷം മോട്ടിലും സഹപ്രവർത്തകരും ശാരീരിക പ്രവർത്തനങ്ങളും നഴ്സുമാർക് വൈകല്യവും വൈകല്യവും തമ്മിലുള്ള സങ്കലനം പരിശോധിച്ചു ക്രോസ് സെക്ഷനറി പ്രസിദ്ധീകരിച്ചു. 80 സി]. ശാരീരിക പ്രവർത്തനവും (അൻപത് ദിവസം നീളുന്ന അക്സലേറ്റർ ദൈർഘ്യം), അസ്ഥിരവും വൈകല്യവും (സിംപ്റ്റം ഇൻവെൻററി, സ്വയം റിപ്പോർട്ട് ചെയ്തിട്ടുള്ള EDSS) അളക്കുകയും അളവറ്റ പ്രവർത്തനം, EDSS (r = -2008), സിംപ്റ്റം ഇൻവെൻററി (r = -7) . ശാരീരിക പ്രവർത്തനങ്ങൾ കുറഞ്ഞുവരുന്നുണ്ട് ന്യൂറോളജിക്കൽ വൈകല്യവും വൈകല്യവുമാണ്. എന്നാൽ പഠനത്തിൻറെ ക്രോസ്-സെക്ഷൻ സ്വഭാവം കാരണം ഏതെങ്കിലും ബന്ധം സ്ഥാപിക്കാനാകില്ലെന്നും അദ്ദേഹം പറഞ്ഞു.

പിന്നീട് മോൾ, മക്കയൂലി എന്നിവർ ശാരീരിക പ്രവർത്തനങ്ങളിലുള്ള മാറ്റങ്ങൾ (ഗോഡിനൽ ലയൽ ടൈം എക്സർസൈസ് സുവഹനീയവും എക്സ്എംഎക്സ് ആക്സിലറോമീറ്റർ ഡാറ്റയും), ലക്ഷണങ്ങൾ (സിംപ്റ്റം ഇൻവെൻററി, എം.എസ്. സിംപ്ലം സിംപോം ചെക്ക്ലിസ്റ്റ്) പരിമിതികളും വൈകല്യവും (അവസാന-ലൈഫ് ഫംഗ്ഷൻ ആൻഡ് ഡിസെബിലിറ്റി ഇൻവെൻററി) [മോൾൽ ആൻഡ് മക്കലൂലി, 7]. മൊത്തം എൺപത് എംഎസ് രോഗികൾ, എൺപത് മാസക്കാലം തുടർന്നു. നാഗി (2009) മുന്നോട്ടുവെച്ച ഡിസലമെന്റ് മാതൃകയെ അടിസ്ഥാനമാക്കിയുള്ള ഒരു മോഡൽ പ്രാഥമിക മാതൃകയായി പരിശോധിച്ചു. ശാരീരിക പ്രവർത്തനത്തിലെ മാറ്റം ചടങ്ങിൽ ബാക്കിയുള്ള മാറ്റങ്ങൾ (r = xNUMX) ബന്ധപ്പെടുത്തിയാണെന്നും ഇത് പ്രവർത്തനം വൈകല്യം (r = 292). ശാരീരികപ്രവർത്തനത്തിലുള്ള മാറ്റം നാഗിയുടെ അനായാസ മോഡുമായി പൊരുത്തപ്പെടുന്ന വൈകല്യത്തിലുള്ള മാറ്റം (പ്രവർത്തനവുമായി ബന്ധമുള്ള ഒരു ബന്ധം) ബന്ധപ്പെട്ടിരിക്കുന്നതാണെന്ന് കണ്ടെത്തലുകൾ സൂചിപ്പിക്കുന്നു, എന്നാൽ മറ്റു മോഡലുകൾ വിശകലനത്തിലും ഒരു കാരണമായ വ്യാഖ്യാനത്തിലും പ്രയോഗിക്കപ്പെടാറുണ്ട്, അതിനാൽ, ഇപ്പോഴും സ്വീകരിച്ചില്ല.

ഒരു മാസം നീളമുള്ള ഒരു നീണ്ട പഠനത്തിൽ മോട്ടലും സഹപ്രവർത്തകരും ശാരീരിക പ്രവർത്തികളിൽ (ഗോഡ്ൻ ലഷർ-ടൈം എക്സർസൈസ് സുവഹനീയവും ഇന്റർനാഷണൽ ഫിസിക്കൽ ആക്റ്റിവിറ്റിക്കൽ സുവഹനീയവും) ഗതാഗതക്കുരുക്കലിൽ ഒരു മാറ്റവുമായി ബന്ധപ്പെട്ടുണ്ടാകുമെന്ന സിദ്ധാന്തം പരീക്ഷിച്ചു (മൾട്ടിപ്പിൾ സ്ക്ലറോസിസ് വാക്കിംഗ് സ്കേൽ- 6 എസ്. എസ്. 12a]. ലൈനാർ പാനൽ വിശകലനവും കോവറിയൻസി മോഡലിങ്ങും ഉപയോഗിച്ച് 2011 MS രോഗികളിൽ നിന്നുമുള്ള വിവരങ്ങൾ വിശകലനം ചെയ്തു. ശാരീരിക പ്രവർത്തനത്തിൽ 263 ന്റെ വ്യതിചലനം ഒരു സ്റ്റാൻഡേർഡ് ഡീവിയേഷൻ യൂണിറ്റ് മാറ്റം ഒരു സ്റ്റാൻഡേർഡ് ഡീവിയേഷൻ യൂണിറ്റിനൊപ്പം ജ്വലിക്കുന്ന വൈകല്യത്തിൽ 1 ന്റെ ശേഷിക്കുന്ന മാറ്റവുമായി ബന്ധപ്പെട്ടതായി കണ്ടെത്തി. അതുകൊണ്ട് ഈ കണ്ടെത്തലുകൾ ശാരീരിക പ്രവർത്തനത്തെ ഒരു പ്രധാന സമീപനമായി പിന്തുണയ്ക്കുന്നു.

അവസാനമായി, ശാരീരിക പ്രവർത്തനങ്ങളിൽ മാറ്റം വരുത്തിയ (6- day ആക്സിലറോമീറ്റർ ഡാറ്റ), വൈകല്യ പ്രകടനത്തിലെ മാറ്റം (രോഗിയുടെ നിർണ്ണായകമായ രോഗ നടപടികൾ) സ്കെയിൽ (എം.എസ്.എൽ.എൽ) മക്യുലേ, 292]. ശാരീരിക പ്രവർത്തനത്തിലെ മാറ്റം വൈകല്യ പ്രകടനത്തിലെ മാറ്റം വഴി (പാത്ത് ഗുണകരം: -7) പാനൽ വിശകലനം കാണിക്കുന്നു. ഇത് ശാരീരിക പ്രവർത്തനങ്ങളിൽ ഒരു കുറവുണ്ടായത് എം.എസ്. വ്യക്തികളിലെ ഹ്രസ്വകാല വൈകല്യ പരിണാമത്തിൻറെ ഒരു പെരുമാറ്റച്ചവടവുമാണ് (പക്ഷേ ഒരു കാരണമല്ല).

അടുത്തകാലത്തായി, ജർമ്മൻ എം എസ് രോഗികൾക്കുള്ള 2 ജർമ്മൻ എം എസ് രോഗികളിൽ (സ്വയം റിപ്പോർട്ടുകൾ അടിസ്ഥാനമാക്കിയുള്ള) കഴിഞ്ഞ 15 വർഷക്കാലത്തെ സ്പോർട്സ് പ്രവർത്തനങ്ങൾ (ബെയ്ക്ക് ചോദ്യങ്ങൾ - സ്പോർട്സ് ഇൻഡെക്സ്), എം.എസ്. 632]. സ്പോർട്സ് സൂചികയുടെ അടിസ്ഥാനത്തിൽ നാലു ഗ്രൂപ്പായി രോഗികളെ വേർതിരിച്ചിരുന്നു. കഴിഞ്ഞ 18 വർഷങ്ങൾക്കുള്ളിൽ നാലു വീഴ്ചകളുടെ എണ്ണത്തെക്കുറിച്ച് നടത്തിയ പഠനങ്ങളിൽ നിന്നാണ് പഠനം നടത്തിയത്. എന്നിരുന്നാലും, ഏറ്റവും സജീവമായ ഗ്രൂപ്പിന് എല്ലാ വിഭാഗങ്ങളുടെയും താഴ്ന്ന അർഥം, സ്റ്റാൻഡേർഡ് ഡീവിയേഷൻ ഉണ്ടായിരുന്നു. ഈ വ്യത്യാസം അനുസരിച്ച്, വ്യായാമം പ്രതികൂല നിലപാടിനെ പ്രതികൂലമായി സ്വാധീനിക്കുന്നില്ലെന്നും ഡാറ്റ വീണ്ടും വരുമാനം കുറയ്ക്കുന്നതായും സൂചിപ്പിക്കുന്നു.

വ്യായാമം അല്ലെങ്കിൽ ശാരീരിക പ്രവർത്തനവും രോഗപ്രകടനവും (രോഗലക്ഷണങ്ങൾ, പ്രവർത്തന പരിമിതികൾ അല്ലെങ്കിൽ വൈകല്യം എന്നിവ) അല്ലെങ്കിൽ പ്രവർത്തനം (ശേഷിക്കുന്ന നിരക്ക്) എന്ന സങ്കീർണ്ണവും രോഗശാന്തിവുമായ നടപടികൾ, കൂടുതൽ സംരക്ഷണം നൽകുന്ന ശാരീരിക പ്രവർത്തനങ്ങളുമായി ബന്ധപ്പെടുത്തുന്നതിന്റെ തെളിവുകൾ നൽകുന്നു. എന്നിരുന്നാലും, പഠനത്തിന്റെ സ്വഭാവം കാരണം ഈ ബന്ധത്തിന്റെ കാരണവും സ്ഥാപിക്കപ്പെട്ടിട്ടില്ല.

അനിമൽ സ്റ്റഡീസിൽ രോഗപ്രയോഗം വിലയിരുത്തുക

എം.എസ്. രോഗികളിൽ രോഗം വർദ്ധിക്കുന്നതിനുള്ള പ്രവണത ഫലപ്രദമാണോ അല്ലയോ എന്നു വ്യക്തമാക്കുന്ന ഒരു മനുഷ്യ പഠനരീതി രൂപപ്പെടുത്തുന്നതിൽ ചില വ്യക്തമായ തന്ത്ര വിദഗ്ധർ ഉണ്ട്. അതുകൊണ്ട്, MS ലെ EAE മൃഗ മാതൃകയിൽ ചോദ്യം ഉന്നയിച്ചിട്ടുണ്ട്.

EAE [Le-Page et al al.] എന്ന ഒരു ഏജന്റുമൊത്ത് കുത്തി വച്ചതിന് ശേഷം, എ-ഇഇ എലികളുടെ നാലു ഗ്രൂപ്പുകളിലൊന്നായ ലീ-പേജും സഹപ്രവർത്തകരും പ്രാഥമിക പഠനത്തിലാണ് 1- 10]. എൻഡിൽ മൂന്ന് വ്യത്യസ്ത രോഗബാധമൂലങ്ങളുണ്ടായി. നിശിതം (എലികൾ അതിവേഗം വികസിച്ചുവെങ്കിലും ഗുരുതരമായ ചിഹ്നങ്ങളെ വികസിപ്പിച്ചെടുത്തു), മോണോപാഷിക് (എലികൾ ഒരു രോഗത്തിൻറെ തുടർച്ച മാത്രം തുടർന്ന് വികസിച്ചു), ദീർഘകാല പുനരാരംഭിക്കൽ (CR-EAE) , ഒന്നിൽ കൂടുതൽ രോഗം). CRU-EAE രോഗം കോഴ്സിന്റെ സ്വഭാവം ന്യൂറോണ്ടിഗൈൻസുമായുള്ള പ്രതിരോധം കഴിഞ്ഞ് 1994-10 ദിവസങ്ങൾക്ക് ശേഷവും ആദ്യ അസിസ്റ്റന്റ് അനായാസമായ ആക്രമണത്തിൻറെ വികസനം, അതിനുശേഷം സ്വാഭാവിക തിരിച്ചുള്ള വികാസത്തിന്റെ വികസനം എന്നിവയാണ്. ഒരു സ്ത്രീയും, പുരുഷന്മാരും, ആൺകുട്ടികളും, പുരുഷന്മാരും, പുരുഷന്മാരും. വ്യായാമം കഴിഞ്ഞ് 20 മുതൽ ദിവസം വരെ, ഒരു ട്രെഡ്മിൽ ഓട്ടം നടത്തുന്നത് ഉൾക്കൊള്ളുന്നു. 1 മുതൽ MINNUM വരെ മിനിറ്റിനും 10 മുതൽ 30 വരെ m / min വരെ വർദ്ധിക്കുന്ന വേഗതയിലും ഈ പ്രോട്ടോക്കോൾ ക്രമാനുഗതമായി ക്രമീകരിക്കപ്പെട്ടു. CR-EAE എലികളുടെ നിയന്ത്രണവുമായി താരതമ്യപ്പെടുത്തുമ്പോൾ, ഈ രണ്ട് രോഗികളുടെയും സി.ആർ.ഇ-ഇഎഇ എലികളിൽ രോഗം ആരംഭിക്കുന്നത് ഗണ്യമായി കുറയ്ക്കുമെന്ന് പഠനം വെളിപ്പെടുത്തി. കൂടാതെ, ആദ്യത്തെ പുനരാവിഷ്കരണത്തിന്റെ കാലാവധി നിയന്ത്രണത്തിലുള്ള എലികളുമായി താരതമ്യം ചെയ്യുമ്പോൾ സി.ഇ.ആർ-ഇഎഇ എലികളിൽ ഗണ്യമായ കുറവായിരുന്നു. അതേസമയം, രോഗം മൂർച്ഛിച്ചതിനെക്കുറിച്ച് യാതൊരു ഫലവും കാണാനില്ല. നിശിതവും രസതന്ത്രപരവുമായ EAE എലികളിൽ വ്യായാമത്തിന് ഒരു ഫലവുമില്ല. EAE- ന്റെ ഒരു ഘട്ടത്തിൽ EAE (CR-EAE) ലഘൂകരിക്കപ്പെടുന്ന ഘട്ടത്തിൽ എൻഡ്യൂറേഷൻ വ്യായാമങ്ങൾ കുറയുകയാണെന്നും അത് വ്യായാമം രോഗത്തെ കൂടുതൽ രൂക്ഷമാക്കാതിരിക്കുകയും ചെയ്തു.

പരിപൂരകമായ പഠനത്തിലൂടെ ല-പേജും സഹപ്രവർത്തകരും രചനാപരമായ EAE മോഡലിൽ നാല് പരീക്ഷണങ്ങൾ നടത്തി [ല-പേ. 1996]. എക്സ്ട്രൂമൻസിനും, എൺപത് ദിവസം തുടർച്ചയായ വ്യായാമങ്ങൾ (1-8 മില്ലി / ദിവസം) തുടർച്ചയായി വ്യായാമം ചെയ്തതിനു ശേഷം, എലികളുടെ എണ്ണത്തിൽ രോഗികളുടെ ക്ലിനിക്കൽ സൂചനകളിലൂടെ കുത്തിവച്ച ഫലം ഉണ്ടാകുന്നു. കൂടാതെ, രോഗത്തിൻറെയും ഏറ്റവും കൂടിയ തീവ്രതയുടേയും ദിവസം വ്യായാമം ചെയ്യപ്പെടുന്ന എലികളിൽ കാലതാമസമുണ്ടായി. എന്നാൽ, രോഗം നീണ്ടുനിൽക്കുന്ന അവസ്ഥയിൽ മാറ്റം വന്നിട്ടില്ല. ഇൻസുലിങിന് മുമ്പ് 2 ദിവസം തുടർച്ചയായി വ്യായാമങ്ങൾ നടത്തുമ്പോൾ ഒരു ഫലവുമുണ്ടായില്ല. 2- ഉം 250- ഉം ആയ പരീക്ഷണങ്ങളിൽ (എൺപത് മണി മുതൽ 25 മണിക്കൂർ വരെ), അല്ലെങ്കിൽ വേരിയബിൾ വേഗതയിൽ 300 ദിവസം കൂടുതൽ മിതമായ വ്യായാമം (2 മില്ലിമീറ്റർ മുതൽ 30 മില്ലി മീറ്റർ വരെ മൊത്തം മൊത്തം എൺപത് മണിക്കുറും) രോഗത്തിൻറെയും ക്ലിനിക്കൽ പരസ്ഥിതിയെ ബാധിച്ചു. രോഗം കോഴ്സിലും ക്ലിനിക്കൽ പാരാമീറ്ററുകളിലും യാതൊരു ഫലവുമുണ്ടായില്ല. മോഡറേറ്റസിൻറെ ഇഎഇഎയുടെ ഫലപ്രാപ്തിയെ കൂടുതൽ മിതമായ രീതിയിൽ വ്യായാമം ചെയ്യുന്നതിനേക്കാൾ കഠിനമായ വ്യായാമം കുറവാണെന്ന് പഠനം നടത്തിയവർ അഭിപ്രായപ്പെട്ടു. ഇഎഇഇയുടെ പ്രവർത്തനം ആരംഭിക്കുന്നതിന് മുൻപ് നടത്തിയ വ്യായാമത്തെ ക്ലിനിക്കൽ സൂചനകൾ കൂടുതൽ വഷളാക്കിയില്ല.

ഈയിടെ, റോസി, സഹപ്രവർത്തകർ തുടങ്ങിയവ സിആർ-ഇഎഇ എയ്സ് മോഡസിലെ രോഗം പുരോഗമനത്തിന് കാരണമായി. 2009]. ഈ പഠനത്തിൽ പ്രതിരോധസംരക്ഷണ ദിനത്തിൽ ഓടിക്കുന്ന ഒരു ചക്രം ഉൾക്കൊള്ളുന്ന ഒരു കൂട്ടം എലികൾ ഉണ്ടായിരുന്നു. നിയന്ത്രണ സംഘത്തിൽ പ്രവർത്തിക്കുന്നില്ല. ശാരീരിക പ്രവർത്തനങ്ങളുടെ അളവ് നിയന്ത്രിക്കപ്പെട്ടിട്ടില്ലാത്തതിനാൽ ഇത് ഇടപെടൽ ഉണ്ടാക്കുന്ന ചക്രത്തിൽ സ്വമേധയാ ശാരീരിക പ്രവർത്തനമുണ്ടായിരുന്നു. കൂടുതൽ പരീക്ഷണങ്ങളിൽ EAE എല ഇഞ്ചി എല എല എല എലസ് ​​എലസ് ​​പോസിറ്റിവ്ഡ്സ് ഇൻ പോൾഡ് ചക്രം. ചക്രം മൂലമുണ്ടാകുന്ന സെൻസറി എൻറോൾമെന്റിൽ നിന്ന് ശാരീരികപ്രവർത്തനത്തിന്റെ പങ്ക് എടുത്തുപറയുകയാണ് ചെയ്തത്, കൂടാതെ രോഗത്തിന്റെ ക്ലിനിക്കൽ കോഴ്സിനെ സ്വാധീനിക്കില്ലെന്നും ഇത് തെളിയിച്ചു. പ്രാരംഭ ഘട്ടത്തിൽ (ഇൻസ്പെക്ടിനു ശേഷമുള്ള എൺപത് ദിവസം), വ്യായാമം ചെയ്യപ്പെടുന്ന മൗസുകളിൽ, ശരാശരി 13 / ദിവസം വേഗതയിലുണ്ടാകുമ്പോൾ, ചക്രം തകരാറിലായപ്പോൾ ചക്രം പൂർത്തിയാക്കിയപ്പോൾ (760- 18 ദിവസങ്ങൾക്കുള്ളിൽ) ചക്രം പൂർത്തിയാക്കി. EAE ഇൻക്യുൻറേഷൻ കഴിഞ്ഞ് 20 ദിവസങ്ങൾ കഴിഞ്ഞ് EAE മൃഗങ്ങളുമായി താരതമ്യപ്പെടുത്തുമ്പോൾ, EAE- ന്റെ സമ്മർദ്ദം മൂലം, EAE- യുടെ ശാരീരികവും ചലനാത്മകവുമായ ഘട്ടങ്ങളിൽ EAE- . കൂടാതെ, EAE ഉണ്ടാക്കിയ സിനാപ്റ്റിക് ആൻഡ് ഡൻഡറിക് വൈകല്യങ്ങൾ ശാരീരിക പ്രവർത്തനത്താൽ ശോഷിച്ചതായി കാണപ്പെട്ടു.

ചുരുക്കത്തിൽ, എയ്റോബിക് വ്യായാമം (അല്ലെങ്കിൽ വൊളണ്ടറി ശാരീരിക പ്രവർത്തനം) എം എ യുടെ ഇലക്ട്രിക് മോഡലിൽ രോഗം ക്ലിനിക്കൽ കോഴ്സിനെ സ്വാധീനിക്കാനുള്ള ശേഷി ഉണ്ട്.

ഡോ ജിമനെസ് വൈറ്റ് കോട്ട്
ശാരീരിക പ്രവർത്തനങ്ങളിലും വ്യായാമങ്ങളിലും പങ്കെടുക്കുന്നത് എല്ലാവർക്കും, പ്രത്യേകിച്ച് മൾട്ടി സ്ക്ലിറോസിസ്, അല്ലെങ്കിൽ എം.എസ്. മൾട്ടിപ്പിൾ സ്ക്ലിറോസിസ് ലക്ഷണങ്ങൾ കുറയ്ക്കുവാൻ വ്യായാമം സഹായിക്കുമെങ്കിലും, രോഗികൾക്ക് വ്യായാമശേഷി വർദ്ധിപ്പിക്കേണ്ടതുണ്ട്. ഈ ലേഖനത്തിൽ ചർച്ച ചെയ്ത ഒരാളെപ്പോലുള്ള പല ഗവേഷണ പഠനങ്ങൾക്കും വ്യായാമം, വ്യായാമങ്ങൾ എന്നിവ കുറയ്ക്കാൻ സഹായിക്കും. മൾട്ടിപ്പിൾ സ്ക്ലിറോസിസ് പുരോഗമനത്തിനു താഴെയായി. ഏറ്റവും മികച്ചതാക്കാൻ ഓരോ വർക്ക്ഔട്ട് പരിപാടിയുടെയും വിശദാംശങ്ങൾ ചർച്ച ചെയ്യാൻ ഒരു ഹെൽത്ത് കെയർ പ്രൊഫഷണലോട് സംസാരിക്കേണ്ടത് അത്യാവശ്യമാണ് എം.എസ്. ഡോ. അലക്സ് ജിമനേസ് DC, CCST

സംവാദം

അലസിപ്പിക്കലില്ലാത്തതും രോഗിക്ക് റിപ്പോർട്ട് ചെയ്തതുമായി ബന്ധപ്പെട്ട പഠനങ്ങൾ, എം എസിന്റെ മൃഗചികിത്സാ മാതൃകയിൽ പ്രയോഗിക്കുന്ന പഠനങ്ങൾ എന്നിവയിൽ നിന്നുള്ള സമീപകാല തെളിവുകൾ, വ്യായാമത്തിന്റെ (അല്ലെങ്കിൽ ശാരീരിക പ്രവർത്തനങ്ങൾ) ഫലപ്രദമാക്കൽ ഫലം സൂചിപ്പിക്കുന്നു, എന്നാൽ തെളിവുകളുടെ ഉറവിടം കൃത്യമായ നിഗമനങ്ങളിലേക്ക് പരിമിതപ്പെടുത്തുന്നു. കൂടാതെ, ഈ കണ്ടെത്തലുകൾ ക്ലിനിക്കൽ ഫലവത്തായ നടപടികളിലൂടെ രോഗം പുരോഗമന മൂല്യപരിശോധനയിൽ സ്ഥിരീകരിക്കപ്പെടുന്നില്ല. വ്യക്തമായ ബുദ്ധിമുട്ടുകൾ ഉണ്ടായിട്ടും ദീർഘദൂര വ്യായാമ പഠന ശേഷിയുള്ള എംഎസ് രോഗികളിൽ പഠന ഇടപെടലുകൾ ഈ മേഖലയിൽ ആവശ്യമാണ്.

എം എസ് ഡിസീസ് പ്രോഗ്രസ്സ്

എം.എസ്. രോഗം പുരോഗതിയുണ്ടാക്കാൻ ശ്രമിക്കുമ്പോൾ ചില പ്രധാന രീതിശാസ്ത്ര പ്രശ്നങ്ങൾ ഉണ്ടാകാം. മികച്ച എം.എസ്. ഫലപ്രാപ്തി നിർവ്വഹിക്കാൻ കഴിയാത്ത രോഗത്തെ പുരോഗമനത്തിനിടയാക്കുമെങ്കിലും, ഇത് MS ൽ വളരെ പ്രയാസകരമാണ്. MS ന്റെ ശുദ്ധമായ ആവിഷ്ക്കാരം രോഗം എല്ലാ വശങ്ങളും കണക്കാക്കാൻ അതിനെ വെല്ലുവിളിക്കുന്നു, ഇത് പ്രത്യേക ലക്ഷണങ്ങളിൽ ശ്രദ്ധ കേന്ദ്രീകരിക്കുകയും വേണം. കൂടാതെ, രോഗബാധിതമായ രോഗാവസ്ഥയിലും, പുരോഗമനത്തിനായുള്ള ജനസംഖ്യാപരമായ വൈകല്യവും, കാലക്രമേണ വൈകല്യ പ്രകടനത്തിൽ അനിശ്ചിതമായ പ്രഭാവം, ബഹുമുഖമായ നരോളിക അവധികൾ, വ്യക്തിഗത രോഗികൾക്ക് നഷ്ടപരിഹാരം നൽകൽ, രോഗികളുടെ കോമോർബിഡിറ്റികൾ എന്നിവ കൂടുതൽ സങ്കീർണമാക്കുക. [ഗോൾഡ്മാൻ et al. 2010].

ക്ലിനിക്കൽ ഫലങ്ങളുടെ നടപടികൾ

ഇഎസ്എസ്എസ്, എംഎസ്എഫ്സി, റിനാപ്പ്സ് റേറ്റ് തുടങ്ങിയവയാണ് എം.എസ്. ചികിത്സാ പരിശോധനകൾക്കുള്ള ഏറ്റവും സാധാരണമായ ചികിത്സാരീതികൾ. 2010]. വ്യായാമ പഠനങ്ങൾ (പ്രതിരോധം, സഹിഷ്ണുതം, സംയുക്ത പരിശീലനം) ഇഡ്എസ്എസ് ഉപയോഗിക്കുന്നത് പൊതുവേ ഒരു വ്യായാമം ഇടപെട്ടതിനുശേഷം യാതൊരു മാറ്റവും റിപ്പോർട്ട് ചെയ്യില്ലെന്ന് ഞങ്ങളുടെ സാഹിത്യ അവലോകനം തെളിയിക്കുന്നു. EDSS പ്രയോഗിക്കുന്ന മെഡിക്കൽ പഠനങ്ങളിൽ, ചികിത്സാരീതിയും പ്ലേബോയും [Bates, 2] തമ്മിലുള്ള വ്യത്യാസ പരിവർത്തനങ്ങളിലെ അളവുകൾ അളക്കാൻ XMLX-XNUM വർഷങ്ങൾ നീളുന്ന വലിയ സാമ്പിൾ വലുപ്പങ്ങളും ഇടപെടലുകളും നടത്തേണ്ടതുണ്ട്. ഇത് ഹ്രസ്വമായ ഇടപെടൽ കാലയളവുകൾ (3-2011 ആഴ്ചകൾ) മോശമായാണു സൂചിപ്പിക്കുന്നത്, മാത്രമല്ല മിക്ക വ്യായാമ പഠനങ്ങളിലും പ്രയോഗിച്ച ചെറിയ സാമ്പിൾ വലുപ്പങ്ങൾ. നിരവധി പഠനങ്ങളിൽ റിപ്പോർട്ടുചെയ്തത് പോലെ EDSS ന്റെ പരിവർത്തനത്തിന്റെ മൊത്തത്തിലുള്ള പ്രതികരണവും സെൻസിറ്റിവിറ്റിയും ഇതിന് കാരണം ആണ് (റഫറൻസുകൾക്കായി ഗോൾഡ്മാനും മറ്റുള്ളവരും [3] കാണുക). കൂടാതെ, EDSS അതിന്റെ അപ്രതീക്ഷിതമായ സ്കെയിലിംഗും, അമ്യൂബ്ലേഷൻ സ്റ്റാറ്റസിനു പ്രാധാന്യം നൽകിയും, ആവശ്യമായ ബുദ്ധി, വിഷ്വൽ ഘടകങ്ങളുടെ അഭാവത്തിൽ വിമർശിക്കപ്പെട്ടു. [ബൽസ്റ്റർ, 26]. വ്യായാമത്തിന് പ്രാധാന്യം നൽകിയിട്ടും, സമീപകാലത്തെ മെറ്റൽ വിശകലനം നടത്തിയത്, വ്യായാമത്തിന്റെ ഫലമായ വ്യായാമങ്ങൾ [സ്നൂക്ക് ആൻഡ് മോൾ, 2010], വ്യായാമത്തിന്റെ ഇടപെടലുകളെ കുറിച്ചുള്ള താഴ്ന്ന പ്രതികരണത്തെ സൂചിപ്പിക്കുന്ന മിക്ക പഠനങ്ങളിലും EDSS ൽ മാറ്റമൊന്നും വന്നിട്ടില്ല. ക്ലിനിക്കൽ പരീക്ഷണങ്ങളിൽ, EDSS (ഗോൾഡ്മാൻ et al. 2001]. EDSS, MSFC എന്നിവ പ്രയോഗിക്കുന്ന ഒരു വ്യായാമ പഠനത്തിൽ നിന്നും ഈ നിർദ്ദേശം പിന്തുണയ്ക്കുന്നു. ഈ ദീർഘകാല പഠനത്തിൽ (2009 ആഴ്ച) [റോബർഗ്ഗ് et al. 2010] EDSS, MSFC എന്നിവയിൽ സംയോജിത പരിശീലനത്തിന്റെ ഫലങ്ങൾ വിലയിരുത്തി. എം.എസ്.എഫ്.സി മാത്രമാണ് കാര്യമായ സ്വാധീനം ചെലുത്തിയത്. എംഎസ്എഫ്സി സംയുക്തത്തെ ഫലപ്രദമായി ഉപയോഗപ്പെടുത്തി ഫലപ്രാപ്തിയുടെ അഭാവത്തെ കണ്ടെത്തുന്നതിലും ഇഎസ്എസ്എസുകളെ അപേക്ഷിച്ച് കൂടുതൽ സെൻസിറ്റീവ് ആണെന്ന് അഭിപ്രായപ്പെട്ടു. ഭാവിയിലെ വ്യായാമചലനങ്ങളിൽ, രോഗം പുരോഗതിയുണ്ടെങ്കിൽ അത് എം.എസ്.എഫ്.സി ഒരു ക്ലിനിക്കൽ ഫലമായി അളക്കേണ്ടതായി പരിഗണിക്കണം.

താഴ്ന്ന പ്രതികരണങ്ങളോടൊപ്പം, ഹൃസ്വകാല ഇടപെടലുകൾക്കും, ചെറിയ സാമ്പിൾ വലുപ്പവും, മറ്റു വിശകലനങ്ങൾ, വിശകലനം ചെയ്യുന്നതിനുള്ള നടപടികളുടെ ഫലമായി ഉണ്ടാകുന്ന പൊതു അവ്യക്തതകൾ പരികല്പനപ്പെടുത്തുന്നു. നിലവിലുള്ള ഡാറ്റയിൽ വ്യക്തമായ പാറ്റേൺ പോലുമില്ലാതെ വ്യായാമത്തിന്റെ (ഉദാഹരണത്തിന് എൻഡുറൻസ് ആൻഡ് റസിസ്റ്റൻസ് ട്രെയിനിംഗ്) ക്ലിനിക്കൽ സ്കെയിലിൽ നിന്ന് പിടിച്ചെടുത്ത ഫലത്തെ സ്വാധീനിക്കാം. കൂടാതെ, മിക്ക പഠനങ്ങളും മിതമായ നിലവാരമുള്ള (EDSS <6) എംഎസ് രോഗികളെ വിലയിരുത്തുകയും ചെയ്യുന്നു. ശാരീരികമായി ബുദ്ധിമുട്ടുള്ള രോഗികളിൽ മാറ്റം വരുത്തുന്നതിന് ക്ലിനിക്കൽ സ്കെയിലുകൾ കൂടുതൽ ബോധവൽക്കരണമായിരിക്കാം. അവസാനമായി, വ്യായാമ പഠനത്തിൽ എൻറോൾ ചെയ്യുന്ന അംഗീകൃത ശാരീരിക ക്ഷമതയുള്ള രോഗികളാണെങ്കിൽ കണ്ടെത്തലുകൾ പക്ഷപാതപരമായിരിക്കില്ല. അങ്ങനെയെങ്കിൽ, ഈ രോഗികളിൽ അടിവയൽ ഫിറ്റ്നസ് ലെവൽ ശരാശരിക്ക് മുകളിലായിരിക്കുമെന്ന് ഡോക്ടർമാർ പറഞ്ഞു.

കുറച്ച് പഠനങ്ങൾ മാത്രമാണ് [ജർണനോട്ടൊടിർ et al. 2007; പെടാജൻ et al. 1996; റോബർഗ്ഗ് et al. 2004; വൈറ്റ് et al. 2004] തുടർന്നു്, റിപപ്ഴ്സ് റേറ്റിൽ വ്യക്തമായ ഡാറ്റ, പക്ഷേ ചെറിയ ഇടപെടൽ കാലഘട്ടങ്ങളും ചെറിയ പഠന വലിപ്പത്തിലുള്ള അനേകം പഠനങ്ങളും റിലേപ്സ് റേറ്റിൽ മാറ്റം വരുത്തിയാൽ, വ്യക്തമാകയില്ല. എന്നാൽ, എൺപതോളം മാസത്തെ ഇടവേളയിൽ, റോംബർഗും സഹപ്രവർത്തകരും, ആകെ തന്നെ, എൺപത് റിസപ്ഷനുകൾ (സംയുക്ത പരിശീലന സംഘത്തിൽ അഞ്ചും കൺട്രോൾ ഗ്രൂപ്പിൽ ആറുപേർ) കണ്ടു. 11]. അതുപോലെ, പീറ്റാജനും സഹപ്രവർത്തകരും (എൻഡുറൻസ് ട്രെയിനിങ് ഗ്രൂപ്പ് നാല് പുനർവിപണനങ്ങളും നിയന്ത്രണ ഗ്രൂപ്പുകളും മൂന്ന് വീഴ്ചകളുമുണ്ട്) [പീറ്റജൻ et al. 6] Bjarnadottir ഉം സഹപ്രവർത്തകരും (സംയുക്ത പരിശീലന സംഘം ഒരു പുനരധിവാസം, നിയന്ത്രണ സംഘം ഒരു പുനരധിവാസം) [Bjarnadottir et al. വ്യായാമം, നിയന്ത്രണ ഗ്രൂപ്പുകളിൽ സമാനമായ റീസെപ്റ്റ് നിരക്ക് റിപ്പോർട്ടുചെയ്തു. വെള്ളയും സഹപ്രവർത്തകരും നടത്തിയ പഠനത്തിൽ, പ്രതിരോധ പരിശീലനം മൂല്യനിർണയം നടത്തുന്ന XXX- 2004]. അടുത്തിടെ, ടെൽനറും സഹപ്രവർത്തകരും, സ്വാഭാവിക റിപ്പോർട്ടിംഗും അടക്കമുള്ള പ്രവർത്തനങ്ങളും, എംഎസ് രോഗികളിൽ നിന്നുമുള്ള ശാരീരിക പ്രവർത്തനങ്ങൾ ശേഖരിച്ചു. 1996]. ഈ വിവരങ്ങളെ അടിസ്ഥാനമാക്കി, വ്യായാമങ്ങൾ ക്ലിനിക്കൽ രോഗത്തെ സംബന്ധിച്ചിടത്തോളം വലിയ സ്വാധീനം ചെലുത്തിയിട്ടില്ലെന്ന് അഭിപ്രായപ്പെട്ടു. നിലവിലുള്ള ഏതാനും വിവരങ്ങൾ കൂടി കണക്കിലെടുക്കുമ്പോൾ എംഎസ് രോഗികളിൽ ഏതെങ്കിലും തരത്തിലുള്ള വ്യായാമം വർദ്ധനവ് വരുത്തുമെന്ന് സൂചിപ്പിക്കുന്നില്ല. എന്നിരുന്നാലും, ഈ ഡാറ്റ ചെറിയ അളവിൽ പങ്കെടുക്കുന്നവർ (രോഗത്തിൻറെ തരം അല്ലെങ്കിൽ തീവ്രതയെ അടിസ്ഥാനപ്പെടുത്തിയിരുന്നില്ല), മിക്ക പഠനങ്ങളിലും ഹ്രസ്വമായ ഇടപെടൽ കാലതാമസങ്ങൾ കാരണം മുന്നറിയിപ്പ് നൽകണം. അതിനാൽ, പങ്കെടുക്കുന്നവരിൽ ഏറിയ പങ്കും ദീർഘകാല പഠനങ്ങൾ ഫലമായുണ്ടാകുമ്പോൾ, റിപ്ലാസ് റേറ്റ് ഒരു അനന്തര ഫലമായി നൽകണം.

നോൺക്ലിനിക് മെഷീൻസ്

എം.ആർ.ഐ.യുടെ ഉപയോഗം എം.എസ്. ബാർ-സോഹാർ മറ്റു രോഗികളുമായി രോഗനിർണ്ണയവും മാനേജ്മെന്റും വിപ്ലവകരമായിരിക്കുന്നു. 2008]. ക്ലിനിക്കൽ പരീക്ഷണങ്ങളെ സംബന്ധിച്ച്, എം.ആർ.ഐ, എംഎസ്ഐ സ്വീകരിച്ച ക്ലിനിക്കൽ ഫലവത്തായ നടപടികളിലൂടെ നിരവധി നേട്ടങ്ങൾ വാഗ്ദാനം ചെയ്യുന്നുണ്ട്, രോഗം സംബന്ധിച്ച പ്രവർത്തനക്ഷമത വർദ്ധിച്ചുവരുന്ന സംവേദനക്ഷമതയും ഹിസ്റ്റോപത്തോളജി കണ്ടെത്തലുകളുമായി മികച്ച ബന്ധവും. കൂടാതെ, എംആർഐ ഓർഡിനൽ സ്കെയിലുകളിൽ കൂടുതൽ പുനർനിർമ്മിതമായ മാർഗ്ഗങ്ങൾ നൽകുന്നു, എംആർഐയുടെ മൂല്യനിർണയം പരമാവധി അന്ധമായ അന്ധതയിൽ നടത്താൻ കഴിയുന്നു [ബാർ-സോഹാർ et al. 2008]. ഗര്ണിക്കലിനുള്ള പ്രവര്ത്തനങ്ങള് (ഗാഡോളിനിയം-ഇന്ഹാന്സ്ഡ് ലസണ്സ്, ന്യൂഗ്രൂഡക്സ്, ഹൈപ്ടിന്റണ്ന്സിസ് ലയോഷ്യന്റ്സ്), രോഗം തീവ്രത (മൊത്തം T2- ഹൈപ്പര്ടൈന്ഡന്സ് ലയര് വോള്യം, മൊത്തം T2- ഹൈപ്പിന്സെന്സസ് ലയന്റ് വോളിയം, മുഴുവന്-ബ്രെയിൻ അറ്റപോര്ട്ട്) തുടങ്ങിയ പ്രതിരോധം MRI അളവ് പ്രതിഫലിപ്പിക്കുന്നു. ബേർമൽ et al. 1] രോഗപ്രതിരോധം വ്യായാമം ചികിത്സ ഫലപ്രദമായി വിലയിരുത്താൻ ആവശ്യമായ സാമ്പിൾ വലുപ്പങ്ങൾ കുറയ്ക്കും. ഈ തരത്തിലുള്ള പഠനത്തിൽ നിന്നും വരാൻ കഴിയുന്ന നിഗമനങ്ങളെ പരിമിതപ്പെടുത്തുന്ന വ്യത്യസ്ത എംആർഐ പരിപാടികളിൽ രണ്ട് ക്രോസ്-സെക്ഷണൽ പഠനങ്ങൾ മാത്രമാണ് വ്യായാമത്തിന്റെ പ്രഭാവം വിലയിരുത്തിയിട്ടുള്ളത് (ഇപ്പോഴത്തെ കാർഡിയോറോരോസ്ററേറ്ററി ഫിറ്റ്നസ് തലത്തിൽ രേഖപ്പെടുത്തിയിരിക്കുന്നു). എന്നിരുന്നാലും, പ്രോത്സാഹന കണ്ടെത്തലുകൾ MRI യുടെ ഫലവത്തായ അളവുകോൽ, രോഗം പുരോഗമനത്തിനായുള്ള വ്യായാമത്തിന്റെ ഫലങ്ങളെ വിലയിരുത്തുന്ന ഭാവി ദീർഘവീക്ഷണ പരീക്ഷണങ്ങളിൽ ഉൾപ്പെടുത്താൻ പ്രോത്സാഹിപ്പിക്കുന്നു.

രോഗി-റിപ്പോർട്ട് ചെയ്യപ്പെടുന്ന നടപടികൾ

വ്യായാമം അല്ലെങ്കിൽ ശാരീരിക പ്രവർത്തനവും രോഗപ്രകടനവും (രോഗലക്ഷണങ്ങൾ, പ്രവർത്തന പരിമിതികൾ അല്ലെങ്കിൽ വൈകല്യം എന്നിവയെന്ന് സൂചിപ്പിക്കുന്ന) തമ്മിലുള്ള ബന്ധത്തിന്റെ രോഗചികിത്സ റിപ്പോർട്ടുകൾ കൂടുതൽ സംരക്ഷണം നൽകിക്കൊണ്ട് കൂടുതൽ ശാരീരിക പ്രവർത്തനങ്ങളുമായി ബന്ധപ്പെടുത്തുന്നതായി തെളിയിക്കുന്നു. എങ്കിലും, പഠനത്തിന്റെ സ്വഭാവം ഈ അസോസിയേഷന്റെ കാരണത്തെക്കുറിച്ച് നിഗമനങ്ങൾ അനുവദിക്കുന്നില്ല. രോഗനിർണ്ണയ റിപ്പോർട്ടുകൾ പ്രയോഗിക്കുന്ന പഠന ഗവേഷണത്തിൽ ഞങ്ങൾ വ്യായാമത്തിന്റെ അളവുകൾ മാത്രമല്ല, ശാരീരിക പ്രവർത്തനങ്ങളുടെ അളവുകളും ഉൾപ്പെടുത്താൻ തീരുമാനിച്ചു. വ്യായാമത്തിന്റെ അളവ് ഒരു വ്യായാമത്തിന്റെ അളവുകോലല്ല എന്ന കാര്യം അംഗീകരിക്കുന്നുണ്ട്. പക്ഷേ, മോട്ടിയുടെയും സഹപ്രവർത്തകരുടെയും പ്രത്യേകമായ നിരവധി കണ്ടെത്തലുകൾ ഇതായിരുന്നു. അടുത്തിടെ നടത്തിയ ഒരു പ്രബന്ധത്തിൽ, തങ്ങളുടെ പഠനങ്ങളെ അടിസ്ഥാനമാക്കി, അടുത്തകാലത്തെ ഗവേഷണം എം.എസ്. വൈകല്യത്തിന്റെ പെരുമാറ്റ വൈരുദ്ധ്യം എന്ന നിലയിൽ ശാരീരിക പ്രവർത്തനങ്ങളെ തിരിച്ചറിഞ്ഞിട്ടുണ്ടെന്ന് മോൾവും സഹപ്രവർത്തകരും അഭിപ്രായപ്പെടുന്നു. എം.എസ്., പ്രത്യേകിച്ച് അസാധാരണമായ വൈകല്യത്തിന്റെ (EDSS> 4) മാനദണ്ഡങ്ങൾ കൈവരിച്ചവർ, ശാരീരിക പ്രവർത്തനങ്ങൾ മെച്ചപ്പെടുത്തുന്നതിലൂടെ, ശാരീരിക പ്രവർത്തനങ്ങൾ 'മൊബിലിറ്റി വൈകല്യം' എന്നു വിളിക്കുന്നതിന്റെ പുരോഗതിയെ ഇത് സ്വാധീനിക്കാറുണ്ട്. . കൂടുതൽ അപ്രാപ്തമാക്കിയത് (EDSS> 2010) എം എസ് രോഗികൾക്ക് തെറാപ്പി നൽകാനുള്ള ചെലവ് കൂടുതൽ ഫലപ്രദമാകാം, എന്നാൽ മിക്ക വ്യായാമവും പഠിക്കുന്നത് പരിശീലന അനുപാതത്തിനും നഴ്സുബല വൈകല്യത്തിനും ഉള്ള ബന്ധത്തെ സൂചിപ്പിക്കുന്നില്ല എന്നാണ്. കൂടുതൽ പഠനങ്ങൾ സൂചിപ്പിക്കുന്നത്, XMS ന് താഴെയുള്ള EDSS സ്കോർ ഉള്ള MS രോഗികൾ കൂടുതൽ വികലാംഗ എംഎസ് രോഗികളുമായി താരതമ്യം ചെയ്യുമ്പോൾ വലിയ മെച്ചപ്പെടുത്തൽ അനുഭവപ്പെടുന്നു [Ponichtera-Mulcare et al. 4; ഷാപ്പിറോ തുടങ്ങിയവരും. 4.5] അല്ലെങ്കിൽ വ്യത്യാസങ്ങൾ ഇല്ലെന്ന് [പീറ്റജൻ et al. 1997]. വൈകല്യത്തിന്റെ വിവിധ തലങ്ങളിലുള്ള എംഎസ് രോഗികളിലെ വ്യായാമത്തിന്റെ ഫലങ്ങളെ വിലയിരുത്തുന്നതിന് ഈ പഠനങ്ങളിൽ ഒന്നുപോലും ഊർജ്ജിതമാക്കിയതായി ശ്രദ്ധിക്കേണ്ടതുണ്ട്. എന്നാൽ, വൈകല്യത്തിന്റെ വിവിധ തലങ്ങളിലുള്ള MS രോഗികളിൽ 1988 മാസത്തെ പ്രതിരോധ പരിശീലനം മെച്ചപ്പെടുത്തുന്നുണ്ടോ എന്ന് ഫിഫിയും സഹപ്രവർത്തകരും അടുത്തിടെ നടത്തിയ ഒരു പഠനത്തിൽ വ്യക്തമാക്കുന്നു. എം എസ് ഉൾപ്പെടെയുള്ള എല്ലാ വ്യക്തികളും വ്യത്യസ്ത വൈകല്യങ്ങളില്ലാത്തവയാണെങ്കിലും സമാന്തരമായി മസിൽ ശക്തി [ഫിലിപ്പ്, അൽ. 1996]. ഇത് നിർദ്ദേശത്തിന് വഴിയൊരുക്കുന്നു, രോഗത്തിൻറെ ആദ്യഘട്ട ഘട്ടങ്ങളിലും രോഗിയുടെ വളർച്ചയെ ബാധിക്കുന്ന കാര്യത്തിലും ഈ വ്യായാമം ഒരുപോലെ പ്രധാനമാണ്.

ദീർഘകാല പഠനങ്ങളിൽ വലിയ സാമ്പിൾ സൈറ്റുകളിൽ നിന്നും വിവരങ്ങൾ ശേഖരിക്കുന്നതിനുള്ള അവസരം രോഗപ്രതിരോധ നടപടികൾ പ്രയോഗിക്കുന്നതിന്റെ ഒരു പ്രധാന നേട്ടമാണ്. കൂടാതെ, രോഗം പുരോഗമനത്തിന് വ്യായാമത്തിന്റെ ഫലങ്ങളെ വിലയിരുത്തുമ്പോൾ രോഗിയുടെ കാഴ്ചപ്പാടിലെ വിവരങ്ങൾ ശേഖരിക്കേണ്ടത് പ്രധാനമാണ്. രോഗബാധിതമായ നടപടികൾ ഉൾപ്പെടുന്ന ഭാവിയിൽ നടത്തുന്ന പഠനങ്ങളിൽ, സാധ്യമെങ്കിൽ, ക്ലിനിക്കൽ കൂടാതെ / അല്ലെങ്കിൽ നോൺക്ലിനിറ്റിക്കൽ നടപടിക്രമ നടപടികൾ ഉൾപ്പെടുത്തണം.

ആനിമൽ സ്റ്റഡീസ്

എയ്റോബിക് വ്യായാമം (അല്ലെങ്കിൽ പ്രവർത്തനങ്ങൾക്ക്) എം എ യുടെ മൃഗചികിത്സാ വിദഗ്ധയിൽ രോഗം ക്ലിനിക്കൽ കോഴ്സിനെ സ്വാധീനിക്കാനുള്ള ശേഷിയുണ്ടെന്ന് ഞങ്ങളുടെ അവലോകനം തെളിയിച്ചു. വ്യക്തമായി ചോദിക്കുന്ന ചോദ്യമാണ് എം എസിന്റെ ഇഎംഇ മൃഗ മാതൃകയിൽ നിന്നുള്ള കണ്ടെത്തലുകൾ മാനുഷികമാക്കുവാൻ സാധിക്കുകയാണോ എന്നത്. ഇപ്പോൾ ഈ ചോദ്യത്തിന് വ്യക്തമായ ഉത്തരം നൽകാനാവില്ല. EAE പഠനങ്ങളുടെ ഫലമായി നിലവിലെ രോഗം പരിഷ്ക്കരിക്കുന്ന ചികിത്സകളെ ന്യായീകരിക്കുമോ എന്ന സമീപകാല അവലോകനം അവലോകനം ചെയ്തു. ഇഎഇഇ തീർച്ചയായും എം.എസ്. ഒരു അപൂർണ കണ്ണാടമാണെങ്കിലും അനേകം ക്ലിനിക്കൽ, ഇമ്മ്യൂണോപത്തോളജിക്കൽ, ഹിസ്റ്റോളജിക്കൽ കണ്ടെത്തലുകൾ എന്നിവ മൃഗം മോഡലുകളാൽ ആകർഷണീയമാവുന്നു. എം.എസ്സിന്റെ അടിസ്ഥാന രോഗപ്രതിരോധ സംവിധാനങ്ങളെ വിശദീകരിക്കാനും, നൂതന തെറാപ്പിക്ക് പരീക്ഷണഘട്ടത്തിൽ ഏർപ്പെടുത്താനും ഇഎഇഇ വിലമതിക്കുന്നു. et al. 2010]. തൽഫലമായി, കണ്ടെത്തലുകൾ മനുഷ്യാവയവങ്ങളെ നേരിട്ട് കൈമാറ്റം ചെയ്യാൻ കഴിയില്ല, പക്ഷേ സങ്കീർണ്ണമായ സിദ്ധാന്തങ്ങൾ പരീക്ഷിക്കുന്നത് ഇവിടെ തുടങ്ങാം. കൂടാതെ, EAE ൽ നിങ്ങൾക്ക് പരമാവധി വ്യായാമം പരിശോധന (VO2 പരമാവധി പരീക്ഷണം പോലെയുള്ളവ) നടത്താൻ കഴിയാത്തതിനാൽ ആപേക്ഷികമായ വ്യായാമത്തെ നിയന്ത്രിക്കാൻ കഴിയില്ല. അനന്തരഫലമായി, ആപേക്ഷികമായ ആപേക്ഷിക വ്യായാമങ്ങൾ മൃഗങ്ങൾ തമ്മിൽ വ്യത്യാസപ്പെട്ടിരിക്കാം. EAE ലെ എയറോബിക് ശേഷിയിൽ എയറോബിക് വ്യായാമത്തിന്റെ ഫലങ്ങളെ വിലയിരുത്തുന്നത് വളരെ പ്രയാസകരമാണ്. എന്നിരുന്നാലും, മനുഷ്യ പഠനവുമായി താരതമ്യപ്പെടുത്തുമ്പോൾ ഇ എഇ മോഡൽ നിരവധി ഗുണങ്ങൾ നൽകുന്നുണ്ട്. കുറഞ്ഞ ചെലവുകൾ കൂടാതെ, ഇടപെടലിനും നിയന്ത്രിത പരിസ്ഥിതിക്കും ജനിതക ഘടകങ്ങൾക്കും അനുസൃതമായി എളുപ്പത്തിലുള്ള നിയന്ത്രണം EAE മാതൃക, ഭാവിയിൽ പഠനങ്ങളിൽ ശ്രദ്ധ കേന്ദ്രീകരിക്കുന്ന കേന്ദ്ര നരാസസ് സിസ്റ്റത്തിൽ (സിഎൻഎസ്) സ്ഥിതി ചെയ്യുന്ന സംവിധാനങ്ങളെ വിലയിരുത്തും. മറ്റൊരു അവലോകനം, എം.എസ്. ജനസംഖ്യയിൽ വളരെ നിർണായകമായ ജനിതക വൈറസ്, ഇഎഇഇയുടെ വിവിധ മോഡലുകൾ സമാന്തരമായി പരിശോധിച്ചപ്പോൾ മാത്രമാണ് പ്രതികരിച്ചത് [ഗോൾഡ് et al. 2006]. ഭാവി പഠനത്തിലും ഈ വശം ഉൾപ്പെടുത്തണം.

സാധ്യമായ മെക്കാനിസങ്ങൾ

MS- ൽ വ്യായാമവും രോഗം നിലയും തമ്മിലുള്ള ബന്ധം എന്ന നിലയിൽ പല വ്യവസ്ഥകളും നിർദ്ദേശിക്കപ്പെട്ടിട്ടുണ്ട്. സൈറ്റിൽകൈൻസും ന്യൂറോട്രോപിക് ഘടകങ്ങളും ഏറ്റവും മികച്ച വാഗ്ദാനങ്ങളിൽ ചിലത് [വൈറ്റ് ആൻഡ് കാസ്റ്റിലോനോ, 2008].

Cytokines. എം.സിയുടെ രോഗലക്ഷണങ്ങളിൽ സിടോകൈൻസ് ഒരു പ്രധാന പങ്കു വഹിക്കുന്നു. ചികിത്സ ഇടപെടലുകളുടെ പ്രധാന ലക്ഷണമാണ് ഇത്. പ്രത്യേകിച്ച്, ഇന്റർലേക്കിൻ (IL) -6, ഇന്റർഫെറൺ (IFN) -γ, ട്യൂമർ നെസ്കോറോസ് ഫാക്ടർ (ടിഎൻഎഫ്) -എ എം.എസ്. കാപ്റ്റൻ ആൻഡ് കോളസ്, 2008 എന്നിവയുൾപ്പെടെയുള്ളവർക്കുണ്ടാകുന്ന ഡീമോലിനേഷൻ, അൻകോണൽ കേടുപാടുകൾ തുടങ്ങിയ പ്രക്രിയയിൽ ഒരു പ്രധാന പങ്കുണ്ട്.

ചില സൈറ്റോകൈനുകളുടെ സാന്ദ്രതയിലെ മാറ്റങ്ങൾ, പ്രത്യേകിച്ച് IFN-γ, TNF-α തുടങ്ങിയവയാണ് MS- ൽ രോഗാവസ്ഥയിൽ മാറ്റങ്ങളുമായി ബന്ധപ്പെട്ടിരിക്കുന്നത്, കൂടാതെ ഉയർന്ന ഇൻഫ്രാസ്ട്രക്റ്റർ Th-1 സൈട്ടോക്നുകളുടെ (TNF-α, IFN-γ , IL-2, IL-12) നാഡീവ്യൂഹത്തിനും വൈകല്യത്തിനും കാരണമാകാം [Ozenci et al. 2002]. ഇത് വ്യായാമത്തിന് അനിയന്ത്രിതമായ സൈക്ക്കോക്സിനും സൈഡ്ക്രമീകരണത്തിനും രണ്ട് സൈറ്റോകിനുകൾ (IL-1, IL-2) തുടങ്ങിയ അസമത്വങ്ങൾ വർദ്ധിപ്പിക്കും. ഇതുവഴി വ്യായാമം ചെയ്യാൻ സാധിക്കും. MS രോഗികളിൽ രോഗം പ്രവർത്തനം [വൈറ്റ് ആൻഡ് കാസ്റ്റിലോനോ, 4b].

ചെറുത്തുനിൽപ്പിന്റെ പ്രതിരോധം, വൈറ്റ് et al. 2006], സഹിഷ്ണുത [Castellano et al. 2008; ഹെസേൻ തുടങ്ങിയവരും. 2003; ഷൂൾസ് മറ്റുമാണ്. 2004] കൂടാതെ സംയോജിത പരിശീലനം [ഗോൾസാരി മുതലായവ. 2010] നിരവധി സൈറ്റോകിനുകളിൽ വിലയിരുത്തപ്പെട്ടു. IL-4, IL-10, C-reactive പ്രോട്ടീൻ (CRP), IFN-γ എന്നിവയുടെ നിലകൾ കുറഞ്ഞുവെന്നും വൈറ്റ്, സഹപ്രവർത്തകർ എന്നിവരുടെ പഠനം ഒരു പഠനം ചൂണ്ടിക്കാട്ടുന്നു. എന്നാൽ, TNF-α, IL-2, IL-6 എന്നീ നിലവാരങ്ങൾ തുടർച്ചയായി മാറ്റമില്ലാതെ തുടർന്നു. വൈവിധ്യമാർന്ന പ്രതിരോധ പരിശീലനത്തിന്റെ ആഴ്ചകൾ [വൈറ്റ് et al. 8]. സൈക്കോകൈൻ സാന്ദ്രീകരണത്തിൽ വിശ്രമിക്കുന്നതിൽ പുരോഗമന പ്രതിരോധ പരിശീലനം ഒരു പ്രധാന സ്വാധീനം ചെലുത്തുന്നുണ്ടെന്നും അതിനാൽ തന്നെ എം.എസ്. എന്നിരുന്നാലും, പഠന നിയന്ത്രണം നിയന്ത്രിക്കപ്പെട്ടില്ല, തെളിവുകളുടെ ശക്തി പരിമിതപ്പെടുത്തുന്നതിനായി മാത്രമാണ് 2006 പങ്കാളികൾ ഉൾപ്പെട്ടിരുന്നത്. Heenen and colleagues IFN-γ, TNF-α, IL-10 എന്നിവയുടെ എൻഡ്യൂറൻസ് ട്രെയിനിങ്ങിൻറെ 8 ആഴ്ചകളുടെ തീവ്രമായ പ്രത്യാഘാതം വിശകലനം ചെയ്തു. കൂടാതെ, മെയിൽ നിയന്ത്രണ സംവിധാനവും മെറ്റീരിയൽ സപ്പോർട്ട് ചെയ്ത ആരോഗ്യമുള്ള ഒരു വിഭാഗവും [Heenen et al. 10]. എൺമൻസ് എൻഡുറൻസ് ട്രെയിനിങ് (സൈക്ലിംഗ്) പൂർത്തിയാക്കിയ ശേഷം എല്ലാ ഗ്രൂപ്പുകളിലും ഐഎഫ്എൻ-γ ​​വർദ്ധിച്ചു. ടിഎൻഎഫ്-α, ഐഎൽ -എൻഎൻഎക്സ്എക്സ് എന്നീ ചെറു സൂചികളിലെ ചെറിയ വർദ്ധനവ് എം എസ് രോഗികളുടെ രണ്ട് ഗ്രൂപ്പുകളിൽ കണ്ടു. ഈ വിവരങ്ങളെ അടിസ്ഥാനപ്പെടുത്തി, എം.എസ്. രോഗികളിലെ ശാരീരിക സമ്മർദ്ദത്തിന് അനാവശ്യമായ പ്രതിരോധശേഷി ഉണ്ടാകുന്നതിൽ വ്യതിചലനമുണ്ടാക്കാൻ കഴിയാത്തതാണെന്ന് രചയിതാക്കൾ അഭിപ്രായപ്പെടുന്നു. ഈ കണ്ടെത്തലുകൾ, അങ്ങനെ ഒരു ബോട്ടുചെയ്യൽ പരിശീലനം MS രോഗികളിൽ കുറഞ്ഞത് ഒരു സൈറ്റോകൈൻ പ്രൊഫൈൽ സ്വാധീനിക്കാൻ കഴിയും പിന്തുണയ്ക്കുന്നു. MS പരിശീലന ഗ്രൂപ്പിലെ MSM പരിശീലന ഗ്രൂപ്പിലെ എക്സിക്യൂഷൻ വ്യായാമത്തിന് ശേഷം (2003 ആഴ്ച സൈക്കിൾ ചവിട്ടൽ), എംഎസ് കൺട്രോൾ ഗ്രൂപ്പ് [Schulz et al. 30].

കാസ്റ്റിലോനയും സഹപ്രവർത്തകരും നടത്തിയ ഒരു പഠനത്തിൽ 8 എംഎസ് രോഗികളിൽ കൂടാതെ 3 ആരോഗ്യകരമായ പൊരുത്തമുള്ള നിയന്ത്രണങ്ങൾക്കുള്ള ഐ.എൽ -എക്സ്എക്സ്എക്സ്എക്സ്എക്സ്എക്സ്എക്സ് -എക്സ്എൻഎക്സ്എൻഎൻഎൻഎൻഎൻ, ഐഎഫ്എൻ-γ ​​എന്നിവയിലെ എൻഎൽഎൻആഴ്സ് എൻഡുറൻസ് ട്രെയിനിംഗ് (സൈക്ലിംഗ്, ദിനം, എട്ടുദിവസങ്ങൾ). എൻഡ്യൂറൻസ് ട്രെയ്നിംഗ് കഴിഞ്ഞ് ഐഎഫ്എൻ-γ, ടിഎൻഎഫ്-α തുടങ്ങിയ വിശ്രമവേളയിൽ എം.എസ്. രോഗികളിൽ ഉയർന്നുവന്നിട്ടുള്ളത്, ആരോഗ്യകരമായ നിയന്ത്രണത്തിൽ മാറ്റങ്ങളൊന്നും ഉണ്ടായില്ല [Castellano et al. 6]. ഹെസേനും അദ്ദേഹത്തിന്റെ സഹപ്രവർത്തകരും പഠിച്ചതുപോലെ [Heesen et al. കാസ്റ്റല്ലോനോയും സഹപ്രവർത്തകരും ഒരേ ബോട്ടിംഗ് എൻഡുറൻസ് ട്രെയ്നിംഗിന്റെ ഗുരുതരമായ ഫലങ്ങൾ പഠിക്കുകയും ആരോഗ്യകരമായ നിയന്ത്രണങ്ങളുമായി താരതമ്യപ്പെടുത്തുമ്പോൾ യാതൊരു വ്യത്യാസവും കാണുകയും ചെയ്തു. എന്നാൽ ഈ പഠനത്തിൽ, IFN-γ, TNF-α എന്നിവയിൽ ഏതെങ്കിലും വർദ്ധനവുണ്ടായില്ല. Heenen ആൻഡ് സഹപ്രവർത്തകരുടെ കണ്ടെത്തലുകൾ വ്യത്യസ്തമായി ഗ്രൂപ്പുകൾ.

ഗോൾസരിയും സഹപ്രവർത്തകരും IFN-γ, IL-8, IL-4 [Golzari et al. എന്നിവയിൽ സംയോജിത എൻഡുറൻസ് ആൻഡ് റെസിസ്റ്റൻസ് ട്രെയ്നിംഗിൽ 17 ആഴ്ചകളുടെ ഫലങ്ങൾ വിലയിരുത്തുന്നതിന് റാൻഡം നിയന്ത്രിത ട്രയൽ (RCT) നടത്തിയത്. 2010]. പഠനഗ്രൂപ്പിൽ IFN-γ, IL-17 എന്നിവയുടെ വിശ്രമ സന്ധികളിൽ ഗണ്യമായ കുറവുണ്ടായിരുന്നു. എന്നാൽ, കൺട്രോൾ ഗ്രൂപ്പിൽ യാതൊരു മാറ്റവും ഉണ്ടായില്ലെങ്കിലും ഗ്രൂപ്പ് താരതമ്യങ്ങൾ ഉണ്ടായില്ല.

ചുരുക്കത്തിൽ, പഠനങ്ങളോട് സൈക്കോകൈൻ പ്രതികരണങ്ങളൊന്നും വ്യക്തമായി കാണില്ല. പഠന തരം, വ്യായാമം ഇടപെടൽ, അളവെടുപ്പിന്റെ സമയം, നിലവാരത്തിലുള്ളവ മുതലായവ), കുറഞ്ഞ സ്റ്റാറ്റിസ്റ്റിക്കൽ ശക്തി അളവുകൾ ഈ തരത്തിലുള്ള വലിയ വ്യത്യാസം കാരണം. എന്നിരുന്നാലും, ഒരു വ്യായാമ പരീക്ഷയിൽ എം.എസ്. രോഗികളിൽ അനേകം (നാശനഷ്ടം) സൈറ്റോകൈൻ സ്വാധീനം ചെലുത്തിയിട്ടുണ്ട്, കൂടാതെ നിരവധി സൈറ്റോക്കുകളുടെ വിശ്രമത്തിലുളള മാറ്റങ്ങളുള്ള ഒരു പരിശീലന കാലത്തിനു ശേഷം റിപ്പോർട്ട് ചെയ്യപ്പെട്ടിട്ടുണ്ട്. മാത്രമല്ല, ആരോഗ്യകരമായ വിഷയങ്ങളോട് സമാനമായ പ്രതികരണം ഈ പ്രതികരണമായി തോന്നുന്നു. ആയതിനാൽ, സൈറ്റോയ്ൻസ് എം.എസ്. വ്യായാമം, രോഗം വർദ്ധിപ്പിക്കൽ എന്നിവയുമായി ബന്ധപ്പെട്ടിരിക്കാം, എന്നാൽ വലിയ തോതിലുള്ള ഭാവിയിലെ ആർടിസി ഇതിനെ വിലയിരുത്തേണ്ടതുണ്ട്.

ന്യൂറോട്രോപിക് ഘടകങ്ങൾ. നൊറോതെറോഫിക് ഫാക്റ്ററുകളാണ് നൊറോറോഫ്രീക് കുടുംബങ്ങൾ. ന്യൂറൽ മരണം തടയാനും നവോത്ഥാന പുനരധിവാസം, ലൈഫ് റീജനറിനേഷൻ, ലൈഫ് റീജനലിഷൻ തുടങ്ങിയവയ്ക്കും അനുകൂലമായ ഒരു പങ്കാണ് ഇബുഡി. 1997]. തലച്ചോറ്-ഡിറൈവ്ഡ് ന്യൂറോട്രോപിക് ഫാക്റ്റർ (ബിഡിഎൻഎഫ്), നർമ്മം വളർച്ച ഫാക്ടർ (എൻ.ജി.എഫ്) [വൈറ്റ് ആൻഡ് കാസൽസാനോ, എക്സ്എംഎൽബി] എന്നിവയാണ് നാരోట്രോഫിക്കിലെ പല ഘടകങ്ങളും.

എൻഎച്ച്എഫ്, ബി.ഡി.എൻഎഫ് എന്നിവയിൽ എംഎസ്എസ്എസ് രോഗികളിൽ ഒരു വ്യായാമത്തിനായുള്ള ബോട്ട് (30 മില്ലിക് സൈക്ലിംഗിൽ 60 മില്ലി സൈക്ലിംഗ്) ഗോൾഡ് ആന്റ് സഹപ്രവർത്തകർ പരിശോധിച്ചു. 2]. എൻജിഎഫിന്റെ അടിസ്ഥാനസമ്മർദ്ദം കണക്കിലെടുത്താൽ എം എസ് രോഗികളിൽ വളരെ കൂടുതലാണ്. വ്യായാമം കഴിഞ്ഞ് മുപ്പതു മിനുട്ട് പിന്നിടുമ്പോൾ ബി.ഡി.എൻ.എഫ്.യിൽ ഗണ്യമായ വർധനയുണ്ടായി. എന്നിരുന്നാലും, മാറ്റങ്ങൾ ആരോഗ്യകരമായ വിഷയങ്ങളിൽ കാണപ്പെടുന്ന മാറ്റങ്ങളിൽ നിന്ന് വ്യത്യാസപ്പെട്ടില്ല. ഇത് വ്യായാമത്തിന് വ്യായാമത്തെ ഫലപ്രദമായി വ്യായാമം ചെയ്യാൻ സാധിക്കും. എം.എസ്. ഇതേ ഗ്രൂപ്പിലെ ഒരു പഠനത്തിൽ SCHULZ- ഉം സഹപ്രവർത്തകരും BDNF, NGF എന്നിവയിൽ ആർഎസ്സിയിൽ ബവേയ്ക്ലൈഡ് സൈക്ലിംഗിൻറെ പ്രഭാവം വിലയിരുത്തി എം.ഇ. രോഗികളിൽ [Schulz et al. 25]. ഇടപെടൽ കാലഘട്ടത്തിനു ശേഷം നടത്തിയ വിശ്രമ കേന്ദ്രീകരണം, വിശാലമായ വ്യായാമത്തിന്റെ പ്രതികരണം എന്നിവയെക്കുറിച്ച് പഠനങ്ങൾ ഒന്നും കാണുന്നില്ല. താഴ്ന്ന നിലനിന്ന എൻജിഎഫ് നിലവാരത്തെ കുറിച്ചൊരു പ്രവണത കണ്ടെത്തി. ആഴ്ചയിൽ മൂന്നുതവണ സൈസലിംഗിലാണോ എന്ന് കാസ്റ്റിലോനോ വൈറ്റ് വിലയിരുത്തുന്നു. MS രോഗികളിൽ ബീറ്റാഎൻഎഫിന്റെ സെമൻ സങ്കീർണതയും ആരോഗ്യകരമായ നിയന്ത്രണത്തിൽ കാസ്റ്റിലോനോയും വൈറ്റ്, 2003 യും ബാധിക്കുന്നു. സ്വർണത്തിന്റെയും സഹപ്രവർത്തകരുടെയും കണ്ടെത്തലുകൾക്ക് വിപരീതമായി, നിയന്ത്രണങ്ങളുമായി താരതമ്യപ്പെടുത്തുമ്പോൾ BDNF വിശ്രമിക്കുകയാണ് MS രോഗികളിൽ അടിസ്ഥാനമായുള്ളത്, എന്നാൽ ഗ്രൂപ്പുകളിൽ തമ്മിൽ യാതൊരു വ്യത്യാസവുമില്ലാതായി. എം.എസ്. രോഗികളിലെ ബി.ഡി.എൻ.എഫ്.എഫ് കേന്ദ്രീകൃത ശേഷി ആഴ്ചയിൽ എട്ടു മുതൽ എട്ടു മുതൽ ആഴ്ചയിൽ കുറയുകയായിരുന്നു. പിന്നീട് ആഴ്ചയിൽ എട്ടു മുതൽ എട്ടു വരെ കുറയുകയും ചെയ്തു. എന്നാൽ, ബിഎൻഎൻഎഫിൻറെ ശേഷി വിശ്രമവേളകളിൽ നിലനിർത്തി. രണ്ട് വേദികളിൽ വ്യായാമത്തിനു ശേഷമുള്ള ബി.ഡി.എൻ.എഫ്.എഫ്., എട്ട് മണിക്കൂറുകളിൽ ഗോൾഡ് ആന്റ് സഹപ്രവർത്തകരുടെ കണ്ടെത്തലുകൾക്ക് വിപരീതമായി ഒരൊറ്റ മത്സരം നടത്തുക എന്ന പ്രതികരണവും വിലയിരുത്തപ്പെട്ടു. മനുഷ്യരിലെ ബി.ഡി.എൻ.എഫ് നിയന്ത്രണം ബാധകമാക്കാൻ കഴിയുമെന്ന് പ്രാഥമിക തെളിവുകൾ നൽകിയിരുന്നതായി രചയിതാക്കൾ പറയുന്നു.

കൂടുതൽ പഠനങ്ങൾ നടത്താൻ MS രോഗികളിൽ ന്യൂറോട്രോപിക് ഘടകങ്ങളിലുള്ള വ്യായാമത്തിന് ഫലമായി ഒട്ടേറെ കണ്ടെത്തലുകൾ ഉണ്ട്. എന്നിരുന്നാലും, ന്യൂറോ പ്രോട്ടോക്റ്റീവ് പ്രക്രിയകളിൽ ഉൾപ്പെട്ടിരിക്കുന്നതിന് അറിയപ്പെടുന്ന പല ന്യൂറോട്രോപിക് ഘടകങ്ങളെയും വ്യായാമം സ്വാധീനിക്കും.

നിഗമനങ്ങളിലേക്ക്

വ്യായാമം ഒരു രോഗം-എം.ഇ. രോഗികളിൽ ഉണ്ടോ അല്ലയോ എന്നു വ്യക്തമായി പറയാൻ കഴിയില്ല, എന്നാൽ ഇത് സൂചിപ്പിക്കുന്ന പഠനങ്ങൾ. അതുകൊണ്ട്, ഈ പ്രധാനപ്പെട്ട ചോദ്യത്തെ അഭിമുഖീകരിക്കാൻ ധാരാളം എം.എസ്. രോഗികളിലെ ഭാവി ദീർഘകാല ഇടപെടൽ പഠനങ്ങൾ ആവശ്യമാണ്.

അക്നോളജ്മെന്റ്

സമഗ്രസാഹിത്യ അന്വേഷണത്തിന് ഗവേഷകരായ ലൈബ്രേറിയൻ എഡ്ത് ക്ലോസനെ നന്ദി പറയുന്നു.

അടിക്കുറിപ്പുകൾ

പൊതു, വാണിജ്യ, അല്ലെങ്കിൽ ലാഭേച്ഛയില്ലാത്ത മേഖലകളിൽ ഏതെങ്കിലും ഫണ്ടിംഗ് ഏജൻസിയിൽ നിന്ന് പ്രത്യേക ഗാൻറിന് ഈ ഗവേഷണത്തിന് ലഭിച്ചിട്ടില്ല.

യുഡിന് ബോഗൻ ഐഡക്, മെർക്ക് സെറോനോ, സനോഫി അവെന്റീസ് എന്നിവയിൽ നിന്ന് യാത്രാ ഗ്രാൻറുകൾ കൂടാതെ / അല്ലെങ്കിൽ ഹോണററി ലഭിച്ചിട്ടുണ്ട്. ബയോജെൻ ഐഡിക്, മെർക് സെറോണോ, ബിയർ സ്കീയിംഗ് എന്നിവിടങ്ങളിൽ നിന്നുള്ള ഗവേഷണ പിന്തുണയും ട്രാവൽ ഗ്രാൻറുകളും എസ്.എൻ.സനോഫീ അവെന്റസിസിൽ നിന്നും നൽകിയിട്ടുണ്ട്.

വേദന, ക്ഷീണം, ദൗർബല്യം, നാരായ കോശങ്ങളിലെ നാഡി കോശങ്ങൾക്ക് കേടുപാടുകൾ സംഭവിച്ച അമിതമായ ഏകോപനം, സിഎൻഎസ് എന്നിവ മൂലമുള്ള ലക്ഷണങ്ങളാൽ മൾട്ടിപ്പിൾ സ്ക്ലിറോസിസ് അഥവാ എം.എസ്. മൾട്ടിപ്പിൾ സ്ക്ലിറോസിസ് ലക്ഷണങ്ങളുടെ മാനേജ്മെൻറ് മെച്ചപ്പെടുത്താനും രോഗത്തിന്റെ പുരോഗതി കുറയ്ക്കാനും വ്യായാമം സഹായിച്ചു. എന്നിരുന്നാലും കൂടുതൽ തെളിവുകൾ ആവശ്യമായി വന്നാലും മുകളിൽ പറഞ്ഞ ലേഖനം ഈ ഫലങ്ങളുടെ സംഗ്രഹം സംഗ്രഹിക്കുന്നു. മൾട്ടിപ്പിൾ സ്ക്ലിറോസിസ് വളർച്ചയും മൊത്തത്തിലുള്ള ആരോഗ്യവും ക്ഷേമവും മെച്ചപ്പെടുത്തുന്നതിനുള്ള വ്യായാമത്തെ വ്യാഖ്യാനിക്കുന്നതിനുള്ള ഉദ്ദേശ്യം വ്യക്തമാക്കുന്നു. ഞങ്ങളുടെ വിവരങ്ങളുടെ പരിധി ചിതറായും അസാധാരണമായ ആരോഗ്യ പ്രശ്നങ്ങളിലേക്കും പരിമിതപ്പെടുത്തിയിരിക്കുന്നു. വിഷയം ചർച്ച ചെയ്യാൻ, ഡോക്ടർ ജിമെനെസ് ചോദിക്കാൻ മടിക്കരുത് അല്ലെങ്കിൽ ഞങ്ങളെ ബന്ധപ്പെടുക 915-850-0900 .

ഡോ. അലക്സ് ജിമെനെസ് ക്യൂറാണ്

ഇതിൽ നിന്നും റെഫറൻസ്: Ncbi.nlm.nih.gov/pmc/articles/PMC3302199

പച്ച കോൾ ഇപ്പോൾ ബട്ടൺ എച്ച് .png

കൂടുതൽ വിഷയം ചർച്ച: അക്യുട്ട് ബാക്ക് വേദന

പുറം വേദന ലോകവ്യാപകമായി തൊഴിലാളിയുടെ വൈകല്യവും നഷ്ടപ്പെടാത്ത ദിവസങ്ങളും ഏറ്റവും കൂടുതലായ കാരണങ്ങൾ. ഡോക്ടർ ഓഫീസ് സന്ദർശനങ്ങൾക്കുള്ള രണ്ടാമത്തെ ഏറ്റവും സാധാരണ കാരണം ചൂണ്ടിക്കാട്ടുന്നു, ഉയർന്ന ശ്വാസകോശബാധയുള്ള അണുബാധകൾ മാത്രം. ജനസംഖ്യയിൽ ഏതാണ്ട് എൺപതു ശതമാനം പേർക്ക് അവരുടെ ജീവിതകാലം മുഴുവൻ ഒരു വേദന ഒരിക്കൽ അനുഭവപ്പെടും. നട്ടെല്ല്, സന്ധികൾ, കട്ടിലുകൾ, പേശികൾ തുടങ്ങി മൃദുവായ ടിഷ്യൂകൾ കൊണ്ട് നിർമ്മിച്ച സങ്കീർണമായ ഘടനയാണ് നട്ടെല്ല്. പരുക്കുകളും ഒപ്പം / അല്ലെങ്കിൽ അഴുകിയ അവസ്ഥകളും ഹാർനിയേറ്റഡ് ഡിസ്ക്കുകൾ, ഒടുവിൽ മുടി വേദനയുടെ ലക്ഷണങ്ങളായി മാറുന്നു. സ്പോർട്സ് പരിക്കുകൾ അല്ലെങ്കിൽ വാഹനാപകടങ്ങൾ പലപ്പോഴും മുടി വേദനയ്ക്ക് ഇടയാക്കുന്നു, ചിലപ്പോൾ ചലനങ്ങളുടെ ലളിതമായ വേദനയ്ക്ക് വേദനയേറിയ ഫലങ്ങൾ ഉണ്ടാകാം. ഭാഗ്യവശാൽ, ചികിൽസാകൃതിയിലുള്ള സംരക്ഷണം പോലെയുള്ള ബദൽ ചികിൽസാരീതികൾ, നട്ടെല്ലിൽ മാറ്റം വരുത്താനും നട്ടെല്ലിൽ മാറ്റം വരുത്താനും സഹായകരമാകും, ഇത് ആത്യന്തികമായി വേദനയുടെ ആശ്വാസം വർദ്ധിപ്പിക്കും.

കാർട്ടൂൺ പേപ്പർ ബോയുടെ ബ്ലോഗ് ചിത്രം

EXTRA EXTRA | പ്രധാന വിഷയം: ശുപാർശ എൽ പാസോ, TX ച്യൂയിപോർട്ട് സ്ട്രക്ചർ

***

മൾട്ടിപ്പിൾ സ്ക്ലിറോസിസിന് വ്യായാമ നേട്ടങ്ങൾ

മൾട്ടിപ്പിൾ സ്ക്ലിറോസിസിന് വ്യായാമ നേട്ടങ്ങൾ

പതിവായി എം എസ്സിന്റെ ലക്ഷണങ്ങളുമായി നിങ്ങൾ മല്ലിടുകയാണോ? മൾട്ടിപ്പിൾ സ്ക്ലിറോസിസ് അല്ലെങ്കിൽ MS, മനുഷ്യ ശരീരത്തിന്റെ രോഗപ്രതിരോധ സംവിധാനമാണ് നാഡീകോശങ്ങൾക്ക് ചുറ്റുമുള്ള, ഫാറ്റി മെയ്ലിൻ പൂട്ടിനെ ആക്രമിക്കുന്ന ഒരു രോഗം. മൾട്ടിപ്പിൾ സ്ക്ലിറോസിസ് സാധാരണ ലക്ഷണങ്ങൾ ക്ഷീണം, പേശി സ്പാസുകൾ, നടക്കാനിടയുള്ള പ്രശ്നങ്ങൾ, തഴയൽ വികാരങ്ങൾ, വിരസത എന്നിവയാണ്.

വിവിധ ഗവേഷണ പഠനങ്ങൾ, മെച്ചപ്പെട്ട ശാരീരിക പ്രവർത്തനങ്ങൾ, വ്യായാമങ്ങൾ, ശാരീരിക പ്രവർത്തനങ്ങൾ, വ്യായാമങ്ങൾ എന്നിവ പങ്കുവയ്ക്കുന്നതിൽ നിന്ന് എംഎസ് ഉൾപ്പെടെയുള്ള അസുഖങ്ങൾ, മറ്റ് അസുഖങ്ങൾ എന്നിവയ്ക്കുള്ള സാധ്യത കുറയ്ക്കും. ശാരീരികമായ പ്രവർത്തനവും വ്യായാമക്കുറവുമല്ലാത്ത അപൂർവ പോഷണവും മൾട്ടിപ്പിൾ സ്ക്ലിറോസിസ് ഉള്ളവർക്കാണ് ഏറ്റവും അപകടസാധ്യതയുണ്ടെന്ന് ഒരു ഗവേഷണ പഠനം സൂചിപ്പിക്കുന്നു.

മൾട്ടിപ്പിൾ സ്ക്ലിറോസിസിന് വ്യായാമത്തിന്റെ ഗുണങ്ങൾ സംബന്ധിച്ച മറ്റൊരു ഗവേഷണ പ്രബന്ധം അച്ചടിച്ചതാണ്. ഗവേഷണ പഠനത്തിലെ പങ്കാളികൾ കൂടുതൽ മെച്ചപ്പെട്ട മനോഭാവം സൃഷ്ടിച്ചു, അവരുടെ ശക്തി, വഴക്കം, ചലനശേഷി, കുറഞ്ഞ ക്ഷീണം അനുഭവപ്പെട്ടു, അവരുടെ കുടൽ, മൂത്രസഞ്ചി, രക്തചംക്രമണ പ്രവർത്തനം എന്നിവ മെച്ചപ്പെടുത്തി, വിഷാദരോഗത്തിന്റെ കുറച്ചു ലക്ഷണങ്ങൾ വികസിപ്പിച്ചെടുത്തു.

മൾട്ടിപ്പിൾ സ്ക്ലിറോസിസ് വേണ്ടി വ്യായാമം

ഒരു ഫിറ്റ്നസ് പ്രോഗ്രാം മെഡിക്കൽ മേൽനോട്ടത്തിൽ രൂപകൽപ്പന ചെയ്യണം, MS ലക്ഷണങ്ങളിൽ മാറ്റം വരുത്തിയേക്കാം. MS ൽ രോഗികൾക്ക് ശാരീരിക പ്രവർത്തനങ്ങളിൽ ഏർപ്പെടുകയും ഓരോ ആഴ്ചയും പല തവണ വ്യായാമങ്ങൾ ചെയ്യപ്പെടുകയും കാലാവധി നീണ്ടുപോകുന്ന പ്രവർത്തനങ്ങൾ ഒഴിവാക്കുകയും വേണം. എം.എസ്. രോഗികൾക്ക് ഇപ്പോഴും വീട്ടിലുണ്ട്. പാചകം, പൂന്തോട്ടം, മറ്റ് വീട്ടു ജോലികളുൾപ്പെടെയുള്ള ദൈനംദിന ചുമതലകളുടെ ഉദാഹരണങ്ങൾ.

MS ലക്ഷണങ്ങളെ നിയന്ത്രിക്കാൻ സഹായിക്കുന്ന വ്യായാമങ്ങൾ:

  • യോഗ. നിങ്ങളുടെ ശരീരം, മനസ്സ് എന്നിവയെ ശാന്തരാക്കാൻ സഹായിക്കുന്ന ശ്വാസകോശത്തെക്കുറിച്ച് ബോധവാനായി ഈ ശാരീരിക പ്രവർത്തി / വ്യായാമം സവിശേഷതകൾ. യോഗയുടെ പ്രയോജനങ്ങൾ മനുഷ്യശരീരത്തിന്റെ വിന്യാസം വർദ്ധിപ്പിക്കുക, നിങ്ങളുടെ സ്വന്തം ബാലൻസ് മെച്ചപ്പെടുത്തുക. ധ്യാനാത്മകമായ ടെക്നിക്കുകൾ ധ്യാനവും യോഗവും, മാഗ്നിക് റിസോണൻസ് ഇമേജിംഗ്, എംആർഐ സ്കാൻ, അല്ലെങ്കിൽ ഒരു ഇൻജക്ഷൻ ലഭിക്കാൻ ഉപയോഗിക്കും.
  • തായി ചി. നിങ്ങളുടെ ചലനങ്ങളെ ശ്വസിക്കുന്നത്, വിശ്രമിക്കാനും, വേഗത കുറയ്ക്കാനും ഈ ചൈനീസ് ആയോധന കല നിങ്ങളെ പഠിപ്പിക്കുന്നു. മാത്രമല്ല, നിങ്ങളുടെ ബാലൻസ് മെച്ചപ്പെടുത്താനും, മസിൽ ടോണിനെ നിയന്ത്രിക്കാനും സഹായിക്കാനും സഹായിക്കാനും തയ്യ Chi സഹായിക്കും, മാത്രമല്ല സ്ട്രെസ് ഒഴിവാക്കുകയും ചെയ്യും.
  • ജല വ്യായാമങ്ങൾ. ജലാശയങ്ങളിൽ ശാരീരിക പ്രവർത്തനങ്ങൾ / വ്യായാമങ്ങൾ കുറവ് ആവശ്യമാണ്. ഇത് ശരിയായി നടപ്പാക്കാൻ കഴിയാത്ത വിധത്തിൽ എം ചലനങ്ങളുള്ള ആളുകളെ സഹായിക്കുന്നു. മസിൽ വ്യായാമം, മെച്ചപ്പെട്ട വഴക്കം, മെച്ചപ്പെട്ട ചലനം, മെച്ചപ്പെട്ട കരുത്ത്, കുറഞ്ഞ വേദന എന്നിവയാണ് ജലത്തിന്റെ വ്യായാമങ്ങൾ. എയറോബിക് പ്രതിരോധം മെച്ചപ്പെടുത്തുന്നതിന് ശ്രദ്ധ കേന്ദ്രീകരിക്കുന്നു.

ആരോഗ്യരംഗത്തെ പ്രൊഫഷണലായ എം.എസ്. ആൾക്കാർക്ക് അവരുടെ ലക്ഷണങ്ങളെ കൂടുതൽ ഭീകരമാക്കുമെന്ന് ഭയന്ന് പൂർണ്ണമായും വ്യായാമം ചെയ്യുക. പതിവ് വ്യായാമം സ്ഥിരമായി വ്യായാമം ചെയ്യുന്നത് എം എസ് ഉൾപ്പെടെയുള്ളവർക്കായി ഗുണനിലവാരം മെച്ചപ്പെടുത്തുക മാത്രമല്ല, ഭാവിയിൽ സങ്കീർണതകൾ കുറയുകയും രോഗലക്ഷണങ്ങൾ കുറയ്ക്കാനും സഹായിക്കും. മൾട്ടിപ്പിൾ സ്ക്ലിറോസിസ് ഉള്ളവർക്ക് പോലും ആരെയെങ്കിലും പ്രയോജനപ്പെടുത്താം.

ഡോ ജിമനെസ് വൈറ്റ് കോട്ട്
പല ആരോഗ്യപരിപാലന തൊഴിലാളികൾ പറയുന്നതനുസരിച്ച്, ശാരീരിക പ്രവർത്തനവും വ്യായാമവും ഒന്നിലധികം സ്ക്ലിറോസിസ് അല്ലെങ്കിൽ എം.എസ്സിനുള്ള ചികിത്സയുടെ ഏറ്റവും അവശ്യ ഘടകങ്ങളിലൊന്നാണ്. എം.എസ്. ആയുർദൈർഘ്യത്തിൽ പല രോഗികളും പലപ്പോഴും വ്യായാമത്തെ പ്രതികൂലമായി ബാധിക്കുകയാണെങ്കിൽ, ഇത് ലക്ഷണങ്ങളെ കൂടുതൽ ഗുരുതരമാക്കും എന്ന് ഗവേഷണ പഠനങ്ങൾ തെളിയിച്ചിട്ടുണ്ട്. അടുത്ത ലേഖനത്തിൽ വിവരിച്ചതുപോലെ, ശാരീരിക പ്രവർത്തനങ്ങൾ ശക്തി, ചലനാത്മകത, വഴക്കം എന്നിവ മെച്ചപ്പെടുത്താൻ സഹായിക്കും. കൂടാതെ, മെച്ചപ്പെട്ട മലവിസർജ്ജനവും പിത്താശയവും, മെച്ചപ്പെട്ട മാനസികാവസ്ഥയും ക്ഷീണം കുറയ്ക്കലുകളും ഉൾപ്പെടെ എം.എസ്. ഡോ. അലക്സ് ജിമനേസ് DC, CCST ഇൻസൈറ്റ്

എം.എസ്. വേണ്ടി വ്യായാമങ്ങൾ ആരംഭിക്കുക

നാഷണൽ മൾട്ടിപ്പിൾ സ്ക്ലിറോസിസ് സൊസൈറ്റിക്ക് വൈദ്യപരിശോധന നടത്തുന്ന നഴ്സ് പ്രിൻസിപ്പാളും അസോസിയേറ്റ് വൈസ് പ്രസിഡന്റുമായ കാത്ലീൻ കോസ്റ്റല്ലോ, ഒരു ചികിൽസാകൃതി അല്ലെങ്കിൽ ഫിസിക്കൽ തെറാപ്പിസ്റ്റ് പോലുള്ള ഹെൽത്ത് കെയർ പ്രൊഫഷണലുകളുടെ പിന്തുണ തേടാൻ ശുപാർശ ചെയ്യുന്നു, രോഗികൾക്ക് അനുയോജ്യമായ ശാരീരിക പ്രവർത്തനങ്ങൾ അല്ലെങ്കിൽ വ്യായാമങ്ങൾ മിസ്. മൾട്ടിപ്പിൾ സ്ക്ലിറോസിസിന് വ്യായാമം പ്രയോജനപ്പെടുത്തുന്നതിൽ ഉൾപ്പെടുന്നു:

കുറഞ്ഞ ക്ഷീണം

വിവിധ തരത്തിലുള്ള ശാരീരിക പ്രവർത്തനങ്ങളും വ്യായാമങ്ങളും ക്ഷീണം വർദ്ധിപ്പിക്കാൻ കഴിയും. എം.എസ്. വ്യക്തികളുമായുള്ള നിരന്തരമായ പരാതിയാണ് ഇത്. യോഗയെ കുറിച്ചുള്ള ഗവേഷണ പഠനങ്ങൾ, മറ്റ് തരത്തിലുള്ള വ്യായാമങ്ങൾ പോലെ യോഗയും ക്ഷീണം കുറയ്ക്കുന്നതായി കണ്ടെത്തി. എട്ട് മാസത്തെ ജലചികിത്സ ക്ഷീണം, MS ലെ സ്ത്രീകളിൽ മെച്ചപ്പെട്ട ജീവിത നിലവാരം കുറഞ്ഞുവെന്ന് മറ്റൊരു ഗവേഷണ പഠനങ്ങൾ കണ്ടെത്തി.

നല്ല മാനസികാവസ്ഥ

ബുദ്ധിമുട്ടുള്ള നടത്തം, നൃത്തം, അല്ലെങ്കിൽ ബൈസൈക്ലിംഗ് തുടങ്ങിയ മിതമായ തീവ്രത വ്യായാമം വിഷാദരോഗികളിലെ മൂഡ് വർദ്ധിപ്പിക്കാൻ നിരവധി ഗവേഷണ പഠനങ്ങളിൽ കാണിച്ചിരിക്കുന്നു. ശാരീരിക പ്രവർത്തന മാർഗനിർദേശങ്ങൾ നേരിടേണ്ടിവരുമ്പോഴും മൾട്ടിപ്പിൾ സ്ക്ലിറോസിസ് ഉൾപ്പെടെയുള്ള ന്യൂറോളജിക്കൽ ഡിസോർഡേഴ്സിനും മുതിർന്നവർക്കും ആനുകൂല്യങ്ങൾ പ്രയോജനപ്പെടുന്നുണ്ടെന്ന് ഒരു ഗവേഷണ പഠനം കണ്ടെത്തി. മുതിർന്നവർക്ക് കുറഞ്ഞത് എൺപത് മിനിറ്റ് അഥവാ എൺപത് മണിക്കൂറും, എൺപത് മണിക്കൂറും, എൺപത് മിനിറ്റും, മിതാധിഷ്ഠിത ശാരീരികപ്രവർത്തനങ്ങളോ വ്യായാമങ്ങളോ ആയിരിക്കണമെന്ന് ഡിസീസ് കൺട്രോൾ ആന്റ് പ്രിവൻഷൻ സെന്ററുകൾ നിർദ്ദേശിക്കുന്നു. കൂടാതെ, MS- ന്റെ മേശ ശക്തിപ്പെടുത്തൽ വ്യായാമങ്ങൾ ഉൾപ്പെടുന്ന ചുരുങ്ങിയത് രണ്ട് വ്യായാമങ്ങളുമായി .

മികച്ച ബ്ലാഡർ നിയന്ത്രണം

എം എസ്സിലെ ആളുകളിൽ വ്യായാമത്തിന്റെ ഗുണങ്ങൾ സംബന്ധിച്ച ഗവേഷണ പഠനങ്ങളിൽ ഒരു അവലോകനം നടത്തിയത്, എൺസോബിക് എയ്റോബിക് വ്യായാമത്തിന് എം.എസ്. എക്സ്.എം.എൽ ഇൻഫർമേഷൻ ആൻഡ് കോംപ്ലിമെന്ററി മെഡിസിനിൽ പ്രസിദ്ധീകരിച്ച ഒരു ചെറിയ പൈലറ്റ് ഗവേഷണ പഠനത്തിലാണ് ഇക്കാര്യം വ്യക്തമായത്.

ശക്തമായ അസ്ഥികൾ

വയർ വഹിക്കുന്ന ശാരീരിക പ്രവർത്തനങ്ങളും വ്യായാമവും നടത്തൽ, ഓട്ടം, അല്ലെങ്കിൽ എലിപ്റ്റിക്കൽ മെഷീൻ ഉപയോഗിക്കുന്നു, അസ്ഥികളെ ശക്തിപ്പെടുത്തുന്നതിനും ഓസ്റ്റിയോപൊറോസിസ്, അസ്ഥികളെ ഒടിവെയ്ക്കുന്നതിനുള്ള സാധ്യത ഉയർത്തുന്ന ഒരു അസ്ഥിപദാർത്ഥത്തെ പ്രതിരോധിക്കാൻ സഹായിക്കും. MS, അല്ലെങ്കിൽ മൾട്ടിപ്പിൾ സ്ക്ലിറോസിസ് രോഗികളുള്ള ധാരാളം ആളുകൾ ആസ്വാദക ഘടകങ്ങളായ, ആസ്വാദകത വളർത്തുന്നതിന് സാധ്യതയുണ്ട്.

  • അസ്ഥി ആരോഗ്യത്തെ സംരക്ഷിക്കുന്നതിന് കാൽസ്യം ഉപയോഗിച്ച് പ്രവർത്തിക്കുന്ന പോഷകാഹാരത്തിൻറെ അളവ് വിറ്റാമിൻ ഡിയുടെ അളവ് കുറവാണ്
  • കോർട്ടികോസ്റ്റീറോയിഡുകൾ കഴിക്കുന്ന ഒരു ചരിത്രം, എംഎസ് ഫ്ളേകളെ ചികിത്സിക്കാൻ ഉപയോഗിക്കുന്ന മരുന്നുകൾ, ഇത് കാൽസ്യം ലെവൽ താഴ്ന്ന നിലവാരത്തിലേക്ക് നയിക്കും
  • വിവിധ തരത്തിലുള്ള വ്യായാമങ്ങളിൽ ഏർപ്പെടാൻ സാധ്യതയുള്ള ഒരു വ്യക്തിയെ ഇത് അനുകരിക്കാനുള്ള ബുദ്ധിമുട്ടുകൾ
  • ശരീരഭാരം കുറയുന്നു

അതേസമയം, എം.എസ്. ആൾക്കാരുമായി ഇടയ്ക്കിടെയുള്ള ബാലൻസ് ഉണ്ടാകും. ഇത് പൊടുന്നനെ കൂടുതൽ ദോഷം ചെയ്യും, തകർന്ന എല്ലുകളുടെ ഒരു പ്രധാന കാരണം. അസ്ഥികളുടെ സാന്ദ്രത കാത്തുസൂക്ഷിക്കുന്നതിനും എല്ലായിടങ്ങളിലും, പ്രത്യേകിച്ച് എം.എസ്.ഡബ്ല്യു രോഗനിർണയം നടത്തിയവരിൽ, എല്ലുകൾ ശക്തമാക്കുവാനും സഹായിക്കുന്ന വ്യായാമത്തിനും ശാരീരിക പ്രവർത്തനങ്ങൾക്കുമുള്ള മാർഗ്ഗങ്ങൾ കണ്ടെത്തുന്നു.

ഭാരോദ്വഹനം മാനേജ്മെന്റ്

ശരീരഭാരം കുറയുകയും വ്യായാമങ്ങൾ കുറയുകയും ചെയ്യുന്നതിലൂടെ എം എസ്സിന്റെ ലക്ഷണങ്ങൾ ഫലപ്രദമാകുകയാണെങ്കിൽ ഭാരം വർദ്ധിക്കും. ഇത് ശരീരത്തിന് കൂടുതൽ ബുദ്ധിമുട്ട് ഉണ്ടാക്കും. കോർട്ടികോസ്റ്റീറോയിഡുകൾ ഉപയോഗിക്കുന്നത് ഭാരം കുറയ്ക്കാൻ സഹായിക്കും. ശാരീരിക പ്രവർത്തനങ്ങളിലോ വ്യായാമങ്ങളിലോ ഏർപ്പെടാൻ ശരീരഭാരം കുറയ്ക്കാൻ സഹായിക്കും. സാധാരണയായി വ്യായാമം ചെയ്യാനുള്ള കഴിവുണ്ട്. മുകളിൽ വിവരിച്ച മറ്റു നേട്ടങ്ങളോടൊപ്പം, ശാരീരിക പ്രവർത്തനങ്ങളോ വ്യായാമമോ കുറവുള്ളവർക്ക് വിശപ്പ് വർദ്ധിപ്പിക്കും.

നിരവധി ആളുകൾക്ക്, എം എന്നാണ് ശാരീരിക പ്രവർത്തനങ്ങളിൽ മാറ്റം വരുത്തുന്നത് അല്ലെങ്കിൽ അവർ ചെയ്യാൻ സാധിക്കുന്ന വ്യായാമങ്ങൾ എന്നാണ്. അവരെ എങ്ങനെ എക്സിക്യൂട്ട് ചെയ്യാൻ കഴിയുമെന്നത് സൂചിപ്പിക്കുന്നു, എന്നിരുന്നാലും, അവരുടെ ജീവിതരീതി ഒരു നിലപാടിൽ തുടരുകയല്ല. നിങ്ങൾക്ക് നന്നായി അനുയോജ്യമായ പ്രവർത്തനങ്ങളും MS ൽ നീങ്ങാൻ സഹായിക്കുന്ന അസിസ്റ്റീവ് ഉപകരണങ്ങളും കണ്ടെത്തുന്നതിന് നിങ്ങളുടെ ഹെൽത്ത് കെയർ പ്രൊഫഷണലുമായി ജോലി ചെയ്യുക. ഞങ്ങളുടെ വിവരങ്ങളുടെ പരിധി ചിതറായും അസാധാരണമായ ആരോഗ്യ പ്രശ്നങ്ങളിലേക്കും പരിമിതപ്പെടുത്തിയിരിക്കുന്നു. വിഷയം ചർച്ച ചെയ്യാൻ, ഡോക്ടർ ജിമെനെസ് ചോദിക്കാൻ മടിക്കരുത് അല്ലെങ്കിൽ ഞങ്ങളെ ബന്ധപ്പെടുക 915-850-0900 .

ഡോ. അലക്സ് ജിമെനെസ് ക്യൂറാണ്R

പച്ച കോൾ ഇപ്പോൾ ബട്ടൺ എച്ച് .png

കൂടുതൽ വിഷയം ചർച്ച: അക്യുട്ട് ബാക്ക് വേദന

പുറം വേദന ലോകവ്യാപകമായി തൊഴിലാളിയുടെ വൈകല്യവും നഷ്ടപ്പെടാത്ത ദിവസങ്ങളും ഏറ്റവും കൂടുതലായ കാരണങ്ങൾ. ഡോക്ടർ ഓഫീസ് സന്ദർശനങ്ങൾക്കുള്ള രണ്ടാമത്തെ ഏറ്റവും സാധാരണ കാരണം ചൂണ്ടിക്കാട്ടുന്നു, ഉയർന്ന ശ്വാസകോശബാധയുള്ള അണുബാധകൾ മാത്രം. ജനസംഖ്യയിൽ ഏതാണ്ട് എൺപതു ശതമാനം പേർക്ക് അവരുടെ ജീവിതകാലം മുഴുവൻ ഒരു വേദന ഒരിക്കൽ അനുഭവപ്പെടും. നട്ടെല്ല്, സന്ധികൾ, കട്ടിലുകൾ, പേശികൾ തുടങ്ങി മൃദുവായ ടിഷ്യൂകൾ കൊണ്ട് നിർമ്മിച്ച സങ്കീർണമായ ഘടനയാണ് നട്ടെല്ല്. പരുക്കുകളും ഒപ്പം / അല്ലെങ്കിൽ അഴുകിയ അവസ്ഥകളും ഹാർനിയേറ്റഡ് ഡിസ്ക്കുകൾ, ഒടുവിൽ മുടി വേദനയുടെ ലക്ഷണങ്ങളായി മാറുന്നു. സ്പോർട്സ് പരിക്കുകൾ അല്ലെങ്കിൽ വാഹനാപകടങ്ങൾ പലപ്പോഴും മുടി വേദനയ്ക്ക് ഇടയാക്കുന്നു, ചിലപ്പോൾ ചലനങ്ങളുടെ ലളിതമായ വേദനയ്ക്ക് വേദനയേറിയ ഫലങ്ങൾ ഉണ്ടാകാം. ഭാഗ്യവശാൽ, ചികിൽസാകൃതിയിലുള്ള സംരക്ഷണം പോലെയുള്ള ബദൽ ചികിൽസാരീതികൾ, നട്ടെല്ലിൽ മാറ്റം വരുത്താനും നട്ടെല്ലിൽ മാറ്റം വരുത്താനും സഹായകരമാകും, ഇത് ആത്യന്തികമായി വേദനയുടെ ആശ്വാസം വർദ്ധിപ്പിക്കും.

കാർട്ടൂൺ പേപ്പർ ബോയുടെ ബ്ലോഗ് ചിത്രം

EXTRA EXTRA | പ്രധാന വിഷയം: ശുപാർശ എൽ പാസോ, TX ച്യൂയിപോർട്ട് സ്ട്രക്ചർ

***

മൾട്ടിപ്പിൾ സ്ക്ലിറോസിസിൽ വ്യായാമം: ഡിസീസ് മാനേജ്മെൻറിൻറെ ഒരു സംയോജിത ഘടകം

മൾട്ടിപ്പിൾ സ്ക്ലിറോസിസിൽ വ്യായാമം: ഡിസീസ് മാനേജ്മെൻറിൻറെ ഒരു സംയോജിത ഘടകം

പതിവ് ശാരീരിക പ്രവർത്തനങ്ങളിലും വ്യായാമങ്ങളിലും പങ്കെടുക്കുന്നത് അത്യന്താപേക്ഷിതമായ ആരോഗ്യവും ക്ഷേമവും നിലനിർത്തുന്നതിന് അത്യാവശ്യമാണ്, എന്നിരുന്നാലും, അമേരിക്കയിൽ ഏകദേശം 8-ആം നൂറ്റാണ്ടിൽ ജീവിക്കുന്ന മൾട്ടിപ്പിൾ സ്ക്ലിറോസിസ്വ്യായാമത്തെക്കുറിച്ച് അറിഞ്ഞിരിക്കുന്നതിന് ധാരാളം ഗുണങ്ങളുമുണ്ട്. മൾട്ടിപ്പിൾ സ്ക്ലിറോസിസ്, അല്ലെങ്കിൽ എം.എസ്. രോഗികൾക്ക് ശാരീരിക പ്രവർത്തനങ്ങളിൽ ഏർപ്പെടുകയും വ്യായാമങ്ങൾ കൂടുതൽ വഷളാക്കാതിരിക്കുകയും ചെയ്യുന്നത് ഒഴിവാക്കണമെന്ന് ആരോഗ്യസംരക്ഷണ പ്രൊഫഷണലുകൾ ശുപാർശ ചെയ്യുന്നു. എങ്കിലും, ഗവേഷണ പഠനങ്ങൾ സൂചിപ്പിക്കുന്നത് മൾട്ടിപ്പിൾ സ്ക്ലിറോസിസ് ഉള്ളവരുടെ ജീവിത നിലവാരം മെച്ചപ്പെടുത്താൻ വ്യായാമം കഴിയും എന്നാണ്. താഴെക്കൊടുത്ത ലേഖനത്തിന്റെ ഉദ്ദേശ്യം എം.എസ്.

വേര്പെട്ടുനില്ക്കുന്ന

യുവാക്കളിലെ സെൻട്രൽ നാഡ്യവ്യവസ്ഥയിലെ ഏറ്റവും സാധാരണമായ ദീർഘകാല കോശജ്വലനമാണ് മൾട്ടിപ്പിൾ സ്ക്ലിറോസിസ് (എം.എസ്.). സിഎൻഎസ് പതോളജിന്റെ പ്രാദേശികവൽക്കരണത്തെയും സ്വഭാവ സവിശേഷതകളെയും ആശ്രയിച്ച് രോഗം പല തരത്തിലുള്ള ലക്ഷണങ്ങളാണ് ഉണ്ടാകുന്നത്. മരുന്ന് അധിഷ്ഠിത രോഗപ്രതിരോധ ശേഷി ചികിത്സാ കൂടാതെ, നിലവിലുള്ള രോഗലക്ഷണങ്ങളെ നീക്കംചെയ്യാനും ദ്വിതീയ രോഗങ്ങൾ തടയാനും മരുന്നുകളും അധിഷ്ഠിതവും നോൺ-മരുന്നുകളുടെ ഉപയോഗവും രണ്ട് പര്യാപ്തമായ തന്ത്രങ്ങളായി സ്ഥാപിക്കപ്പെടുന്നു. പ്രത്യേകിച്ച്, വ്യായാമം, ഫിസിയോ തെറാപ്പി തുടങ്ങിയ ശാരീരിക തെറാപ്പി, വ്യക്തിയുടെ രോഗികളുടെ ആവശ്യങ്ങൾക്ക് അനുയോജ്യമാവുകയും, വ്യക്തിഗതമായ ഫലം മെച്ചപ്പെടുത്താനുള്ള കഴിവുണ്ട്. എന്നിരുന്നാലും, MS ലെ ഫിസിക്കൽ തെറാപ്പിയിലെ ഉയർന്ന ഗുണനിലവാരമുള്ള വ്യാവസായിക ഡാറ്റ അപൂർവ്വമാണ്. ഈ ലേഖനം എം.എസ്. രോഗികളിൽ ശാരീരിക പ്രവർത്തനത്തിന്റെ സ്വാധീനത്തെക്കുറിച്ചും രോഗം സംബന്ധിച്ചുള്ള രോഗലക്ഷണങ്ങളെക്കുറിച്ചും ശാരീരിക നിയന്ത്രണങ്ങൾ സംബന്ധിച്ചും നിലവിലുള്ള അറിവ് സംഗ്രഹിക്കുന്നു. മരുന്ന് ചികിത്സകൾ അല്ലെങ്കിൽ ബോധനഷ്ടം പോലെയുള്ള മറ്റു ചികിത്സാരീതികൾ ഈ ഉദ്ദേശ്യത്തിനായി മനഃപൂർവ്വമായി ഒഴിവാക്കപ്പെട്ടിരുന്നു.

അടയാളവാക്കുകൾ: മൾട്ടിപ്പിൾ സ്ക്ലിറോസിസ്, ഫിസിക്കൽ തെറാപ്പി, വ്യായാമം, തുടർച്ചയുടെ തടയൽ, വ്യക്തിഗത ചികിത്സ

എം.എസ്

എംഎസ്എസിന്റെ ദീർഘവും നീർവീക്കം നിറഞ്ഞ രോഗമാണ് എം.എസ്., മസ്തിഷ്കത്തിലെ ഗ്ലൈറോസിനും മസ്തിഷ്കത്തിലെ നട്ടെല്ലിനും മസ്തിഷ്കത്തിലെ നഷ്ടവും മൾട്ടിഫോൾ ഡീമിലിനേഷനുമുണ്ടാകുന്നു. യുവാക്കളിൽ നോൺ-ട്രോമാറ്റിക് വൈകല്യത്തിൻറെ ഏറ്റവും സാധാരണമായ കാരണങ്ങളിൽ ഒന്ന് MS- ഉം ലോകമെമ്പാടുമുള്ള ഏതാണ്ട് എൺപത് മുതൽ -10 വരെ ദശലക്ഷം ആളുകളും [1] എന്നതിനെ ആശ്രയിച്ചിരിക്കും. സ്ത്രീകളെ അപേക്ഷിച്ച് പുരുഷൻമാർ രോഗം വികസിപ്പിക്കാൻ സാധ്യത കൂടുതലാണ്. (സ്ത്രീ: പുരുഷ അനുപാതം ഏതാണ്ട്, 2.5-83: 1,2). സാധാരണയായി, എം എസ് എസാം മുതൽ എൺപതാം വയസ്സ് വരെ പ്രായമാകുമ്പോൾ എം. തുടക്കത്തിൽ നിന്ന് വ്യത്യസ്തമായ കാലഘട്ടത്തേയോ പ്രാഥമിക പുരോഗമനത്തിനായോ ശേഷം ഒരു ദ്വിതീയ പുരോഗമന ഫോറത്തിലേക്ക് പുരോഗമനത്തോടെയാണ് രോഗം കോഴ്സ് സാധാരണഗതിയിൽ പുനർവിചിന്തനം ചെയ്യുന്നത്. എം.എസ്സിന്റെ കൃത്യമായ ഇടുതിശാസ്ത്രം ഇപ്പോഴും വ്യക്തമല്ല. സിഎൻഎസ്-കോശങ്ങൾക്കെതിരെ സ്വയം പ്രതിരോധപ്രവർത്തനങ്ങളിലേയ്ക്ക് നയിക്കുന്ന പരിസ്ഥിതി, ജനിതക ഘടകങ്ങളെ സംയോജിപ്പിച്ച് സിഎൻഎസ് ടിശം കേടുപാടുകൾ, ന്യൂറോളജിക്കൽ വൈകല്യങ്ങൾ എന്നിവ ഫലമായി ഉണ്ടാകാം.

വൈറ്റ്, ഗ്രേ ട്യൂൺ ദ്രവ്യത്തിലെ മോർഫോളജിക്കൽ മാറ്റങ്ങളുടെ പ്രാദേശികവൽക്കരണവും സ്വഭാവവും അനുസരിച്ച്, കാഴ്ച വൈകല്യം, ഡിസേർറിയ, ഡിസ്പാജിയ, സ്പേഷ്യഷ്ടത, പരാസിസ്, ഏകോപനം, ബാലൻസ്, അനാക്സിയ, വേദന, സെൻസെറി വൈകല്യം, ബൾഡർ, ലൈംഗിക പിരിമുറുക്കം [3-7]. ക്ഷീണം, വൈകാരികവും മാനസികവുമായ മാറ്റങ്ങൾ എന്നിവ MS ൽ പതിവായി ലഭ്യമാണ് [8-13]. ഈ ലക്ഷണങ്ങൾ പലപ്പോഴും ലക്ഷണങ്ങളായ കഴിവുകളെ നിയന്ത്രിക്കുന്ന സ്വന്തം കഴിവുകളിലും കഴിവുകളുടേയും അഭാവത്തിൽ, പ്രവർത്തനശേഷിയില്ലാത്ത പ്രവർത്തനക്ഷമതയെ നയിക്കുകയും, പിന്നീട് ഭൗതികവും കായികാഭ്യാസവും, കുറഞ്ഞ ജീവിത നിലവാരവും [14-18] കുറയ്ക്കുകയും ചെയ്തു. മറ്റു ശാരീരികപ്രവർത്തനങ്ങളുടെ അഭാവത്തിൽ എംഎസ്എസിൽ പൊണ്ണത്തടി, ഓസ്റ്റിയോപൊറോസിസ്, കാർഡിയോവസ്ക്കുലാർ തകരാറിലായി സെക്കണ്ടറി സീക്ളെയ്ലുകളിലേക്ക് നയിക്കാൻ കഴിയും. ഇത് രോഗികൾക്ക് ഗുരുതരമായ ഭീഷണി ഉയർത്തുന്നു. പൾമോണറി എമുളൈസിസ്, അപ്പർ ശ്വാസകോശ, മൂത്രനാശയ അണുബാധകൾ, പ്രധാന ഡെക്കബിട്ടൽ അൾസർ [15,16,19].

സ്വയം രോഗപ്രതിരോധ രോഗത്തെക്കുറിച്ച് ഇന്റർഫെറോൺ β അല്ലെങ്കിൽ ഗ്ലാറ്റിംമർ അസെറ്റേറ്റ് പോലുള്ള രോഗപ്രതിരോധ മരുന്നുകൾ തിരഞ്ഞെടുക്കുന്നതിനുള്ള ചികിത്സയാണ്. ഈ മരുന്നുകൾ വേണ്ടത്ര ഫലപ്രദമല്ലെങ്കിൽ, രോഗപ്രതിരോധസംവിധാനങ്ങൾ (മൈടോക്സാസ്ട്രോൺ), മോണോക്ലോണൽ ആന്റിബോഡികൾ (നറ്റാലിക്കുമ-മാബ്) അല്ലെങ്കിൽ അടുത്തിടെ അംഗീകരിച്ച സ്ഫിൻജോസിൻഫോസ്ഫേറ്റ് റിഡോർഡർ മോഡ്യൂലേറ്റർ വിത്ത്പോളിമോഡിനോടൊപ്പം (ചിത്രം 1) [20-22] ആവശ്യമുണ്ട്.

നിർവചനങ്ങൾ

ഈ വ്യവസ്ഥിതിയുടെ ഉദ്ദേശ്യത്തിന്, നിർവചനം, ശാരീരിക പ്രവർത്തികൾ, വ്യായാമം, ശാരീരിക പ്രവർത്തനം, ഫിസിക്കൽ തെറാപ്പി, ഫിസിയോതെറാപ്പി, കായികവിനോദയം എന്നിവ താഴെ പറയുന്ന നിർവചനങ്ങൾക്കനുസൃതമായി ഉപയോഗിക്കും (ടേബിൾസ് ആൻഡ് ഇൻസ്ക്രീൻ): മോട്ടോർ സിസ്റ്റത്തിന്റെ കാര്യത്തിൽ, "ശരീരത്തിന്റെ സ്ഥാനത്ത് സജീവമായതോ മരവിപ്പിക്കപ്പെടുന്നതോ ആയ മാറ്റങ്ങൾ ഉൾപ്പെടുന്നു. ജീവിതത്തിന്റെ എല്ലാ ഘട്ടങ്ങളിലും രോഗങ്ങളും രോഗങ്ങളും തടയുന്നതും സ്ഥിരതയാർന്നതുമായ വ്യായാമവും ശാരീരിക പ്രവർത്തനവും ഒരു വ്യക്തിയുടെ ജീവിത നിലവാരത്തിൽ നിർണ്ണായക ഘടകങ്ങളാണ്. ഫിസിക്കൽ നേട്ടം, മത്സരം, രസകരം എന്നിവയിൽ ശ്രദ്ധ കേന്ദ്രീകരിക്കുന്ന സ്പോർട്സിനെ എതിർത്ത്, ശാരീരിക പ്രവർത്തനങ്ങൾ ഏത് തരത്തിലുള്ള ശാരീരിക നീക്കങ്ങളെ ഉൾക്കൊള്ളുന്നു, അത് ഊർജ്ജം കവർ ചെയ്യുന്നു, അടിസ്ഥാനപരമായ പ്രചോദനം പരിഗണിക്കാതെ. "ആരോഗ്യ-മെച്ചപ്പെടുത്തൽ ശാരീരിക പ്രവർത്തനങ്ങൾ" എന്നതുകൊണ്ട് ഒഴിവുസമയ പ്രവർത്തനങ്ങൾ (ഉദാ: സ്പോർട്സ്), ദൈനംദിന പ്രവർത്തനങ്ങൾ (ഉദാ: പടികയറ്റം) എന്നിവയും ഉൾപ്പെടുന്നു. ലൈറ്റ് ആക്റ്റിവിറ്റി (MET; XMET MET) = മുതിർന്നപ്പോൾ, = 1 മില്ലി (പുരുഷന്മാർ), 2 മില്ലി (O1 / kg / min) (ലൈറ്റ്) (<xNUMX) MET), മിതമായ (3.5-3.2 MET) ഊർജ്ജവും (> 2 MET). പൊതുവായ ശാരീരിക പ്രവർത്തനങ്ങൾക്ക് വിരുദ്ധമായി, വ്യായാമം, ശാരീരികാവസ്ഥ നിലനിർത്താനും, പ്രകടനം മെച്ചപ്പെടുത്താനും, വ്യവസ്ഥാപിതമായി ആവർത്തിച്ചുള്ള ചലനങ്ങളുടെ ആസൂത്രിത പ്രകടനം ഉൾക്കൊള്ളുന്നു. കൂടുതൽ പ്രത്യേകമായി അത്ലറ്റിക്, ജനറൽ ഫ്ലെക്സിബിലിറ്റി മെച്ചപ്പെടുത്തുന്നതിന് ലക്ഷ്യമിടുന്നു. ഉയർന്ന നിലവാരത്തിൽ കൂടുതൽ സമയം, പ്രകടനം മെച്ചപ്പെടുത്തുന്നതിന് എൻഡുറൻസ് ട്രെയ്നിംഗ് എന്നിവ ഉൾപ്പെടുന്നു. നിബന്ധനകൾ സഹിഷ്ണുതയും എയ്റോബിക് പരിശീലനവും, കൂടാതെ പ്രതിരോധവും ശക്തി പരിശീലനവും, പലപ്പോഴും പരസ്പരം ഉപയോഗിക്കപ്പെടുന്നു. ദൈനംദിന ജീവിതത്തിലെ ഏറ്റവും നൂതനമായ പ്രവർത്തനങ്ങൾ (ADL), സാമൂഹ്യ വൽക്കരിക്കൽ, വിനോദപരിപാടികളുടെ അന്വേഷണം എന്നിവ ഉൾപ്പെടുന്ന ഏറ്റവും ഉയർന്ന തലത്തിൽ കൂടുതൽ സങ്കീർണ്ണമായ നടപടികൾ ഫിസിക്കൽ ഫംഗ്ഷൻ ഉൾക്കൊള്ളുന്നു. [3] "ഫിസിയോതെറാപ്പിയിൽ" എന്ന വാക്ക് മാനുവൽ വൈദഗ്ധ്യങ്ങൾ ഉൾക്കൊള്ളുന്നു. ഇത് വെള്ളം, ചൂട്, വെളിച്ചം, വൈദ്യുതി തുടങ്ങിയ പരിഹാരങ്ങളാൽ ഉചിതമായ അനുബന്ധമാണ്, മനുഷ്യ ശരീരത്തിന്റെ പ്രവർത്തനവും ബോധപൂർവ്വവും തിരിച്ചെടുക്കാനുള്ള ലക്ഷ്യവും. ഫിസിയോതെറാപ്പിക് രീതികളുടെ ഒരു ഭാഗമാണ് സജീവ / അല്ലെങ്കിൽ പരിശീലന പരിശീലന പരിപാടികൾ. മറിച്ച് വ്യായാമം, ഫങ്ഷണൽ പരിശീലനം, ഫിസിയോതെറാപ്പി, പുനരധിവാസം തുടങ്ങിയ വിവിധ ശാരീരിക പ്രവർത്തികൾ ഉൾപ്പെടുന്ന ഒരു ശാരീരിക തെറാപ്പി എന്നതിന് പകരം "ഫിസിക്കൽ തെറാപ്പി" ഉപയോഗിക്കാറുണ്ട്.

ലക്ഷണങ്ങളിലുള്ള ചികിത്സാപരമായ ചികിത്സ: ലക്ഷണങ്ങളുടെ ഒരു വ്യക്തിഗത പരിഷ്കരണത്തോടെ ലക്ഷ്യം

മയക്കുമരുന്ന് ഉപയോഗം, മയക്കുമരുന്ന് അധിഷ്ഠിതമായ ലക്ഷണങ്ങളോട് എസ്.എം.എല്ലിനുള്ള പരസ്പര സഹകരണം. സമഗ്രമായ അവലോകനങ്ങൾ [21,22] പരാമർശിച്ച മയക്കുമരുന്ന അടിസ്ഥാന സമീപനങ്ങളെ ഈ ലേഖനത്തിന്റെ പരിധിക്കു പുറത്താണ്. കൗൺസിലിംഗ്, നഴ്സിങ് കെയർ കൂടാതെ ഫിസിയോ തെറാപ്പി, ലോജിയോഡീഡിക്സ്, ലൈഫ് ആന്റ് മൊബിലിറ്റി എയ്ഡ്സ്, സൊസൈറ്റി തെറാപ്പി, സൈക്കോതെറാപ്പി എന്നിവയുൾപ്പെടെ ഫിസിക്കൽ തെറാപ്പി ഉൾപ്പെടുന്നു. ഈ നടപടികൾ മൾട്ടിമോഡായി പ്രയോഗിക്കാവുന്നതാണ്, ഇതിനർത്ഥം പല രോഗികളും ഒരു രോഗിയുടെ ചികിത്സാ തന്ത്രത്തിൽ ഒന്നിച്ചു ചേർക്കുന്നുവെന്നും പൊതുവായി മയക്കുമരുന്ന് തെറാപ്പി നൽകണമെന്നും [1]. വ്യക്തിപരമായ ലക്ഷണങ്ങൾ അനുസരിച്ച് ശാരീരിക ചികിത്സകൾ ഒരേ സമയം പല ഘടകങ്ങളെ ദോഷകരമായി ബാധിക്കുന്നു. ലക്ഷണങ്ങളെ കുറയ്ക്കൽ, ചലനശേഷി വർദ്ധിപ്പിക്കുക, ജീവിത നിലവാരം മെച്ചപ്പെടുത്തുക, സാധ്യമായ സ്വാതന്ത്ര്യം നൽകുക മുതലായവ, പ്രത്യേകിച്ച് എ.ടി.എല്ലുകളുടെ എക്സ്റ്റൻഷൻ പരിശീലനം വഴി കഴുകുക, തിന്നുക, കുടിക്കുക, വസ്ത്രധാരണം, വീട്ടുജോലികൾ ചെയ്യൽ, രോഗലക്ഷണങ്ങൾ എന്നിവ ജീവൻ അപകടകരമായ ദ്വിതീയ രോഗങ്ങൾ [4,23,24]. രോഗലക്ഷണങ്ങളുടെ ആദ്യ അസുഖങ്ങൾ മുതൽ രോഗബാധിതരായ രോഗികൾക്കും സാന്ദർഭിക അവസ്ഥകൾ വരെയും രോഗം ഓരോ ഘട്ടത്തിലും പ്രയോഗിക്കാൻ കഴിയുന്നു. ഫിസിയോതെറാപ്പിയിൽ നിന്നും വ്യത്യസ്തമായി, MS രോഗികൾക്ക് സാധാരണയായി ഉപയോഗിക്കുന്ന ചികിത്സാരീതികളല്ല വ്യായാമം. എന്നിരുന്നാലും, എം.എസ്. രോഗികളിലെ വിവിധ ശാരീരിക പ്രവർത്തനങ്ങൾ മെച്ചപ്പെടുത്തുന്നതിന് ഇത് ഫലപ്രദവും ചെലവുകുറഞ്ഞതുമായ ഉപകരണമായിരിക്കാം.

MS രോഗികളിൽ വ്യായാമം: ക്ലിനിക്കൽ പാരാമീറ്ററുകളിലെ ഇഫക്റ്റുകൾ (പട്ടിക 3)

സ്വാസീഷ്യൻ അല്ലെങ്കിൽ പരെസിസ് പോലുള്ള MS രോഗികളുടെ രോഗം പ്രധാനമായും രോഗം പുരോഗമനത്തിന്റെ (മോർഫോളിക്കൽ മാറ്റങ്ങൾ) ഒരു പരിണതഫലമാണ്, എന്നാൽ ഇത് ശാരീരിക പ്രവർത്തനം കുറച്ചുകൊണ്ട് കൂടുതൽ സങ്കീർണ്ണമാക്കും [14,26]. എംഎസ് രോഗികളുടെ ശരീരശാസ്ത്രത്തിന്റെ വിവിധ വശങ്ങളെ മെച്ചപ്പെടുത്തുന്നതിന് വ്യായാമം ചെയ്തു. പ്രത്യേകിച്ച്, നിഷ്ക്രിയത്വ സംബന്ധമായ വൈകല്യം വ്യായാമത്തിലൂടെ [[26]] ഒഴിവാക്കാൻ കഴിയും. എന്നിരുന്നാലും, MS ഉള്ള രോഗികൾക്ക് ഒരുപാട് പരിമിതികൾ നേരിടേണ്ടിവരുന്ന ശുപാർശകൾ: ശുപാർശകളെ അടിസ്ഥാനമാക്കിയുള്ള ധാരാളം പഠനങ്ങൾ ഉണ്ടെങ്കിലും, ഈ പഠനങ്ങളിൽ പലതും പരിമിതികളാണ്, ചെറിയ സാമ്പിൾ വലുപ്പങ്ങൾ, ഉചിതമായ നിയന്ത്രണ ഗ്രൂപ്പ് , കണ്ണാടിയില്ലാത്ത ഡിസൈൻ, രോഗത്തിൻറെ വിവിധ കോഴ്സുകളും ഘട്ടങ്ങളും തമ്മിലുള്ള വേർതിരിച്ചെടുക്കുന്നതിൽ പരാജയപ്പെട്ടു. വാസ്തവത്തിൽ, ചിലപ്പോൾ ക്രമരഹിതമായി നിയന്ത്രിതവും അന്ധമായ പഠനപദ്ധതിയും പ്രയോഗിക്കപ്പെടുന്നു. പരിശീലന രീതികൾ പലപ്പോഴും സ്റ്റാൻഡേർഡ് ആയിരിക്കില്ല, കൂടാതെ ഇടപെടലുകൾ അത്ര കൃത്യമായി വിവരിച്ചിട്ടില്ല. ഏതാനും മാസങ്ങൾ വരെ നീളുന്ന ചികിൽസകൾ, വിവിധ ചികിത്സാ ആക്റ്റിവിറ്റികൾ, വിവിധ ചികിൽസകൾ എന്നിവയുടെ തീവ്രത കുറയ്ക്കാനുള്ള ചികിൽസാ രീതികൾ പഠനങ്ങളുടെ താരതമ്യത്തിൽ കൂടുതൽ പരിമിതപ്പെടുത്തുന്നു. ഈ ഇടപെടലുകളുടെ ദീർഘകാല ഫലങ്ങൾ വളരെ അപൂർവ്വമായി റിപ്പോർട്ട് ചെയ്യപ്പെടുന്നു [14,27 - 31]. കൂടാതെ, വ്യായാമത്തിന്റെ ഫലങ്ങളിൽ ഏതാണ്ട് പ്രത്യേകിച്ച് എം.എസ്. രോഗികൾക്ക് നേരിയതോതിൽ മിതമായതോ കുറഞ്ഞതോ ആയ വ്യായാമങ്ങൾ (എക്സ്.എസ്.എക്സ്.എക്സിനെ അപേക്ഷിച്ച് കൂടുതൽ വിപുലീകൃത വൈകല്യ സ്റ്റാറ്റസ് സ്കെയിൽ (EDSS) യിൽ സ്കോർ ചെയ്യുന്നു. ഞങ്ങളുടെ അറിവ്, ഏറ്റവും പുതിയതായി പ്രസിദ്ധീകരിച്ച ഒരു പഠനം മാത്രമായിരുന്നു പരിശോധനാഫലം. എൺ.എസ്.എസ്.

ചുരുക്കത്തിൽ, പഠനങ്ങളുടെ അപര്യാപ്തമായ മാനദണ്ഡ ഗുണനിലവാരവും അപര്യാപ്തമായ വിശദീകരണങ്ങളായ പരിശീലന വ്യവസ്ഥകളും [14,29,33] ഈ പഠനങ്ങളിൽ ഭൂരിഭാഗവും പ്രതിരോധത്തെ (ഉദാഹരണം പുരോഗമന പ്രതിരോധ വ്യായാമങ്ങൾ, നടപ്പാത മെക്കാനിക്സ്), സഹിഷ്ണുത (ഉദാ: സൈക്കിൾ ർമെത്തോമെട്രി, കൈ അല്ലെങ്കിൽ കൈ- എം.എൻ. രോഗികൾ [14,15,28,29] ൽ വ്യായാമത്തിന് ആനുകൂല്യങ്ങൾ നൽകുന്നതിന് തെളിവുകൾ നൽകിയിട്ടുണ്ട്. ഈ പരിശീലന പരിപാടികൾ താഴെ കൂടുതൽ വിശദമായി നൽകുന്നു. എല്ലാ പരിശീലന പരിപാടികൾക്കും രോഗികൾക്ക് നല്ല ക്ഷമയുണ്ട്. ഏതാണ്ട് എൺപതു ശതമാനം ഇൻപോഷ്യന്റ് പങ്കാളികളും, ഹോം എൻജിനീയറി ട്രയലുകളിലെ എൺപതു മുതൽ പന്ത്രണ്ട്% വരെ പങ്കെടുക്കുന്നവരിൽ പ്രതികൂല സംഭവങ്ങൾ [100-59] സംഭവിക്കാതെ പൂർത്തിയാക്കി.

എൻഡുറൻസ് ട്രെയിനിംഗ്

മിതമായ എൻഡ്യൂറൻസ് ട്രെയ്നിംഗ് ഫലമായി താഴ്ന്നതും അപ്പർ അറ്റകുറ്റപ്പണികൾക്കുമുള്ള മെച്ചപ്പെട്ട മസിലുകളെയും, വേഗത, ക്ഷീണം, ജീവിത നിലവാരം [14,15,17,28,29,31,34] എന്നിവ പോലെയുള്ള ചില പ്രവർത്തന പരിപാടികളാണ്. ചില എഴുത്തുകാരെ ചെയർ ട്രാൻസ്ഫറിൽ [14,39], നടത്തം, സ്റ്റെയർ ക്ലൈംബിംഗ്, ടൈംഡ് ചെയ്ത് ടെസ്റ്റ് ചെയ്യൽ (ഒരു കസേരയിൽ നിന്നുനിന്നുകൊണ്ട്, നന്നാക്കാൻ പോവുക, വീണ്ടും തിരിഞ്ഞ് സീറ്റുകളിൽ) [3]. എന്നാൽ, മുകളിൽ പറഞ്ഞതുപോലെ, വ്യത്യസ്തവും വൈരുദ്ധ്യവുമായ ഫലങ്ങൾ കണ്ടെത്തി. ഉദാഹരണത്തിന്, ചില എഴുത്തുകാർ എയറോബിക് ശേഷിയിൽ ഗണ്യമായി മെച്ചപ്പെടുത്തിയതായി റിപ്പോർട്ട് ചെയ്തു, പരമാവധി ഓക്സിജൻ ഉയർത്തൽ (VO14,35,40-max), [2], മറ്റുള്ളവർ ശ്രദ്ധേയമായ മെച്ചപ്പെടുത്തലുകൾ [14,41,42] നിരീക്ഷിച്ചില്ല.

[30,35,45] എൻഡ്യൂറൻസ് ട്രെയ്നിംഗിലൂടെ ക്ഷീണം മെച്ചപ്പെടുത്തുന്നതിനുള്ള ചില തെളിവുകൾ ഉള്ളതിനാൽ ഇത് ക്ഷീണം ബാധകമാവുന്നു, മറ്റു പഠനങ്ങൾ സ്ഥിതിവിവരശാസ്ത്രപരമായ പ്രാധാന്യം [14,28,35] നിരസിച്ചു അല്ലെങ്കിൽ ഏതെങ്കിലും വ്യത്യാസങ്ങൾ ഒന്നും വെളിപ്പെടുത്തിയിട്ടില്ല [27,46,47].

വിറ്റാലിറ്റി [14,48], സോഷ്യൽ ഫംഗ്ഷൻ [14,44,48], മാനസികാവസ്ഥ [14,42,44], ഊർജ്ജം [14,42], കോപം [14,41], ലൈംഗിക പ്രവർത്തനം [14], മൂത്രാശയം, പാമ്പ് എന്നിവ പോലുള്ള വൈവിധ്യമാർന്ന ജീവിത നിലവാരത്തിൽ വൈരുദ്ധ്യാത്മക ഡാറ്റ റിപ്പോർട്ട് ചെയ്യപ്പെട്ടിട്ടുണ്ട്. പ്രവർത്തനം നടത്തും [41], വിഷാദം [14,41].

കുറഞ്ഞത് രോഗബാധിതരായ രോഗികളെ അപേക്ഷിച്ച് കൂടുതൽ ശാരീരികസമ്പന്നരായ വൈകല്യങ്ങളുള്ള എൺപതുമാസത്തെ എപിഎബി എയ്റോബിക് പരിശീലന പരിപാടിയുടെ ഫലമായി ഒരു സംഘം വിശകലനം നടത്തി. എൺപത് രോഗികൾ മാത്രം പഠിച്ച 6 രോഗികളുടെ ചെറിയ സാമ്പിൾ സൈസ് [1]. അതിനാൽ ഈ ഫലങ്ങൾ ശ്രദ്ധയോടെ കൈകാര്യം ചെയ്യേണ്ടതുണ്ട്. കൂടുതൽ പഠനങ്ങൾ ആവശ്യമാണ്.

പ്രതിരോധ പരിശീലനം

ആരോഗ്യമുള്ള ആളുകളിൽ മസിലുകൾ ശക്തിപ്പെടുത്തുന്നതിന് പ്രതിരോധ പരിശീലനം ഏറെയാണ്. MS രോഗികളിൽ പേശികളുടെ കഴിവ് മെച്ചപ്പെടുത്തുന്നതിന് തെളിവുകൾ ഉണ്ട് [35,40]. കൂടാതെ, വേഗത്തിലുള്ള വേഗത, സ്റ്റെപ്പിംഗ് എൻഡുറൻസ്, സ്റ്റെയർ ക്ലൈംബിംഗ്, ടൈംഡ് അപ്, ടെസ്റ്റ്, സ്വയം റിപ്പോർട്ട് ചെയ്ത വൈകല്യം, സ്വയം റിപ്പോർട്ട് ചെയ്ത ക്ഷീണം തുടങ്ങിയവയെക്കുറിച്ച് എം.ഇ. രോഗികളിൽ വിശേഷിച്ചും, ഡൈനാമിക് ഗൈറ്റ് ഇൻഡെക്സ് [35,49].

പ്രതിരോധ പരിശീലനത്തിന്റെ വ്യത്യസ്ത രൂപങ്ങളുണ്ട്. ഉദാഹരണമായി, ഒരു ഫോം, പുരോഗമന പ്രതിരോധ വ്യായാമത്തെ (പ്രി) ഉൾക്കൊള്ളുന്നു, ഇത് ടെയ്ലർ et al. ഇനിപ്പറയുന്ന മൂന്ന് തത്ത്വങ്ങൾ ഉൾക്കൊള്ളുന്നു: "1. പേശി ക്ഷീണം ആഗമിക്കുന്നതുവരെ താരതമ്യേന ഉയർന്ന ലോഡുകളുള്ള ചെറിയ എണ്ണം ആവർത്തനങ്ങളെ പ്രവർത്തിപ്പിക്കുക, 2. വീണ്ടെടുക്കലിനും വ്യായാമത്തിനും ഇടയിൽ മതിയായ വിശ്രമം അനുവദിക്കുക, കൂടാതെ 3. ലോഡ് പേശി ബലപ്പെടുത്തുവാനുള്ള ശേഷി വർദ്ധിപ്പിക്കും "[40].

Cakit et al. 45 MS രോഗികളുടെ [35] ന്റെ ഒരു റാൻഡമൈൻഡഡ് നിയന്ത്രിത പരീക്ഷണത്തിലെ ബാക്കി വ്യായാമവുമൊത്ത്, പുരോഗമന പ്രതിരോധ പരിശീലനത്തിനും താഴ്ന്ന ലിംങ് ശക്തിപ്പെടുത്തലിനും സൈക്ലിംഗ് വഴി PRE യുടെ പ്രഭാവം പരിശോധിച്ചു. ആഴ്ചയിൽ എട്ടു ആഴ്ചകൾക്കുള്ളിൽ, രണ്ട് പരിശീലന ഗ്രൂപ്പുകളിലെ രോഗികൾ, 8 മീ. നടത്തം പരിശോധിക്കുന്നതിനും, വ്യായാമത്തിന്റെ കാലാവധിയിലേക്കും, ഇടവേളകളില്ലാത്ത കൺട്രോൾ ഗ്രൂപ്പിലെ രോഗികളെക്കാളും പരിശോധന നടത്തും. മാത്രമല്ല, ബാലൻസ്, ക്ഷീണം, വിഷാദം, വീഴ്ച ഭയം എന്നിവയെക്കുറിച്ച് മികച്ച ഫലങ്ങൾ നൽകുന്നതിന് പരിശീലക സംഘങ്ങൾ തെളിയിച്ചു.

ടെയ്ലർ et al. എം എസ് രോഗികളിൽ [10] പരമാവധി മസിൽ ശക്തി, മസിലുകളുടെ എൻഡ്യൂറൻസ്, പ്രവർത്തന പ്രവർത്തനങ്ങൾ, മൊത്തത്തിലുള്ള മാനസിക പ്രവർത്തനങ്ങൾ എന്നിവയിലെ ഒരു 40 ആഴ്ച PRE പ്രോഗ്രാം എന്ന പ്രയോഗം അന്വേഷിച്ചു. ആംഗിൾ ശക്തി, ലെഗ് എൻഡ്യൂറൻസ്, വേഗത്തിലുള്ള വണ്ടി വേഗത്തിന്റെ കാര്യമായ മെച്ചപ്പെടുത്തലുകൾ എന്നിവയെ കുറിച്ച് എഴുത്തുകാർ റിപ്പോർട്ടു ചെയ്തിരുന്നു. കൂടാതെ, എൺപത് മിനിറ്റ് ദൈർഘ്യമുള്ള വാക്ക്-പരിശോധനയും ദൈനംദിന ജീവിത പ്രവർത്തനവും മെച്ചപ്പെടുത്താനുള്ള ഒരു പ്രവണതയാണ് എഴുത്തുകാർ റിപ്പോർട്ട് ചെയ്തത്.

പ്രി കൂടാതെ, ശരിയായ ഗൈറ്റ് മെക്കാനിക് പ്രോത്സാഹിപ്പിക്കുന്നതിനുള്ള തന്ത്രങ്ങൾ പോലെയുള്ള മറ്റ് പരിശീലനരീതികൾ, ഭാരം വഹിക്കുന്നതിൽ ഭാരം, ഭാരം മാറ്റൽ, ബോഡി പൊസിഷനിംഗ്, അല്ലെങ്കിൽ വെയ്റ്റ്ലിഫ്റ്റി എന്നിവ ഉപയോഗിക്കുന്നത് [49] ആണ്. ഉദാഹരണത്തിന്, പിലുട്ടി et al. ശരീരഭാരം പിന്തുണയ്ക്കുന്ന ട്രെഡ്മിൽ പരിശീലനത്തിന്റെ ഒരു ആഴ്ചയിൽ ഒരു മണിക്കൂറാണ് പുരോഗമന MS (അഞ്ച് പ്രാഥമിക പുരോഗമനമുള്ള രോഗികൾ, സെക്കണ്ടറി പുരോഗമന രോഗമുള്ള ഒരു രോഗി), വൈകല്യമുള്ള ആറ് രോഗികളിൽ (EDSS 5- 8) ആഴ്ചയിൽ മൂന്ന് മിനിറ്റ് പ്രതിദിനം മൂന്നുമണിക്കൂർ [12]. പരിശീലന തീവ്രതയിൽ ട്രെഡ്മിൽ വാക്കിങ് വേഗതയും, ശരീരഭാരം കുറയ്ക്കലും, ജീവിതശൈലിയുടെ ഗുണനിലവാരത്തിന്റെ ഭൗതികവും മാനസികവുമായ സബ്കലേറ്റുകളിൽ രോഗികൾ മെച്ചപ്പെടുത്തി. ക്ഷീണം കുറയ്ക്കപ്പെട്ടില്ല.

സംയോജിത ക്ഷമതയും ചെറുത്തുനിൽപ്പ് പരിശീലനവും

MS ലെ സംയുക്ത പ്രതിരോധവും സഹിഷ്ണുത പരിശീലനവും പ്രമേയമാക്കി ഏതാനും ചില അംഗങ്ങൾ പരിശോധിച്ചു. പേശി ബലത്തിലും ഗെയ്റ്റ് വേഗതയിലും ചെറിയ മെച്ചപ്പെടുത്തലുകൾ വിവരിച്ചിട്ടുണ്ട് [14,34,50]. സൂക്ഷ്മപരിശോധനയിൽ, MSM രോഗികളിൽ Surakka et al ഒരു താരതമ്യേന വലിയ പഠനത്തിൽ. ആറുമാസത്തെ പ്രതിരോധവും എൻഡ്യൂറൻസ് ട്രെയിനിംഗും ആറു മാസത്തിനു ശേഷം നിർണായകമായ പരിശീലന പ്രഭാവം നിരീക്ഷിച്ചു. എന്നാൽ പുരുഷൻമാരിലല്ല, സ്ത്രീകളിലെ 95% കൂടുതലായ വ്യായാമ പ്രവർത്തനത്തിലൂടെ ഇത് വിശദീകരിക്കാം. ഇതുകൂടാതെ, റോബർഗ്ഗ് et al. ആറുമാസത്തെ മൊത്തം വ്യായാമ പരിശീലനത്തിനു ശേഷം നടക്കാനുള്ള വേഗതയിലും അപ്പർ എർറ്റിറ്റി എന്റർമെന്റിലും ഗണ്യമായ മെച്ചപ്പെടുത്തലുകൾ റിപ്പോർട്ടു ചെയ്തിരുന്നു. എന്നാൽ, താഴ്ന്ന അറ്റകുറ്റപ്പണികൾ, VO25- മാക്സ്, സ്റ്റാറ്റിക് ബാലൻസ്, മാനുവൽ ഡീപ്ലിറ്റീറ്റി [50] മെച്ചപ്പെടുത്തുന്നില്ല.

എ.ഡി.എൽ, കോൾട്രാൻ സഹകരണം, എ.ടി.എൽ, ആരോഗ്യവുമായി ബന്ധപ്പെട്ട ജീവിത നിലവാരം (എച്ച് ആർ ക്യു എൽ), എം.എസ്. രോഗികളിലെ വിവിധ ലക്ഷണങ്ങളിലുള്ള ഫിസിക്കൽ തെറാപ്പി എന്നിവയുടെ ഫലങ്ങളെക്കുറിച്ചുള്ള ഒരു വ്യത്യാസമാണ് കോക്റാൻ സഹകരണം പ്രസിദ്ധീകരിച്ചത്. അക്കാലത്ത് ഒരു രോഗചികിത്സാഹം അനുഭവിക്കാത്ത എം. എസ്. രോഗികളിൽ മാത്രം നിയന്ത്രിതവും ക്രമരഹിതവുമായ ക്ലിനിക്കൽ പഠനങ്ങൾ ഉൾപ്പെടുത്തിയിട്ടുണ്ട്. ആറ് നാഴികകളുടെ വ്യാഖ്യാനം മാത്രമാണ് അവരുടേതായി പ്രസിദ്ധീകരിച്ചിട്ടുള്ളത്, ഫിസിക്കൽ തെറാപ്പി (പുനരധിവാസം, ഫിസിയോതെറാപ്പി, വ്യായാമം, ഫൗണ്ടേഷൻ പരിശീലനം, സ്വതന്ത്രമായ ഹോം അടിസ്ഥാനത്തിലുള്ള പരിശീലനം, ജലവൈദ്യുതവനം) തുടങ്ങിയവയുടെ അനേകം പഠനങ്ങൾ. ഏതെങ്കിലും ഫിസിക്കൽ തെറാപ്പി ലഭിക്കാത്ത കൺട്രോൾ ഗ്രൂപ്പ് [2005-33]. മറ്റ് രണ്ട് ഫിസിക്കൽ തെറാപ്പി പ്രോഗ്രാമുകളുടെ ഫലങ്ങൾ താരതമ്യം ചെയ്തു. സംവേദനത്തിൽ, പേശി ബലത്തിൽ, ചലനം (ചലനത്തെ മാറ്റുകയും നിലനിർത്തുകയും ചെയ്യുക, നടത്തം, ചലിക്കുന്ന സമയം, സമയം കൈമാറ്റം, നടത്തം ചമയം എന്നിവ), വ്യായാമം ടോളറൻസ് ടെസ്റ്റുകൾ (പരിഷ്കരിച്ച ഗ്രേഡഡ് വ്യായാമം പരിശോധന, VO36,39,41,51- മാക്സ്, ഫിസിയോളജിക്കൽ ചെലവ് സൂചിക) എല്ലാം ഗണ്യമായി മെച്ചപ്പെടുത്തി. മൂഡ് പാരാമീറ്ററുകൾ (ഭയം, വിഷാദം) moderate improvement, EDSS, ക്ഷീണം, മാനസിക വ്യാപ്തി, ADL എന്നിവ മാറ്റമില്ലാതെ തുടർന്നു [53].

അസനോയും മറ്റുപേരും എംഎസ്എൻഎക്സ് മുതൽ എൺപത് മുതൽ [1950] വരെ നടത്തിയ വ്യായാമ ഇടപെടലുകളുടെ തിരഞ്ഞെടുത്ത റാൻഡാലിഡ് നിയന്ത്രിത പരീക്ഷണങ്ങളുടെ (ആർടിസി) രീതിശാസ്ത്രപരമായ നിലവാരം വിശകലനം ചെയ്തു. ശാരീരികവും മാനസികവുമായ സാമൂഹിക സാമൂഹ്യ പ്രവർത്തനത്തിലും ജീവിതത്തിന്റെ ഗുണത്തിലും വ്യായാമത്തിന്റെ ഫലപ്രദമായ ഫലങ്ങൾക്ക് തെളിവുകൾ കണ്ടെത്തി, പക്ഷേ ഈ മേഖലയിൽ ഉയർന്ന ഗുണനിലവാരമുള്ള ആർ.സി.റ്റിക്ക് വലിയ ആവശ്യം ഉയർത്തി.

MS രോഗികളിൽ വ്യായാമം: വൈകല്യത്തെക്കുറിച്ച് ശരീര താപനിലയെ സ്വാധീനിക്കുന്നു

ജർമ്മനിയിലെ ഒളിതാംഗശാസ്ത്രജ്ഞനായ വിൽഹെം ഉഹ്താഫ് (1890 - 1853) ശാരീരിക പ്രവർത്തനത്തിനു ശേഷമുള്ള കാഴ്ച വൈകല്യവും പയറിസും ആദ്യമായി വിവരിച്ചു. രോഗികളുടെ ശരീര താപനില രേഖപ്പെടുത്തിയിട്ടില്ല കാരണം, ഉദ്ധാരണം വിശദീകരിച്ചിരിക്കുന്ന ലക്ഷണങ്ങൾ ശാരീരിക പ്രവർത്തനങ്ങളാൽ സംഭവിച്ചതാണെന്നതാണ്, മാത്രമല്ല ശരീരത്തിലെ താപനില വർദ്ധിക്കാത്തതുകൊണ്ടാണിത്. തുടർന്ന്, MSM രോഗികൾക്ക് വ്യായാമത്തിൽ ഏർപ്പെടരുതെന്ന് നിർദ്ദേശിച്ചു [1927-14]. വാസ്തവത്തിൽ, എം എസ് രോഗികളിൽ 83 മുതൽ 83% വരെ ശരീരത്തിലെ താപനില വർദ്ധിക്കുന്ന സാഹചര്യങ്ങളിൽ നൊസ്റ്റാലിജിക്കൽ ലക്ഷണങ്ങളുടെ മുൻകൈയെടുക്കുന്നതിനോ അല്ലെങ്കിൽ ഗുരുതരമായ ശാരീരിക പ്രവർത്തനങ്ങൾക്കോ, ശാരീരിക പ്രവർത്തനത്തിലോ, പനിയിലോ, ചൂടുള്ള ബാത്വേയിലോ [16,19,46,54,55-60] വേദന അനുഭവപ്പെടുന്നു. ആദ്യ വിവരണത്തിന്റെ ഒരു സൂചന എന്ന നിലയിൽ, "ഉധോഫ്സ് പ്രതിഭാസം" എന്ന പദത്തിന് രൂപം നൽകിയിട്ടുമുണ്ട്. ഡൈസോട്ടൊനോമിയ കാരണം താപനില കാരണമാണിതെന്ന് സൂചിപ്പിക്കുന്നു. ഇത് ഭാഗികമായി നിർജ്ജീവമായ axons (80) എന്ന പ്രവാഹത്തിന്റെ വേഗതയെ ആശ്രയിച്ചുള്ള ശേഷി സഹിക്കുന്നു. ഏതാണ്ട് എൺപത് വരെ, അനേകം സിസ്റ്റമാറ്റിക് അന്വേഷണങ്ങൾ പുറത്തുവന്നത് ശരീരത്തിന്റെ താപനിലയും വൈകല്യമുള്ളവർക്കിടയിലെ തീവ്രതയും തമ്മിലുള്ള ബന്ധം വെളിപ്പെടുത്തി.

വ്യായാമത്തെ ഒഴിവാക്കാൻ എം.എസ്. രോഗികൾക്കുള്ള മറ്റൊരു വാദം ഊർജ്ജത്തിന്റെ ഒരു "മാലിന്യ" ക്ഷീണതയെ കൂടുതൽ വഷളാക്കുന്നതും എ.ഡി.എൽ.സ് [ഇതുവരെ] സ്ഥിരീകരിക്കാത്തതും കുറയ്ക്കാൻ സഹായിക്കുമെന്ന അനുമാനമാണ്. കൂടാതെ, സിഎൻഎസ് ഘടനയിൽ ശാരീരികപ്രവർത്തനത്തിൻറെ ഹാനികരീതിയോ അല്ലെങ്കിൽ റിപ്പപ് റേറ്റുകളുടെ പ്രവർത്തനം മധ്യസ്ഥതയുടെ വർദ്ധനവുമായോ ഒരു ഫലവും ഉണ്ടായിട്ടില്ല [14].

MS രോഗികളിൽ വ്യായാമം: രോഗപ്രതിരോധ സംവിധാനത്തിന്റെ ഫലങ്ങൾ

വിവിധ ദിശകളിലെ അമിത ശ്വാസകോശ സംബന്ധമായ അസുഖങ്ങൾ പോലെയുള്ള സാധാരണ പകർച്ചവ്യാധികൾക്കുള്ള അപകട സാധ്യതയെ വ്യായാമത്തിൽ സ്വാധീനിക്കാം. മത്സരാധിഷ്ഠിതമായ കായികവിനോദങ്ങൾ വളരെ ശാരീരിക പ്രവർത്തനങ്ങളിലൂടെ അണുബാധകൾ കൂടുന്നതിന് കാരണമാകുമ്പോൾ, മിതമായ വ്യായാമം അവരുടെ തടയുന്നതിന് സഹായിക്കും [58-15,19,57].

രോഗപ്രതിരോധസംവിധാനത്തിൽ ആരോഗ്യമുള്ള വിഷയങ്ങളിൽ ശാരീരികമായ ബുദ്ധിമുട്ട് പെരിഫറൽ ലിമോഫോസൈറ്റ് എണ്ണം വർദ്ധിപ്പിക്കുന്നതിന് തെളിയിക്കപ്പെട്ടിട്ടുണ്ട്. ഇത് തുടർന്നുള്ള ശാരീരിക പ്രവർത്തനകാലം അവസാനിച്ചതിനു ശേഷം ആദ്യഘട്ടത്തിൽ താഴെയായിത്തീരുന്നു. ഫലമായുണ്ടാകുന്ന ലിംഫോസിറ്റി കുറയ്ക്കൽ, പരമാവധി ദൈർഘ്യം 19,60,61-3 [24] ആയതിനാൽ, നൂറ് സെക്സുകളിലുടനീളം Th19,58,60 സെല്ലുകളിൽ കൂടുതൽ പ്രാധാന്യം കാണപ്പെട്ടു [1-2]. IX-61, IL-63, IL-1 തുടങ്ങിയ ആന്റി-ഇൻഫർമമിക് സൈറ്റോകിനുകൾ Th2, IFN-γ, IL-2, ഒരു XXXX- ഉം XXX- സെല്ലുകളുടെ അസുഖവും എം എസ് പാടോഗേസിസിൽ [4] പ്രസക്തമായതിനാൽ, പ്രത്യേക താത്പര്യമുള്ള, വിരുദ്ധമായ, തകരാറുമൂലമുള്ള, തകരാറിലായ, തകരാറിലായ, സൈക്ക്കോണിക് ചുഴലിക്കാറ്റ് [5] എന്നതിന് ഒരു Th10- മധ്യസ്ഥൻ അനുകൂലഘടകമായി പ്രവർത്തിക്കുന്നു.

IFN-β അല്ലെങ്കിൽ glatiramer അസറ്റേറ്റ് പോലുള്ള സ്ഥിതീകരിച്ച രോഗപ്രതിരോധ മരുന്നുകൾ രോഗപ്രതിരോധ സംവിധാനത്തിൽ സമാനമായ പ്രഭാവം ഉണ്ടാക്കുന്നതിനാൽ, മരുന്നും ചികിത്സയും ശാരീരിക പ്രവർത്തനവും രോഗപ്രതിരോധ സംവിധാനത്തെ പരിഷ്കരിക്കുന്നതുമായി പരസ്പരം ബന്ധപ്പെട്ടിരിക്കാം. റെഗുലേറ്റിലെ ചെറിയ വ്യായാമ ഫലങ്ങളിൽ, റെഗുലർ ആന്റ് റെഗുലേറ്റീവ് ട്രെയിനിങ് ഇടവേളകളിൽ വാദിക്കുന്നു.

സൈക്കോകൈൻ ഉൽപാദനത്തിന്റെയും പ്രതികരണങ്ങളുടെയും വ്യായാമം കുറവാണ് വ്യക്തവും പലപ്പോഴും വിരുദ്ധവുമാണ്. ഇത് പഠനത്തിലെ വിവിധ ജനവിഭാഗങ്ങൾ, വ്യത്യസ്ത പരിശീലന പ്രോട്ടോക്കോളുകൾ, കൂടാതെ / അല്ലെങ്കിൽ വ്യത്യസ്ത വായനാരീതി പാരാമീറ്ററുകൾ തുടങ്ങിയവ വിശദീകരിക്കാൻ കഴിയും. ഉദാഹരണത്തിന്, Heesen et al. പരിശീലനം ലഭിച്ച അസുഖങ്ങളുള്ള MS രോഗികളിൽ [IXN], IFN-γ, TNF-α, IL-44,60,62,64 എന്നിവയും ഇതേ വൈറസ് രോഗം സാന്ദ്രീകരിച്ചു. IL-10, IL-62, സി-റിയാക്റ്റീവ് പ്രോട്ടീൻ (സി.ആർ.പി), ഐഎഫ്എൻ-γ ​​എന്നിവയുടെ എട്ടാം ആഴ്ചയിൽ MS രോഗികളിൽ കുറഞ്ഞുവരുന്ന TNF-α എന്ന പ്രവണത കുറയ്ക്കുകയും ചെയ്തു. IL-4 [10] ന്റെ സ്രവങ്ങളെ ഇളക്കിവിടാൻ തക്ക സങ്കോചനങ്ങൾ ഉണ്ടാകുന്നു. അതുപോലെ തന്നെ, MS രോഗികൾക്ക് [6] രോഗപ്രതിരോധ കുത്തിവയ്പ്പ് IL-44,65 ന് വ്യായാമത്തിന്റെ ഫലമായി പ്രസിദ്ധീകരിക്കുന്നതിന് വിരുദ്ധമായ വിവരങ്ങൾ പ്രസിദ്ധീകരിക്കപ്പെട്ടിട്ടുണ്ട്.

MS ന്റെ ന്യൂറോഡെഗേനേറ്റീവ് ഘടകം, ശാരീരിക പ്രവർത്തനത്തിന്റെ പ്രഭാവം, പ്രത്യേകിച്ചും നാഡി വളർച്ചാ ഘടകങ്ങളുടെ വ്യായാമം പ്രത്യേക പ്രാധാന്യം ഉള്ളതുകൊണ്ടാണ്. ഇൻസ്ട്രുൻ പോലുള്ള വളർച്ചാ ഘടകം 66 (IGF-1), രക്തക്കുഴലിലുള്ള എൻഡോഹീലിയൽ വളർച്ചാ ഘടകം (VEGF), [1], മസ്തിഷ്കത്തിൽനിന്ന് ഉത്പാദിപ്പിക്കുന്ന ന്യൂറോട്രോപിക് ഘടകം (BDNF) [67] ], ഇവയെല്ലാം സെൽ പ്രോപ്ലിഫറേഷൻ, സിനാപ്റ്റിക് പ്ലാസ്റ്റിറ്റ്, ന്യൂറോപ്രവരണം, കൂടാതെ ഫിസിയോളജിക്കൽ ആൻഡ് ന്യൂറീനിഫ്ളാമറേറ്ററി അവസ്ഥകളിൽ ന്യൂറോജനിസത്തിനും [69-70] പിന്തുണ നൽകുന്നു. മനുഷ്യരിലും വ്യായാമം ന്യൂറോയ്റ്റീവ് പ്രോട്ടീനുകളുടെ [67,71] ദ്രുതഗതിയിൽ മാറ്റം വരുത്തുമെന്ന് തോന്നുന്നു. ആരോഗ്യമുള്ളവരെ പങ്കെടുപ്പിച്ച് എം.എ. രോഗികളിൽ എംഎംഎൻഎക്സ് മിനിറ്റിലെ മിതമായ എർഗമെറ്ററി അടിസ്ഥാനത്തിലുള്ള വ്യായാമത്തിൽ ബി.ഡി.എൻ.എഫ്, നർവ് വളർച്ചാ ഘടകം (എൻ ജിഎഫ്) [74] എന്നിവയുടെ സാന്നിധ്യം വർധിച്ചു. വർദ്ധിച്ചുവരുന്ന ഹിപ്പോകാപ്പൽ ബി.ഡി.എൻ.എഫ് അളവ് മിതമായ വ്യായാമത്തിൽ അളന്നു [14,67]. ഹിപ്പോകാമ്പസ് പ്രധാനമായും പഠനവും മെമ്മറി ടാസ്മെന്റുകളും മാനസികാവസ്ഥയുടെ മോഡുലേഷനും ഉൾപ്പെടുന്നതിനാൽ, ഈ കണ്ടെത്തലുകൾ എംഎസ് രോഗികൾക്ക് [30] ബാധിക്കുന്ന വൈകല്യവും വൈകല്യവും കുറയ്ക്കാനും വ്യായാമത്തെ ആശ്രയിച്ചേക്കാം. IGF-59,75 ന്റെ വർദ്ധിച്ചുവരുന്ന സ്രവണം വ്യായാമത്തിനു ശേഷം ആരോഗ്യമുള്ള ആളുകളിൽ ഇതുവരെ പ്രകടമായിട്ടുണ്ട്. [67-67] വളർച്ചയുടെ പ്രധാന ഘടകം പോലെ IGF-1, സെൽ സേവിംഗ്സ്, ബ്രെയിൻ വളർച്ച, സിഎൻഎസ് മൈലിൻഷണം എന്നിവയെ പിന്തുണയ്ക്കുന്നു. നവജാതശിശുക്കളും സിനാപ്ടിക്, വൈജ്ഞാനിക പ്ലാസിറ്റിക്കും [76] ഐ.ജി.എഫ് -എൻഎക്സ്എക്സിനുണ്ടാകുന്ന പിൽക്കാല ഘട്ടങ്ങൾ. കൂടാതെ, ആൻറിഓക്സിഡന്റ് എൻസൈമുകളുടെ പ്രവർത്തനത്തെ വ്യായാമം വർദ്ധിപ്പിച്ചു. ഇത് ന്യൂറോ പ്രോர்கോഷനിൽ വ്യായാമത്തിന്റെ പങ്ക് [78].

MS രോഗികളിൽ വ്യായാമം: മോോർഫോളജി ആൻഡ് ഇമേജിംഗ് കണ്ടെത്തൽ ഇഫക്ടുകൾ

മോട്ടോർ പരിപാടികളുടെ ആവർത്തന സജീവമാക്കൽ കോർട്ടിക്കൽ എൻഗ്രാം ശക്തിപ്പെടുത്തുകയും മെച്ചപ്പെട്ട മോട്ടോർ യൂണിറ്റ് ആക്ടിവേഷൻ, ഫയറിംഗ് നിരക്കുകൾ സമന്വയിപ്പിക്കൽ തുടങ്ങിയ ന്യൂറോപ്ലാസ്റ്റിക്ക്, അഡാപ്റ്റീവ് പ്രക്രിയകൾ കാരണമാക്കുകയും ചെയ്യുന്നു. സാരാംശം നിലകൊള്ളുന്ന കാലഘട്ടങ്ങൾ വിപരീത ഫലങ്ങളുമായി ബന്ധപ്പെട്ടിരിക്കുന്നു [35,49,79].

മസ്തിഷ്ക്ക ഘടനാപരമായ പരികൽപനകളിൽ ശാരീരിക പ്രവർത്തനങ്ങളുടെ ഫലമായിട്ടുള്ള വിവരങ്ങൾ വിരളമാണെങ്കിലും, ഫിസിയോ തെറാപ്പി, സ്ഥിര ഫിറ്റ്നസ് പരിശീലനം എന്നിവ മസ്തിഷ്ക ടിഷ്യുവിന്റെ ഘടനാപരമായ മാന്ദ്യത്തെ പ്രതികൂലമായി ബാധിക്കുന്നു. MS [80] പുനർനിർമ്മിക്കുന്നതിന്റെ ആദ്യഘട്ടങ്ങളിൽ ചാരനിറത്തിലും വെളുത്ത ദ്രവ്യത്തിന്റെയും അരക്ഷിതാവസ്ഥ സംഭവിക്കുന്നു. എയ്റോബിക് ഫിറ്റ്നസിന്റെ ഉയർന്ന തലത്തിലുള്ള രോഗികൾ താരതമ്യേന വലിയ പ്രദേശം ഗ്രേ പദാർത്ഥത്തിൽ വലതുവശത്തെ പോസ്റ്റ് ഗൈറസ്, മിഡ്ലൈൻ കോർട്ടിക്കൽ ഘടനകൾ, മുൻധാരണയായ സിങ്കുലി ഗൈറസ്, അനായാസ രോഗികളെ അപേക്ഷിച്ച് കൃത്യമായ സോമാറ്റോസെൻസി കോർട്ടക്സ് . കൂടുതൽ ഉയർന്ന ഫിറ്റ്നസ് നിലകൾ കോർടിക്കൽ മേഖലകളിൽ കൂടുതൽ റിക്രൂട്ട് ചെയ്യുന്നതുമായി ബന്ധപ്പെട്ടിരിക്കുന്നു, എന്നാൽ കുറഞ്ഞ ഫിറ്റ്നസ് നില കൂടുതൽ മെച്ചപ്പെട്ട മുൻഭാഗങ്ങളിലുള്ള cortulated കോർട്ടക്സ് പ്രവർത്തനം [81] എന്നതുമായി ബന്ധപ്പെട്ടിരിക്കുന്നു. വൈകല്യങ്ങളുള്ള വൈദഗ്ധ്യമുള്ള (EDSS 24-0) രോഗത്തിൻറെ ദൈർഘ്യം (6-XNUM വർഷം) 1 വനിത എം എസ് രോഗികളുടെ ഒരു ചെറിയ സാമ്പിൾ അടിസ്ഥാനമാക്കിയാണ് ഈ വിവരങ്ങൾ ശ്രദ്ധിക്കേണ്ടത്.

എം.എസ്. രോഗികൾക്ക് കൂടുതൽ തലച്ചോറ് പ്രദേശങ്ങൾ ഉണ്ടെന്ന് തെളിയിക്കപ്പെട്ടിട്ടുണ്ട്, പലപ്പോഴും ഇരുമുന്നണികൾക്കും, ആരോഗ്യകരമായ നിയന്ത്രങ്ങളുമായി താരതമ്യപ്പെടുത്തുമ്പോൾ മോട്ടോർ, ബോധന രഹിതങ്ങൾ നടത്തുമ്പോൾ സജീവമാക്കുകയും, ഒരുപക്ഷേ ന്യൂറോപ്ലാസ്റ്റിറ്റി എന്ന എക്സ്പ്രഷൻ എന്ന നിലയിൽ [82-92]. Ipsilateral സജീവമാക്കൽ ബിരുദം രോഗം കോശവും തീവ്രതയുമായി [85] ബന്ധിപ്പിക്കുന്നതായി കാണുന്നു, കോർട്ടിക്കൽ അഡാപ്റ്റീവ് റീർഗനൈസേഷൻ പ്രക്രിയകൾ [85,88,93] പ്രതിഫലിപ്പിക്കുന്നു. ഉദാഹരണമായി, പ്രാഥമിക പുരോഗമന രോഗ പ്രമേയവുമായുള്ള MS രോഗികളിൽ, കോർട്ടിക്കൽ സജീവമാക്കൽ, "ഇൻമോള്യു", മോട്ടോർ പ്ലാനിംഗിലെ "ക്ലാസിക്" മേഖലകൾ കൂടാതെ, താൽക്കാലിക, പാരീറ്റൽ, ആൻഡ് ഷിപ്പിറ്റൽ ലോബുകളിൽ നിരവധി മൾട്ടിമോഡൽ കോർട്ടിക്കൽ മേഖലകൾ ഉൾപ്പെടുന്നു. നിർവ്വഹണ പ്രദേശങ്ങൾ (സപ്ലിമെന്ററി മോട്ടോർ ഏരിയ, സിങ്കൂൾട്ട് മോട്ടോർ പ്രദേശം ഉൾപ്പെടെ) [82,85,86]. മോർഗൻ et al. ആരോഗ്യമില്ലാത്ത നിയന്ത്രണങ്ങൾക്ക് പകരം ആരോഗ്യകരമായ നിയന്ത്രണങ്ങൾക്ക് വിപരീതമായ ആവർത്തിക്കാനാവാത്ത ചലന ചലനങ്ങളിൽ നിന്ന് വ്യത്യസ്തമായി, എഫ്.എം.ഐ.ആർ.യിലെ ഇൻററാമൽ ഡോർസൽ പ്രിമേറ്റർ കോർട്ടക്സിലെ കൂടുതൽ പ്രാഥമിക സജീവമാക്കൽ ഉളവാക്കാൻ സാധിക്കുന്നില്ല.

MS രോഗികളിൽ കോർപസ് കോല്ലസോം സാധാരണയായി ബാധിക്കുന്നു. സാധാരണ എംആർഐ സീക്വൻസുകൾ കണ്ടെത്തിയ കോൾസോസൽ ലീഷണുകൾ കൂടാതെ, ഡിഫ്രൻഷൻ ടെൻസർ ഇമേജിംഗ് ശ്രേണികൾ അൾട്രാവർഷ്രക്ഷണൽ നാശനഷ്ടം കാണിക്കുന്നു, ഇത് ഒരു ഫ്രാക്ഷണൽ ആസിടോട്രോപ്പി പ്രതിഫലിപ്പിക്കുകയും ശരാശരി ഡിസ്ബുസിവിറ്റി വർദ്ധിപ്പിക്കുകയും ചെയ്യും [79,94-98]. എൺപത് എം എസ് രോഗികളും ആരോഗ്യകരമായ നിയന്ത്രണങ്ങൾ ഉൾക്കൊള്ളുന്ന ഒരു ചെറിയ പഠനത്തിൽ, ഇബ്രാഹിം ഫിസിയോ തെറാപ്പിക്ക് MSM [11] ലെ മസ്തിഷ്ക മൈക്രോഫ്രീക്റ്റിക്കുകളെ സ്വാധീനിക്കാനാകുമെന്ന അഭിപ്രായത്തിൽ, രണ്ടാഴ്ചയോടനുബന്ധിച്ച് ഫിസിയോതെറാപ്പി പ്രോഗ്രാം ആഴ്ചയിൽ എട്ടുമാസത്തിനുള്ളിൽ ഫ്രാക്ഷണൽ അനീസോട്രോപ്പിയിലും അർദ്ധ ഡിസ്പേസിവിറ്റിയിലും കാര്യമായ വർദ്ധനവ് ഉണ്ടായി. ചുരുക്കത്തിൽ, എം എസ് രോഗികളിൽ വ്യായാമഫലങ്ങൾ പ്രതിഫലിപ്പിക്കുന്ന ഇമേജിംഗ് ടെക്നിക്കുകൾ വഴി കണ്ടെത്താവുന്ന സിഎൻഎസിലെ മോർഫോളിക്കൽ മാറ്റങ്ങൾ പ്രതിഫലിക്കുന്നുണ്ടെന്നും ചില വിവരങ്ങൾ സൂചിപ്പിക്കുന്നു. എന്നിരുന്നാലും എം.എസ്. തലത്തിൽ മസ്തിഷ്ക ഘടനയിൽ വ്യായാമം ഒരുതരത്തിൽ തെളിയിക്കാനാവശ്യമായ തെളിവുകൾ ഇതുവരെ ലഭ്യമല്ല.

MS രോഗികളിൽ വ്യക്തിഗത വ്യായാമം: പൊതുവായതും നിർദ്ദിഷ്ടതുമായ ശുപാർശകൾ

ജർമ്മനിയിലെ ഫെഡറൽ ഹെൽത്ത് മോണിറ്ററിംഗ് സിസ്റ്റത്തിന്റെ ആഴ്ചയിൽ മൂന്ന് പ്രാവശ്യം ഒരു പ്രത്യേക ആരോഗ്യ പരിപാടിയിൽ പരിശീലന പരിപാടിയുടെ നടത്തിപ്പിനുള്ള ജർമൻ ഫെഡറൽ ഹെൽത്ത് മോണിറ്ററിംഗ് സിസ്റ്റത്തിന്റെ ജനറൽ ശുപാർശ, ഒരു ഭൗതിക കാഴ്ചപ്പാടാണ്, പകരം ദൈനംദിന ശാരീരിക പ്രവർത്തനങ്ങളുടെ സംയോജനം എന്നതായിരുന്നു. നിത്യേനയുള്ള ദൈനംദിന പ്രവർത്തനങ്ങളില്ലാത്ത എംഎസ് രോഗികളുടെ സാഹചര്യത്തിൽ പതിവ് വ്യായാമം പ്രധാനമാണ്. മസിൽ ശക്തി മെച്ചപ്പെടുത്തുന്നതിന് പുറമെ, വ്യായാമം, മസിൽ ടോൺ, പോസിറ്റീവ് സ്ഥിരത, വൊളറ്റബിളിറ്റി, സഹിഷ്ണുത എന്നിവ മെച്ചപ്പെടുത്താൻ ഉദ്ദേശിക്കുന്നത് അഗസ്റ്റോണിസ്റ്റുകളേയും ശത്രുക്കളെയും ഉൾപ്പെടുത്തണം [1990]. രോഗിയുടെ വ്യക്തിഗത ആവശ്യങ്ങൾക്കും ലക്ഷണങ്ങൾക്കുമായി ഒരു ശാരീരിക പരിശീലന പരിപാടി ചേർക്കേണ്ടതുണ്ട്. രോഗത്തിൻറെ കോഴ്സ്, ഘട്ടം, വൈകല്യത്തിന്റെ അളവ്, പ്രായം, പാരമ്പര്യരോഗങ്ങൾ, തുടർച്ചയായ രോഗങ്ങൾ എന്നിവ പരിഗണിക്കേണ്ട ഘടകങ്ങളാണ്. പ്രാഥമികമായി, അത് രോഗിയെ പൊതിഞ്ഞു നിൽക്കുന്നില്ലെന്ന് ഉറപ്പാക്കേണ്ടതുണ്ട് [15,35-14].

ആരോഗ്യമുള്ള ആളുകളുമായി താരതമ്യം ചെയ്യുമ്പോൾ എം.എസ്. രോഗികൾക്ക് കുറഞ്ഞുവരുന്ന ഒരു എയറോബിക് ശേഷി [14,26,38], കുറയ്ക്കാൻ പേശീബലം, പേശി അലസൽ വികസനം, ക്ഷതമേറ്റെടുപ്പ്, ദുർബലമായ ബാലൻസ് [14,15,36,99-101] എന്നിവയാണ്. ഗൈറ്റ് സ്പീഡ്, ബിൽഡ് പാരാമീറ്ററുകൾ തമ്മിലുള്ള ഒരു ബന്ധം [102] ആയി കണക്കാക്കപ്പെട്ടിരിക്കുന്നു. രണ്ട് "പിരമിഡുകളിൽ" MS Patients ന്റെ MSc ഫിറ്റ്നസ്, ശാരീരിക പ്രവർത്തനം എന്നിവ വിശദീകരിച്ചു: പ്രായപൂർത്തിയായ ചലനം (റോം) പേശീ ഫിറ്റ്നസ് പിരമിഡിന്റെ അടിത്തറയായി മാറുന്നു, കൂടാതെ പതിവായി [കരാറുകളിൽ] കരാറുകളുടെ അപകടസാധ്യത കുറയ്ക്കാം. പിരമിഡിന്റെ അടുത്ത ഘട്ടത്തിൽ ഗുരുത്വാകർഷണത്തെ ചെറുക്കാനോ അല്ലെങ്കിൽ മസ്തിഷ്കം നിലനിർത്താനോ വേണ്ടി സജീവമായ വഴക്കവും പ്രതിരോധശേഷിയും ഉൾക്കൊള്ളുന്നു. ഉദാഹരണത്തിന്, ദിവസവും ആവശ്യമുള്ള പ്രവർത്തനങ്ങൾ ചെയ്യുന്ന രോഗിയെ പ്രാപ്തരാക്കുക. പേശികളെ ശക്തിപ്പെടുത്തുന്ന ഒരു നല്ല വ്യായാമ പരിപാടി പേശി ഫിറ്റ്നസ് പിരമിഡിന്റെ മുകളിൽ [16] കാണപ്പെടുന്നു. ശാരീരിക പ്രവർത്തന പിരമിഡിന്റെ അടിസ്ഥാനം ADL- കൾ, തുടർന്ന് അന്തർലീനമായ കഴിവുകൾ, സജീവ വിനോദങ്ങൾ, ഘടനാപരമായ എയറോബിക് പരിശീലന പരിപാടികൾ എന്നിവയാണ്. പരിശീലന പരിപാടികളുടെ ഡിസൈൻ, ആവൃത്തി, തീവ്രത എന്നിവ വ്യക്തിഗത രോഗികളുമായി കൂട്ടിച്ചേർക്കണം. എർഗമെട്രിയും വാട്ടർ വ്യായാമവും പോലുള്ള ഭാരോദ്വഹനം വ്യായാമങ്ങൾ പ്രത്യേകിച്ച് മോട്ടോർ കമ്മി അല്ലെങ്കിൽ ബാലൻസ് അസ്വസ്ഥതകളുള്ള രോഗികൾക്ക് ശുപാർശ ചെയ്യുന്നു [16].

വ്യായാമചികിത്സയിൽ സാർവലൗകികമായി സാധുതയുള്ള പ്രത്യേക നിർദ്ദേശങ്ങളൊന്നും നിലവിലില്ല. എന്നിരുന്നാലും, പൊതുവായ ചികിത്സാ ശുപാർശകൾ നിർവചിക്കാവുന്നതാണ്. വ്യായാമ പരിപാടികൾ കൂടുതൽ ശാരീരിക വൈകല്യമുള്ള രോഗങ്ങളിൽ സൂക്ഷ്മപരിശോധന നടത്തിയതിനാൽ, ഈ ശുപാർശകൾ പരമാവധി EDSS സ്കോർ 7 [14,15,34,38] വരെയുള്ള MS രോഗികൾക്ക് മാത്രമായി പരിമിതപ്പെടുത്തിയിരിക്കുന്നു. ഏതെങ്കിലും പുതിയ വ്യായാമപരിപാടി ഒരു ഫിസിയോതെറാപ്പിസ്റ്റായോ അല്ലെങ്കിൽ രോഗത്തെ പരിചയപ്പെടുത്തുന്ന ഫിസിയോളജിസ്റ്റുകളോ [14] ഉപയോഗിച്ച് തുടങ്ങുകയോ വേണം. ദൈനംദിന പ്രവർത്തനങ്ങൾക്കുള്ള പ്രത്യേക വൈകല്യങ്ങൾ ഉൾപ്പെടെയുള്ള ഒരു ചുരുങ്ങിയ ചരിത്രം [16]. പരിശീലന പരിപാടി പരിഗണിച്ച്, പരിശീലന പരിപാടികൾ രോഗികൾക്ക് സങ്കീർണ്ണവും മനസ്സിലാക്കാൻ കഴിയാത്തതുമാണ്. ആവശ്യമെങ്കിൽ, പരിശീലന പരിപാടികളെ വിശദീകരിയ്ക്കുകയോ ഒരു രേഖാമൂലമോ രേഖാമൂലമുള്ള ഫോമിൽ [15] വിശദീകരിക്കാവുന്നതാണ്. പ്രോഗ്രാമുകൾക്ക് മതിയായതും സ്വതന്ത്രമായി പ്രവർത്തിക്കാൻ കഴിയുന്നതുവരെ രോഗികൾക്ക് മേൽനോട്ടം വഹിക്കണം. [14-16,26] വ്യായാമപരിപാടികൾ പ്രത്യേകിച്ച് ദുർബലമായ പേശികളെ ടാർജറ്റ് ചെയ്യണം, കൂടാതെ മൾട്ടിസെഗമെന്റൽ സങ്കീർണ്ണമായ ചലനങ്ങളെ തിരഞ്ഞെടുക്കുകയും വേണം [15,35]. തീവ്രത കുറച്ചുമാത്രമേ വർദ്ധിക്കുകയുള്ളൂ, വേദനയുടെ വേഗതയല്ല [15]. പെരിഫറൽ നഴ്സുമാർക്ക് പ്രത്യേക പരിചരണം നൽകണം. പ്രത്യേകിച്ച് മേൽപ്പറഞ്ഞവ ഒഴിവാക്കണം [15]. ലഘുവായ തലങ്ങളിൽ ആരംഭിക്കുന്നതിനുള്ള പരിശീലന സെഷനുകൾ, ലൈറ്റ് സന്നാഹങ്ങൾ, രോഗികളുടെ ക്ലിനിക്കൽ അവസ്ഥ, പ്രത്യേക പ്രശ്നങ്ങൾ എന്നിവയ്ക്ക് അനുസൃതമായി പുരോഗമിക്കുക, ഒടുവിൽ നേരിയ തീവ്രതയിലേക്ക് നേരിയ വെളിച്ചം എത്തിക്കുക [14-16,26]. പേശികളുടെയും തളികളുടേയും [10] വഴക്കവും മെച്ചപ്പെടുത്താനും ദിവസം തോറും എൺപത് മിനിറ്റ് നീളുന്നതും, എൺപത് മുതൽ -10 വരെ പരിശീലന ശേഷിക്കുള്ള റിസ്ക് സമയം ശുപാർശ ചെയ്യുന്നത് [15]. ബോധവൽക്കരിക്കപ്പെട്ട രോഗികളോ അല്ലെങ്കിൽ ഗുരുതര രോഗലക്ഷണങ്ങളുള്ളവരെ വ്യക്തിപരമായി സഹായിക്കണം. ഹൃദയമിടിപ്പ് വ്യായാമ പരീക്ഷയിൽ XSM രോഗികൾക്ക് ഹൃദയമിറപ്പായ ഡയസ്നോനോമിയ എക്സ്പ്രഷൻ [2] ന്റെ ഒരു പ്രകടനമായി കുറച്ചു കഴിഞ്ഞാൽ ചികിത്സ ആരംഭിക്കുന്നതിനു മുമ്പുതന്നെ കാർഡിയോപൾമോണറി ഫംഗ്ഷൻ എന്നും VO15,16X- മാക്സ് എന്നും കരുതുക. ഇത് ഒരുപക്ഷേ, ദിനപ്പത്രം. സഹിഷ്ണുത പരിശീലനത്തിനും അമേരിക്കൻ കോളേജ് ഓഫ് സ്പോർട്ട്സ് മെഡിസിനുമൊപ്പം, വൈറ്റ് ആൻഡ് ക്സൻഡ്രേഫർ പരിശീലനത്തിന് അനുയോജ്യമായ ലക്ഷ്യം കണ്ടെത്തുന്നതിനായി ഗ്രേഡ് വ്യായാമ പരീക്ഷയിൽ ഹാർട്ട് റേറ്റ് പ്രതികരണത്തെ ഉപയോഗപ്പെടുത്താൻ ശുപാർശ ചെയ്യുന്നു [15]. എതെങ്കിലും ലക്ഷണങ്ങൾ പ്രത്യക്ഷപ്പെടാനും "മിതമായ തീവ്രത" യും ചെയ്യണം. ഉദാഹരണമായി, 6 മുതൽ 20 വരെ (6 "എല്ലാ പ്രയത്നവും ഇല്ല", 20 എന്നാണ് "പരമാവധി Exertion") എന്ന പരികല്പനയിലെ Borg സ്കെയിൽ മുഖേന. 11 മുതൽ 14 വരെയുള്ള മിതമായ തീവ്രത ശ്രേണികൾക്കായി [15,103] അനുമാനിക്കുന്നു. ലക്ഷണങ്ങളേയും പരിശീലന പരിപാടികളേയും ആശ്രയിച്ച് പരിശീലന പങ്കാളിയുമായി അല്ലെങ്കിൽ പരിശീലന ഗ്രൂപ്പിനൊപ്പം വീട്ടിൽ പരിശീലനം നടത്തേണ്ടതാണ്. ഇലാസ്റ്റിക് ബാൻഡുകൾ, അധിക തൂക്കമുള്ളതും കഴുത്തറയും പോലുള്ള പരിശീലന ഉപകരണങ്ങൾ ഉൾപ്പെടുത്താം. സാമൂഹിക പിന്തുണ കാരണം ഒരു പരിശീലനഗ്രൂപ്പ് നിബന്ധനകൾക്ക് അനുസൃതമായും പ്രോത്സാഹനത്തിലും അനുകൂലമാണ് [16,28]. വീട്ടിലെ അടിസ്ഥാന പരിശീലന പരിപാടികളിൽ സമാനമായ പ്രത്യാഘാതങ്ങൾ നേടുന്നതിന്, രോഗികൾ കൂടുതൽ സൂപ്പർവൈസ് ചെയ്യണം, ഉദാഹരണമായി സന്ദർശനങ്ങൾ അല്ലെങ്കിൽ ടെലിഫോൺ കോളുകൾ [16,28]. ഏറ്റവും പ്രധാനമായി, പരിശീലന സെഷനുകൾ പതിവായി നടത്തണം [14-16,26].

എംഎസ് രോഗികൾക്ക് പരിശീലന പരിശീലനവുമായി ബന്ധപ്പെട്ട് ചില പ്രത്യേക ശുപാർശകൾ പ്രസിദ്ധീകരിച്ചിട്ടുണ്ട്. എന്നിരുന്നാലും, ഈ ശുപാർശകൾ കൂടുതലും രചയിതാക്കളുടെ വ്യക്തിപരമായ അനുഭവങ്ങളെ പ്രതിനിധാനം ചെയ്യുന്നുവെന്നും ഉയർന്ന നിലവാരമുള്ള ക്ലിനിക്കൽ ട്രയലുകളിൽ എല്ലായ്പ്പോഴും പിന്തുണയ്ക്കില്ലെന്നും ഇത് ഊന്നിപ്പറയേണ്ടതാണ്. ഉദാഹരണത്തിന്, ഡാർഗാസും, ഏകദേശം എൺപത്-നം മിനിറ്റ് ദൈർഘ്യമുള്ള സഹിഷ്ണുത പരിശീലനം ശുപാർശ ചെയ്യുന്നു. പരമാവധി ഹൃദയമിടിപ്പ്നിരക്കിന്റെ 10- ൽ% വരെ VXXXX- ൽ പരമാവധി 40-50% വരെ പ്രാഥമിക പരിശീലന തീവ്രത ഉണ്ടാകും [70]. Dalgas et al അനുസരിച്ച്, തുടക്കത്തിൽ 2- 60 പുനരുത്ബിശങ്ങൾ ഉൾക്കൊള്ളിക്കാൻ പ്രതിരോധ പരിശീലനം ശുപാർശ ചെയ്യുന്നത്, അത് പിന്നീട് നിരവധി മാസങ്ങൾക്കകം വർദ്ധിപ്പിക്കാൻ കഴിയും. പരിശീലനം തുടങ്ങണം, 80- 14 സെറ്റുകൾ, പിന്നീട് 8- 15 സെറ്റുകൾ, സെറ്റ്സ് തമ്മിലുള്ള ഒരു 2-30 മിനുട്ട് ഇടവേളയിൽ, ആഴ്ചയിൽ രണ്ടോ മൂന്നോ തവണ നടത്തണം. ഉഷ്ണം-സെൻസിറ്റീവ് രോഗികൾക്കും, പതിവായി ഉദ്ധതതീരത്തിലെ വ്യായാമം വ്യായാമം പരിശീലിക്കുന്നവർക്ക് രാവിലെ 5-30 ഡിഗ്രി സെൽഷ്യസിലും, ഊഷ്മാവിലും ശരീരത്തിലും ചൂടായതുകൊണ്ട് ശരീരത്തിന് ഊർജ്ജം കുറയുന്നു. വെള്ളത്തിൽ [1]. മറ്റൊരു വിധത്തിൽ, വ്യായാമം ആരംഭിക്കുന്നതിനും / അല്ലെങ്കിൽ തണുത്ത പായ്ക്കുകൾ കൊണ്ട് ശാരീരിക പ്രവർത്തനങ്ങൾ ചെയ്യുന്നതിനും Uhthoff ന്റെ പ്രതിഭാസം തടയാൻ സഹായിക്കും. കൂടാതെ, എൻഡുറൻസ് ട്രെയിനിംഗിന് പകരം പ്രതിരോധം ചൂട് സെൻസിറ്റീവ് രോഗികൾക്ക് [3] നല്ലതാണ്.

ഡോ ജിമനെസ് വൈറ്റ് കോട്ട്
മൾട്ടിപ്പിൾ സ്ക്ലിറോസിസ്, അല്ലെങ്കിൽ എം.എസ്., ദീർഘകാല, പുരോഗമനപരമായ രോഗമാണ്, കാരണം പ്രതിരോധസംവിധാനത്തെ തലച്ചോറിലും സുഷുമ്നാ നാഡിലുമുള്ള നാഡീകോശങ്ങൾ നശിപ്പിക്കുന്നു. ഏതെങ്കിലും തരത്തിലുള്ള ശാരീരിക പ്രവർത്തനങ്ങളിലോ വ്യായാമങ്ങളിലോ ഏർപ്പെടാതിരിക്കുവാൻ ഡോക്ടർമാർക്ക് MS- ൽ രോഗികളെ ശുപാർശ ചെയ്യുന്നുണ്ട്, എന്നാൽ അടുത്തിടെയുള്ള ഗവേഷണ പഠനങ്ങൾ കണ്ടെത്തിയത് എംഎസ് രോഗലക്ഷണങ്ങളോട് സക്രിയമായിരിക്കുമെന്നാണ്. മൾട്ടിപ്പിൾ സ്ക്ളീറോസിസവുമായി ബന്ധപ്പെട്ട സാധാരണ ലക്ഷണങ്ങൾ: വിരസത, പാവം, പേശീ കോഡിനേഷൻ, മങ്ങൽ ദർശനം, കടുത്ത ക്ഷീണം എന്നിവയാണ്. ഡോ. അലക്സ് ജിമനേസ് DC, CCST ഇൻസൈറ്റ്

MS ലെ വ്യക്തിഗത ലക്ഷണ ലക്ഷണങ്ങളും സൂചനകളും തടയുകയോ അല്ലെങ്കിൽ പൂർണ്ണമായി തടയാൻ ഫിസിക്കൽ തെറാപ്പി സമീപനങ്ങൾ

ക്ഷീണം

മുൻഗാമികളായ ഡിമാൻഡിൽ ശാരീരികവും മാനസികവുമായ ക്ഷീണം മൂലം നിർവികഞ്ഞ ക്ഷീണം, MS- ൽ പതിവായി, പലപ്പോഴും ദുർബലപ്പെടുത്തുന്ന ലക്ഷണമാണ്. [8-10,15,35,104-106] ചികിത്സിക്കാൻ പ്രയാസമാണ് ഇത്. MS-X രോഗികളിൽ ഏതാണ്ട് എൺപത് -30% വരെ രോഗം വ്യാപകമാവുന്നതിൽ ക്ഷീണം അനുഭവപ്പെടുന്നു [15] കൂടാതെ ചില എം.എസ്. രോഗികൾ വൃത്തിഹീനമായ സർക്കിളുകളിൽ അവസാനിക്കുന്നു: ശാരീരിക പ്രവർത്തനങ്ങൾ കുറയ്ക്കാൻ ശാരീരിക പ്രവർത്തനം കുറയ്ക്കാൻ ആഗ്രഹിക്കുന്ന സമയങ്ങളിൽ, സഹിഷ്ണുത, പേശിശക്തി, ഗുണമേന്മ ജീവിതശൈലിയും ക്ഷീണവും വർദ്ധിപ്പിക്കും, അതുവഴി കൂടുതൽ ശാരീരിക പ്രവർത്തനവും സാമൂഹിക ജീവിതവും പരിമിതപ്പെടുത്തുന്നു. [75] തണുപ്പിക്കൽ, മിതമായ വ്യായാമം, പ്രത്യേകിച്ച് എയ്റോബിക് പരിശീലനത്തിനു പുറമേ, ക്ഷീണം [90] കുറച്ചുകൂടി ഫലപ്രദമാണ്. ക്ഷീണം പലപ്പോഴും പകൽ കൂടുതലായി വർദ്ധിക്കുന്നതിനാൽ, പരിശീലന സെഷനുകൾ രാവിലെ നടത്തണം, രോഗിയെ [8,10,16] അമിതഭ്രംശം പാടില്ല. ഒരു പരിശീലനഗ്രൂപ്പിൽ പങ്കാളിത്തം അല്ലെങ്കിൽ മാനസിക പിന്തുണയ്ക്കായി പ്രത്യേക പരിശീലനം, കാലാകാലങ്ങളിൽ പരിശീലനം തുടരാനുള്ള പ്രചോദനം, ക്ഷീണം [9,42,49] കൊണ്ട് ബുദ്ധിമുട്ടുന്ന രോഗികൾക്ക് പ്രയോജനകരമാകാം. ഊർജ്ജ സംരക്ഷണ തന്ത്രങ്ങൾ പ്രയോഗിക്കുകയും ചെയ്യുന്നു, അതിൽ രോഗി പ്രാതിനിധ്യം മനസിലാക്കുകയും ദൈനംദിന കടമകൾ നിർവഹിക്കുന്നതിനായി ചുരുങ്ങിയത് പരിശ്രമിക്കുകയും ചെയ്യുന്നു [30,35,45]. ക്ഷീണത്തെക്കുറിച്ചുള്ള മിതമായ വ്യായാമത്തിന്റെ ഫലപ്രദമായ പ്രയോജനം ചില എഴുത്തുകാരെ [104] വിവരിക്കുന്നുണ്ടെങ്കിലും, നിലവിലുള്ള ക്ഷീണം സ്കെയിലുകളിൽ കാര്യമായ പുരോഗതി കൈവരിക്കാനുള്ള ഫലങ്ങൾ സാധാരണയായി അപര്യാപ്തമാണ്. മറ്റ് പഠനങ്ങൾ ഏതെങ്കിലും പുരോഗതി കണ്ടെത്തുന്നതിൽ പരാജയപ്പെട്ടു [16]. ശാരീരിക ലക്ഷണങ്ങളിൽ ശ്രദ്ധ കേന്ദ്രീകരിക്കുന്നതോ അല്ലെങ്കിൽ ഉറക്കക്കുറവ്, ഉറക്കവുമായി ബന്ധപ്പെട്ട ശ്വസന വൈകല്യങ്ങൾ, വിശ്രമമില്ലാത്ത കാലിൻ സിൻഡ്രോം, ആനുകാലിക അവയവഛിദ്ര മനഃക്ലേശം [4,16,27-14,28,35,41] തുടങ്ങിയ വിവിധ തരത്തിലുള്ള ക്ഷീണ ശകലങ്ങൾ, . ഒടുവിൽ, ക്ഷീണം സംബന്ധിച്ച് മിതമായ വ്യായാമത്തിന്റെ ഫലപ്രദമായ ഫലങ്ങൾ മിതമായ ചിലതിന് വ്യക്തമായ ചില തെളിവുകൾ ഇല്ല.

സാത്വികത്വം

ഏതാണ്ട് എൺപതു% വാർധക്യകാല സംസ്ക്കരണശേഷിയുള്ള ജീവിതശൈലീരോഗങ്ങൾക്ക് MS- ൽ ഇടയ്ക്കിടെയുണ്ട്. ജീവിതത്തിലെ ഗണ്യമായ കുറവ് ഗുണനിലവാരം നിലനിർത്താനുള്ള ശേഷിയുണ്ട് [90]. ഇത് ചലനങ്ങളുടെ പരിധിയിലും സാധാരണ അനുപാതത്തിലും ഉണ്ടാകുന്ന പരിമിതികൾക്കും, സന്ധികൾ അപകീർത്തിപ്പെടുത്തുന്നതിനും, പലപ്പോഴും വേദനയോടും [104] കൂടെ നടക്കുന്നു. വ്യായാമവും ഫിസിയോതെറാപ്പിയിലും എം.എസ്.ഡബ്ല്യു. എന്നിരുന്നാലും മെച്ചപ്പെടുത്തലുകളുടെ ചില തെളിവുകൾ റിപ്പോർട്ട് ചെയ്തിട്ടുണ്ട് [24].

പരിശീലന പങ്കാളിയോ പരിശീലന ഉപകരണങ്ങളോ ഇലാസ്റ്റിക് ബാൻഡുകളോ സഹായിക്കാനും സാധിക്കും. ഫിസിക്കൽ തെറാപ്പി നടപടികൾ സജീവവും നിഷ്ക്രിയവുമായ വ്യായാമങ്ങൾ (ഉദാ: രോഗിയുടെ ലക്ഷ്യം വയ്ക്കൽ, മോട്ടോർസൈക്കിൾ ചക്രം ഉപയോഗിച്ചുള്ള നിഷ്ക്രിയ വ്യായാമങ്ങൾ, സജീവ ട്രെഡ്മിൽ വ്യായാമം) എന്നിവ ഉൾപ്പെടുന്നു. ബോബത്ത് അഥവാ വൊജാടി, ഫിപ്രെറോപോസിറ്റീവ് ന്യൂറോമസ്കൂലർ ഫെസിലിറ്റേഷൻ (പിഎൻഎഫ്) എന്നിവ പ്രകാരം ഫിസിയോ തെറാപ്പിക് ടെക്നിക്കുകൾ ഉപയോഗിക്കുന്നു. ഈ നടപടികളിൽ ഒന്നുംതന്നെ ഉയർന്നതായിട്ടില്ല [104,107]. അവയെ പതിവായി കൊണ്ടുപോകുന്നതും ഒരു മതിയായ തീവ്രത [4,104] കൊണ്ടുപോകുന്നതും പ്രധാനമാണ്. വ്യായാമം ചെയ്ത ശേഷമുള്ള മസിലുകളുടെ ലൈറ്റ് വ്യാപ്തം ഏതാണ്ട്, 20- 60- കൾ വ്യായാമത്തിനു ശേഷവും [15] മുമ്പും നടത്തണം.

പാഴ്സികൾ

നടത്തം പ്രയാസവും പിഴ-മോട്ടോർ പ്രവർത്തനരീതിയും പോലുള്ള ശാരീരിക വൈകല്യങ്ങളിലേക്കു നയിക്കുന്നു. എം.ഇ. രോഗികളിൽ ഗെയ്റ്റ് സ്പീഡ്, പേശി ശക്തി എന്നിവ തമ്മിലുള്ള ബന്ധം കാണിച്ചിരിക്കുന്നു [14]. ബാർലോഫീൻ പോലുള്ള മയക്കുമരുന്ന് ഉപയോഗം കൂടാതെ മയക്കുമരുന്ന് ഉപയോഗിക്കുന്ന മരുന്നുകളും നിലവിലുള്ള പെയേഴ്സ് വഷളാകാൻ ഇടയാക്കും, ശാരീരികവും ജോലിസംബന്ധമായ ചികിത്സാരീതികളും ഏക ചികിത്സാ രീതിയാണ്. ഗുരുത്വാകർഷണ ജല ജലപരിശീലനത്തിന്റെ കുറവ് കാരണം, താഴത്തെ മൂലകങ്ങളുടെ കടുത്ത പെയറുകളുള്ള രോഗികൾക്ക് വ്യായാമം ചെയ്യുന്നതിനും വ്യായാമങ്ങൾ നീക്കുന്നതിനും [15,16] സഹായിക്കുന്നു. സ്റ്റാൻഡിംഗ് ഫ്രെയിമിൽ ഉറച്ചുനിൽക്കാൻ കഴിയാത്ത രോഗികൾക്ക്, മസ്തിഷ്കത്തിന്, കൈകോട്ട, ശ്വാസോച്ഛ്വാസം പേശികളെ പരിശീലിപ്പിക്കാനും, രക്തചംക്രമണ ഡിസേർഗ്യൂളേഷനെ പ്രതിരോധിക്കാനും കഴിയും. സ്ഥിരതയില്ലാത്ത രോഗികൾക്ക്, തളർച്ച ബാധിച്ച മേഖലയിൽ പ്രോക്സിമാലിനായി നിഷ്ക്രിയ വ്യായാമങ്ങൾ ശുപാർശ ചെയ്യുന്നു [15,16]. വ്യായാമത്തിന്റെ ഫലമായി പല പഠനങ്ങളും മസിലുകളുടെ ശക്തി മെച്ചപ്പെടുത്തുന്നുണ്ട്. കൂടാതെ, ചില എഴുത്തുകാർ വേഗത്തിലൂന്നിയുള്ള വേഗത, സ്റ്റേററിംഗ് എൻഡുറൻസ്, സ്റ്റെയർ ക്ലൈംബിംഗ്, ടൈംഡ് ചെയ്ത് ടെസ്റ്റ് [33,35,40,101] എന്നിവയ്ക്കായി പ്രയോജനപ്പെടുത്തി. ചുരുക്കത്തിൽ, തെളിവുകൾ സൂചിപ്പിക്കുന്നത് MS ബന്ധപ്പെട്ട പെയർ ചികിത്സ ഫലപ്രദമാണ്, വീണ്ടും, കുറച്ച് മാത്രം, ഭാഗികമായി അപര്യാപ്തമായ ഡാറ്റ ലഭ്യമാണ്. വ്യായാമത്തിന്റെ ഫലമായുണ്ടാകുന്ന രോഗങ്ങൾ സൌമ്യമായതോ, മിതമായതോ ആയ എം.എസ്.

ഏകോപനം, ബാലൻസ് ഡിസ്ഫംഗ്ഷൻ

ബാലൻസ് നിയന്ത്രണത്തിലുള്ള അസാധാരണതകൾ എം.എസ്. രോഗികളിലെ പലപ്പോഴും ലക്ഷണങ്ങളാണ്. ഇത് അവരുടെ ദൈനംദിന ജീവിതത്തിലെ രോഗികളെ നിയന്ത്രിക്കുന്നതും അപകടസാധ്യത വർദ്ധിക്കുന്നതും [5]. [5] മാനദണ്ഡങ്ങൾ പാലിക്കുന്നതും നിലനിറുത്തുന്നതും, സ്വന്തം ബാലൻസിൻറെ രോഗികളുടെ കാഴ്ചപ്പാടുകളും വളരെ പ്രധാനമാണ്. സൈക്കിൾ പരിശീലനത്തിൻറെ സിറ്റിംഗ് സ്ഥാനം അസ്ഥിര രോഗികൾക്ക് പ്രയോജനകരമാണ് [15,16]. MS ലെ ബാലൻസ്, കോ-ഓർഡിനേഷൻ എന്നിവയിൽ വ്യായാമ പരിപാടികളുടെ സ്വാധീനം ഏതാനും ചില പഠനങ്ങൾ മാത്രമാണ് നടത്തിയത്. വളരെ കുറച്ച് മാത്രമേ പ്രാഥമിക ഫലങ്ങളുടെ പരാമീറ്ററായി ഈ വേരിയബിളുകൾ തിരഞ്ഞെടുത്തിട്ടുള്ളൂ. ഉദാഹരണത്തിന്, കാറ്റനേയോ, അൽ-ക്രോമസോണയും, എക്സ്.എം.എൽ. എം. എസ്. രണ്ടു ചികിത്സാ ഗ്രൂപ്പുകളും മൂന്ന് ആഴ്ചകൾക്കായി പ്രത്യേക ബാക്കി പുനരധിവാസത്തിന് ലഭിച്ചു. മൂന്നാമത് (കൺട്രോൾ) ഗ്രൂപ്പ് ഒരു എടുത്തുപറയേണ്ട പരിശീലന പരിപാടിയിൽ പങ്കു വഹിച്ചു. രണ്ട് ചികിത്സാരീതികളിലും, സ്ഥിരമായ ബാലൻസ് (ബെർക് ബാലൻസ് സ്കെയ്ൽ), ഡൈനാമിക് ബാലൻസ് (ഡൈനാമിക് ഗൈറ്റ് ഇൻഡെക്സ്) എന്നിവയുടെ ക്ലിനിക്കൽ ടെസ്റ്റുകളിലെ വീഴ്ചകളുടെ എണ്ണം കുറയ്ക്കുന്നതിനും മെച്ചപ്പെടുത്തുന്നതിനും കഴിയും. എന്നിരുന്നാലും, സ്വയം വിലയിരുത്തൽ സ്കെയിലുകളിൽ രോഗികൾ കാര്യമായ പുരോഗതി റിപ്പോർട്ട് ചെയ്തിട്ടില്ല [44]. മറ്റൊരു നിയന്ത്രിത പഠനത്തിന്, കൃത്യമായ ബാലൻസ് [5] ന് വ്യായാമ പരിശീലനത്തിന്റെ ഫലപ്രദമായ പ്രഭാവം പിന്തുണച്ചിരുന്നില്ല.

ബുദ്ധി, മൂഡ് വൈകല്യങ്ങൾ

ക്ഷയരോഗ വിദഗ്ദ്ധരുടെയും എലിസബിൽ മെമ്മറി കമ്മി കുറയ്ക്കുന്നതിനും ഇൻഫൊമൈഡി മെമ്മറി കമ്മിയുണ്ടാകൽ, എക്സ്.എൻ.സോഡിക് മെമ്മറി കമ്മിയുണ്ടാകൽ, [45] 70% പരിചയം മാനസിക അസ്വാസ്ഥ്യങ്ങൾ [12,13,24,104,108] തുടങ്ങിയ മാനസിക വൈകല്യങ്ങളാൽ MSM രോഗികളിൽ 60- ആരോഗ്യമുള്ള ആളുകളിൽ എയ്റോബിക് വ്യായാമവും തലവേദനയും തലച്ചോറിന്റെ പ്രവർത്തനവും തമ്മിലുള്ള നല്ല ബന്ധത്തിന് ചില തെളിവുകൾ വിവരിക്കുന്നു [70]. എം.എസ്. രോഗികളിൽ, സാധാരണ ശാരീരിക പ്രവർത്തനങ്ങളുടെ ഫലപ്രദമായ പ്രയോജനങ്ങൾ, മാനസികനിലയിലും വ്യായാമത്തിലും [18] തുടർച്ചയായി റിപ്പോർട്ട് ചെയ്യപ്പെട്ടിട്ടുണ്ട്. കോഗ്നിറ്റീവ് ഫംഗ്ഷനിൽ പ്രാബല്യത്തിലുള്ള സാധുവായ വിവരങ്ങൾ ലഭ്യമല്ല.

ഉപസംഹാരവും വീക്ഷണവും

എം.എസ്. രോഗികൾക്ക് സാധാരണ ശാരീരിക പ്രവർത്തനങ്ങളിൽ നിന്നും പ്രയോജനം ലഭിക്കുന്നുവെന്നും ഉയർന്ന നിലവാരമുള്ള ക്ലിനിക്കൽ, ഇമേജിംഗ്, ഫിസിയോളജിക്കൽ പാരാമീറ്ററുകൾ തുടങ്ങിയവ ഉറപ്പുവരുത്തുന്നുവെന്നും പല തെളിവുകളും സൂചിപ്പിക്കുന്നു. എന്നിരുന്നാലും, MS ലെ വ്യായാമ പരിശീലനത്തെക്കുറിച്ച് ഇതുവരെ ബോധവാന്മായായ ക്ലിനിക്കൽ പരീക്ഷകളുടെ ഗുണമേന്മ എല്ലായ്പ്പോഴും ഉയർന്ന നിലവാരമുള്ള പഠനത്തിന്റെ ആവശ്യകതകൾ നിറവേറ്റുന്നില്ല. മാത്രമല്ല, വിവിധ ചികിത്സാരീതികളും അനായാസവും കാരണം, ഡാറ്റ പലപ്പോഴും താരതമ്യേന കുറവാണ്. അങ്ങനെ പല ചോദ്യങ്ങൾക്കും ഉത്തരം കിട്ടാതെ നിലകൊള്ളുന്നു. അനേകം രോഗബാധകളും വിവിധ തരത്തിലുള്ള വൈകല്യങ്ങളുള്ള എംഎസ് രോഗികളിലെ ക്ലിനിക്കൽ, പാരാക്ലിലിനിക്കൽ പാരാമീറ്ററുകളിലെയും വ്യായാമത്തിന്റെ ഹ്രസ്വവും ദീർഘകാലവുമായ രണ്ട് പ്രമേയങ്ങളും അഭിമുഖീകരിക്കുന്ന, നിലവാരമുള്ള ഉന്നത നിലവാരവും നന്നായി വിശദീകരിക്കപ്പെട്ട പഠനവും ഒരു വലിയ ആവശ്യം വരുന്നു.

താൽപ്പര്യങ്ങളുടെ വൈരുദ്ധ്യങ്ങൾ

അവർക്ക് എതിരാളികളുടെ താൽപര്യമില്ലെന്ന് എഴുത്തുകാർ പ്രഖ്യാപിക്കുന്നു.

കടപ്പാടുകൾ

ഈ സൃഷ്ടിക്ക് DFG (എക്- XXX) പിന്തുണയ്ക്കുന്നു.

മൾട്ടിപ്പിൾ സ്ക്ലിറോസിസ്, ശാരീരിക പ്രവർത്തനങ്ങൾ, വ്യായാമങ്ങൾ എന്നിവയിൽ പങ്കെടുക്കുന്ന യു.എസ്. MS ൽ രോഗികൾക്ക് വ്യായാമത്തിന്റെ പരിധി നിശ്ചയിച്ചിട്ടുണ്ടെങ്കിലും ആരോഗ്യപരിപാലന മേഖലയിലെ വിദഗ്ധരുടെ അഭിപ്രായത്തിൽ, മൾട്ടിപ്പിൾ സ്ക്ലിറോസിസ് ലക്ഷണങ്ങൾ മെച്ചപ്പെടുത്താനും വ്യായാമത്തിൻറെ ഗുണനിലവാരം വർദ്ധിപ്പിക്കാനും വ്യായാമം സഹായിക്കുമെന്ന് മുകളിൽ പറഞ്ഞ പഠനങ്ങൾ വ്യക്തമാക്കുന്നു. എം എസ്സിലെ ആളുകൾക്ക് അവരുടെ ജീവിതം നിരാശപ്പെടേണ്ടിവരില്ല. ഞങ്ങളുടെ വിവരങ്ങളുടെ പരിധി ചിതറായും അസാധാരണമായ ആരോഗ്യ പ്രശ്നങ്ങളിലേക്കും പരിമിതപ്പെടുത്തിയിരിക്കുന്നു. വിഷയം ചർച്ച ചെയ്യാൻ, ഡോക്ടർ ജിമെനെസ് ചോദിക്കാൻ മടിക്കരുത് അല്ലെങ്കിൽ ഞങ്ങളെ ബന്ധപ്പെടുക 915-850-0900 .

ഡോ. അലക്സ് ജിമെനെസ് ക്യൂറാണ്

ഇതിൽ നിന്നും റെഫറൻസ്: Ncbi.nlm.nih.gov/pmc/articles/PMC3375103

പച്ച കോൾ ഇപ്പോൾ ബട്ടൺ എച്ച് .png

കൂടുതൽ വിഷയം ചർച്ച: അക്യുട്ട് ബാക്ക് വേദന

പുറം വേദന ലോകവ്യാപകമായി തൊഴിലാളിയുടെ വൈകല്യവും നഷ്ടപ്പെടാത്ത ദിവസങ്ങളും ഏറ്റവും കൂടുതലായ കാരണങ്ങൾ. ഡോക്ടർ ഓഫീസ് സന്ദർശനങ്ങൾക്കുള്ള രണ്ടാമത്തെ ഏറ്റവും സാധാരണ കാരണം ചൂണ്ടിക്കാട്ടുന്നു, ഉയർന്ന ശ്വാസകോശബാധയുള്ള അണുബാധകൾ മാത്രം. ജനസംഖ്യയിൽ ഏതാണ്ട് എൺപതു ശതമാനം പേർക്ക് അവരുടെ ജീവിതകാലം മുഴുവൻ ഒരു വേദന ഒരിക്കൽ അനുഭവപ്പെടും. നട്ടെല്ല്, സന്ധികൾ, കട്ടിലുകൾ, പേശികൾ തുടങ്ങി മൃദുവായ ടിഷ്യൂകൾ കൊണ്ട് നിർമ്മിച്ച സങ്കീർണമായ ഘടനയാണ് നട്ടെല്ല്. പരുക്കുകളും ഒപ്പം / അല്ലെങ്കിൽ അഴുകിയ അവസ്ഥകളും ഹാർനിയേറ്റഡ് ഡിസ്ക്കുകൾ, ഒടുവിൽ മുടി വേദനയുടെ ലക്ഷണങ്ങളായി മാറുന്നു. സ്പോർട്സ് പരിക്കുകൾ അല്ലെങ്കിൽ വാഹനാപകടങ്ങൾ പലപ്പോഴും മുടി വേദനയ്ക്ക് ഇടയാക്കുന്നു, ചിലപ്പോൾ ചലനങ്ങളുടെ ലളിതമായ വേദനയ്ക്ക് വേദനയേറിയ ഫലങ്ങൾ ഉണ്ടാകാം. ഭാഗ്യവശാൽ, ചികിൽസാകൃതിയിലുള്ള സംരക്ഷണം പോലെയുള്ള ബദൽ ചികിൽസാരീതികൾ, നട്ടെല്ലിൽ മാറ്റം വരുത്താനും നട്ടെല്ലിൽ മാറ്റം വരുത്താനും സഹായകരമാകും, ഇത് ആത്യന്തികമായി വേദനയുടെ ആശ്വാസം വർദ്ധിപ്പിക്കും.

കാർട്ടൂൺ പേപ്പർ ബോയുടെ ബ്ലോഗ് ചിത്രം

EXTRA EXTRA | പ്രധാന വിഷയം: ശുപാർശ എൽ പാസോ, TX ച്യൂയിപോർട്ട് സ്ട്രക്ചർ

***

NFF2 ന്റെ ഗുണങ്ങൾ എന്താണ്?

NFF2 ന്റെ ഗുണങ്ങൾ എന്താണ്?

ഓക്സിഡന്റ് സ്ട്രെസ്സ് കാൻസർ, ഹൃദ്രോഗം, പ്രമേഹം, ത്വരിതഗതിയിലുള്ള വാർധക്യം, ന്യൂറോഡെഗേനേഷൻ തുടങ്ങിയ ആരോഗ്യപ്രശ്നങ്ങൾക്ക് സഹായകമാണ്. ഉയർന്ന അളവ് ഓക്സിഡേറ്റീവ് സമ്മർദത്തിൽ നിന്ന് മനുഷ്യ ശരീരം സംരക്ഷിക്കുന്നതിനായി ആന്റിഓക്സിഡൻറ്റുള്ള സമ്പന്നമായ ആഹാരങ്ങൾ, പച്ചമരുന്നുകൾ, അനുബന്ധ എന്നിവ ഉപയോഗിക്കാവുന്നതാണ്. സമീപകാല ഗവേഷണ പഠനങ്ങൾ തെളിയിച്ചിട്ടുണ്ട് Nrf2 ജീൻ പാത്ത്വേ ആൻറിഓക്സിഡൻറുകളുടെ ഫലങ്ങൾ വർദ്ധിപ്പിക്കാൻ സഹായിക്കും. എസ് Nrf2 ന്റെ ഗുണഫലങ്ങൾ താഴെ വിവരിച്ചിരിക്കുന്നു.

വിഷവസ്തുക്കളെതിരായ ശരീരത്തെ സംരക്ഷിക്കുക

NRF2 എന്നത് ദോഷകരമായ, അന്തർ, ബാഹ്യ സംയുക്തങ്ങളിൽ നിന്നുള്ള കോശങ്ങളെ സംരക്ഷിക്കാൻ കഴിയുന്ന ഒരു ആന്തരികമായ വസ്തുവാണ്. മരുന്നുകൾ / മരുന്നുകൾക്കും വിഷവസ്തുക്കൾക്കും മനുഷ്യശരീരത്തെ പ്രതിരോധിക്കാൻ NRF2 സഹായിച്ചേക്കാം. മൾട്ടിഡ്ഗ്ഗ് പ്രതിരോധവുമായി ബന്ധപ്പെട്ട പ്രോട്ടീനുകൾ അല്ലെങ്കിൽ MRP കൾ എന്നറിയപ്പെടുന്ന സെല്ലിൽ നിന്ന് സംയുക്തങ്ങൾ ഇല്ലാതാക്കുവാൻ പ്രോട്ടീൻ ഉത്പാദനം മെച്ചപ്പെടുത്തുക. ഉദാഹരണത്തിന്, ശ്വാസകോശങ്ങളെ നാഡി തടയാൻ സിഗരറ്റ് പുകയിലെ ശ്വസനത്തിനു ശേഷം NRF2 ട്രിഗർ ചെയ്യുകയാണ്.

കൂടാതെ, അലർജി, വൈറൽ രോഗങ്ങൾ, ബാക്ടീരിയ എൻഡോടോക്സിൻസ്, ഹൈപ്പൊരോക്സിസ്, വിവിധ പാരിസ്ഥിതിക മലിനീകരണത്തിനെതിരെ ശ്വാസകോശങ്ങളെ പ്രതിരോധിക്കാൻ അത് അത്യന്താപേക്ഷിതമാണ്. എന്നിരുന്നാലും, Nrf2 നിരന്തരമായ ട്രിഗ്ഗർ മനുഷ്യശരീരത്തിൽ ഉടനീളം ഗ്ലൂറ്റാതione അറിയപ്പെടുന്ന പദാർത്ഥത്തിന്റെ അളവ് കുറയ്ക്കാം. NRF2 കാൻസർ രോഗബാധയിൽ നിന്നും സംരക്ഷിക്കപ്പെടുകയും ആർസെനിക് ഹെപ്പറ്റോട്ടോക്സിസിറ്റിയിൽ നിന്ന് കരളിനെ സംരക്ഷിക്കുകയും ചെയ്യാം. കൂടാതെ, NRF2 മദ്യത്തിൻറെ ഉപഭോഗത്തിൽ നിന്നും കരളും തലച്ചോറും സംരക്ഷിക്കുന്നു. ഉദാഹരണമായി, എൻഎഫ്എഫ്എക്സ്എൻഎക്സ്എക്സ്എക്സ് അസെറ്റാമോമൊഫെൻ വിഷപദാർത്ഥത്തെ പ്രതിരോധിക്കാൻ കഴിയും.

വഴക്കമുണ്ടാക്കുന്നതും ഓക്സിഡേറ്റീവ് സമ്മർദ്ദവുമാണ്

NRF2 സജീവമാക്കൽ വഴി സോറിസിസിൻറെ സാന്നിധ്യം പോലെയുള്ള വീക്കം തടയുന്ന സൈറ്റോകൈൻസിനൊപ്പം വീക്കം തടയാൻ സഹായിക്കും. NRF2 കരൾ, കിഡ്നി, ശ്വാസകോശത്തിലെ സന്ധിവാതം, ഫിബ്രോസിസ് തുടങ്ങിയ ആരോഗ്യ പ്രശ്നങ്ങളുമായി ബന്ധപ്പെട്ട വീക്കം കുറയ്ക്കും. എൻഎഫ്എഫ്എക്സ്എൻഎക്സ്എക്സ് എക്സ്എക്സ്എക്സ്എക്സ്, സൈക്കോകൈൻസ് എന്നിവ കുറഞ്ഞിട്ടുണ്ട്. ആസ്തമ പോലുള്ള രോഗങ്ങൾക്ക് ഇത് ഗുണം ചെയ്യും.

NRF2 പുറമേ നീല വെളിച്ചത്തിൽ നിന്നും സൂര്യപ്രകാശത്തിൽ കാണപ്പെടുന്ന UVA / UVB ൽ നിന്നും സെല്ലുലാർ നാശത്തിനെതിരെ സംരക്ഷിക്കുന്നു. NRF2 പൊരുത്തക്കേടുകൾ sunburnt ലഭിക്കുന്നതിന് ഇത് കൂടുതൽ എളുപ്പമാക്കുന്നു. UV വികിരണം പ്രതികരണമായി കൊളാജ്യം നിയന്ത്രിക്കുന്നതിന് NRF2 ശേഷിയുള്ളതിനാലാണ് ഇതിന് ഒരു കാരണം. നൂതന ഗ്ലൈക്കേഷൻ എൻഡ്-പ്രോഡക്റ്റ്സ് അഥവാ എയ്ജ്സ്, പ്രമേഹം, ന്യൂറോഡെഗെനറിക് അസുഖങ്ങൾ തുടങ്ങിയ നിരവധി ആരോഗ്യ പ്രശ്നങ്ങൾ വികസിപ്പിക്കുന്നതിൽ സഹായിക്കുന്നു. NRF2 ശരീരത്തിനുള്ളിൽ AGE ൻറെ ഓക്സീഡിറ്റിലുള്ള സമ്മർദ്ദം കുറയ്ക്കാൻ കഴിയും. എൻആർഎഫ്എക്സ്എൻഎക്സ്എക്സ് മനുഷ്യ ചൂടിൽ നിന്നും സമ്മർദ്ദം ഉയർന്ന മർദ്ദത്തിൽ നിന്നും മനുഷ്യ ശരീരത്തെ സംരക്ഷിക്കും.

മൈറ്റോകോണ്ട്രിയയും വ്യായാമവും മെച്ചപ്പെടുത്തുന്നു

NRF2 ഒരു മൈോട്രോണ്ട്രീയ ബൂസ്റ്ററാണ്. എൻ.ആർ.എഫ്.എക്സ്.എൻ.എക്സ്.എക്സ് ആക്ടിവേറ്റേഷൻ മൈത്രിചോറിയയുടെ എപിപി ഊർജ്ജത്തിന്റെ വർദ്ധനവിന് കാരണമാകുന്നു. ഓക്സിജൻ, സിട്രേറ്റ്, കൊഴുപ്പ് എന്നിവ വർദ്ധിപ്പിക്കാനും കഴിയും. എൻആർഎഫ്എക്സ്എക്സ്എക്സ്എക്സ് ഇല്ലാതെ, മൈറ്റോകോണ്ട്രിയയിൽ ശാരീരികമായും, ഗ്ലൂക്കോസിലും പ്രവർത്തിക്കാനുള്ള കഴിവുണ്ടായിരിക്കും. ബയോജെനിസിസ് എന്ന ഒരു പ്രക്രിയയിലൂടെ മൈറ്റോകോണ്ട്രിയയുടെ വളർച്ചയ്ക്ക് NRF2 അത്യന്താപേക്ഷിതമാണ്. വ്യായാമത്തിന്റെ ആനുകൂല്യങ്ങൾ പ്രയോജനപ്പെടുത്തുന്നതിന് എൻആർഎഫ്എക്സ്എൻഎക്സ്എക്സ് ആക്ടിവേഷൻ വളരെ പ്രധാനമാണ്.

Nrf2 ന്റെ പ്രവർത്തനം കാരണം, വ്യായാമം mitochondrial ഫംഗ്ഷൻ ഉയർത്തുന്നു, ഈ ഫലം CoQ10, Cordyceps, കൂടാതെ കലോറിക് നിയന്ത്രണം വർദ്ധിപ്പിക്കും എവിടെ. മിതമായ വ്യായാമം അല്ലെങ്കിൽ നിശിത വ്യായാമങ്ങൾ mitrondrial biogenesis ഒപ്പം സൂപ്പർ ഓക്സൈഡ് ഡിപ്രട്ടേസ് അല്ലെങ്കിൽ എസ്.ഒ.ഡിനും ഉയർന്ന ഊർജ്ജിത സിന്തസിസ്, അല്ലെങ്കിൽ HO-XXX, NRF1 സജീവമാക്കൽ വഴി. ആൽഫ-ലിപ്പോയ്ക് ആസിഡ്, അല്ലെങ്കിൽ ALA, ഡാൻ ഷെൻ എന്നിവ എൻആർഎഫ്എക്സ്എൻഎക്സ്എക്സ് മധ്യത്തോടെയുള്ള മൈറ്റോകോണ്ട്രീയ ബയോജെനിസിസ് വളർത്തുന്നു. കൂടാതെ, NRF1 NRF2 നീക്കം ചെയ്യുന്നത് വ്യായാമത്തിന് ദോഷം ചെയ്യുന്ന വ്യായാമം സഹിഷ്ണുത മെച്ചപ്പെടുത്താനും കഴിയും.

ഹൈപോക്സിയയെ സംരക്ഷിക്കുന്നു

NRF2 മനുഷ്യ ശരീരത്തെ സെല്ലുലാർ ഓക്സിജന്റെ നഷ്ടം / തകരാറിൽ നിന്ന് സംരക്ഷിക്കാൻ സഹായിക്കുന്നു, ഹൈപോക്സിയ എന്ന് വിളിക്കുന്ന ഒരു ആരോഗ്യപ്രശ്നം. CIRS ഉള്ള വ്യക്തികൾ അവരുടെ NRF2 തടസ്സപ്പെട്ടതിനാൽ ഓക്സിജൻ അളവ് കുറച്ചു, ഇത് VEGF, HIF1, HO-XNUM എന്നീ രണ്ടു കുറയ്ക്കും. ഹൈപ്പോക്സിയ, മൈആർ- 1, ആരോഗ്യമുള്ള വ്യക്തികളിൽ, ബ്രൈൻ സെല്ലുകളുടെ നിർമ്മാണത്തിനായി അത്യാവശ്യമാണ്, അതിനാൽ അവയെ NRF101 / HO-2, VEGF / eNOS എന്നിവയുടെ അളവിൽ വർദ്ധിപ്പിക്കുകയും അളക്കുകയും ചെയ്യുന്നു, അതിനാൽ മസ്തിഷ്ക ക്ഷതം തടയുന്നു. CIRS ൽ.

കുറഞ്ഞത് HIF1 സ്വഭാവമുള്ള ഹൈപ്പോക്സിക്, CIRS- ൽ NRF2 അസന്തുലിതാവസ്ഥ മൂലം ചോർച്ച രക്തസ്രാവം ഉണ്ടാകാം. Rhodiola ൽ സ്ഥിതിചെയ്യുന്ന സലിഡോസ്സൈഡ്, NRF2 സജീവതയിൽ പ്രവർത്തിക്കുന്നു, മനുഷ്യശരീരത്തിൽ VEGF, HIF1 അളവ് വർദ്ധിപ്പിച്ച് ഹൈപ്പോക്സിയയിൽ പ്രവർത്തിക്കുന്നു. NRF2 പുറമേ ആത്യന്തികമായി ഹൃദയത്തിൽ ലാക്റ്റേറ്റ് പണിക്കൂലിനെ പ്രതിരോധിക്കാൻ കഴിയും. NRF2 സജീവമാക്കൽ ഹൈപോക്സിയ ഇൻജുഡിയേറ്റഡ് മോഷൻ സിക്ക്നെസ് അല്ലെങ്കിൽ എഎംഎസ് നിർത്താം.

ഏജിംഗ് കുറയുന്നു

NRF2, PPAR-gamma, FOXO എന്നിവയിലൂടെ വലിയ അളവിൽ ഗുരുതരമായ പല ഘടകങ്ങളും ചെറിയ അളവിൽ ആയുർദൈർഘ്യം വർദ്ധിപ്പിക്കും. വളരെ ചെറിയ അളവിലുള്ള വിഷപദാർത്ഥങ്ങൾ അടുത്ത കാലത്ത് ഒരു ടോക്സിൻ ഉപയോഗിച്ച് വെല്ലുവിളി ഉയർത്താൻ സഹായിക്കുന്ന സെല്ലിന്റെ കഴിവ് ഉയർത്തുന്നുണ്ട്, എന്നാൽ വിഷം രാസവസ്തുക്കൾ ഉപയോഗിക്കുന്നതിന് ഇത് ഒരു അംഗീകാരമില്ല.

ഈ പ്രക്രിയയുടെ നല്ലൊരു ഉദാഹരണമാണ് കലോറിക് നിയന്ത്രണം. NRF2 മൈറ്റോകോണ്ട്രിയയും ആന്റിഓക്സിഡന്റുകളും അവയുടെ അളവ് ഉയർത്താനും കോശങ്ങളുടെ മരിക്കുന്നതിനുള്ള ശേഷി കുറയ്ക്കാനും കോശങ്ങളുടെ ആയുസ്സ് വർദ്ധിപ്പിക്കും. NRF2 പ്രായപൂർത്തിയായതിനാൽ NRF2 മരിക്കാനും, പുനരുജ്ജീവിപ്പിക്കാനും സഹായിക്കുന്നു. മുറിവുകൾ മെച്ചപ്പെടുത്താൻ NRF2 ഒരു പങ്കു വഹിക്കുന്നു.

രക്തധമനികളുടെ ശക്തി വർദ്ധിപ്പിക്കുന്നു

സൾഫോറാഫാനെ ഉൽപ്പാദിപ്പിച്ച് കൃത്യമായി പൂർത്തിയാക്കി, NRF2 സജീവമാക്കൽ ഉയർന്ന രക്തസമ്മർദ്ദം, അല്ലെങ്കിൽ രക്തസമ്മർദ്ദം, ധമനികളുടെ കാഠിന്യം, അല്ലെങ്കിൽ രക്തപ്രവാഹത്തിന്, തുടങ്ങിയ ഹൃദയ രോഗങ്ങൾക്കെതിരെ പരിരക്ഷിക്കാം. NRF2 കൊളസ്ട്രോൾ ഉളവാക്കുന്ന സമ്മർദ്ദം കുറയ്ക്കുന്നതിലും, രക്തക്കുഴലുകളിലുണ്ടാകുന്ന അസിറ്റിക്കൊലൈനോസ് അല്ലെങ്കിൽ എസിഎ, വിശ്രമിക്കുന്ന പ്രവർത്തനം എന്നിവ വർദ്ധിപ്പിക്കും. Nrf2 സജീവമാക്കൽ ഹൃദയം ശക്തിപ്പെടുത്താൻ കഴിയും, എന്നാൽ, ഓവർ ആക്ടിവേറ്റഡ് Nrf2 ഹൃദ്രോഗമുണ്ടാകാനുള്ള സാധ്യത വർദ്ധിപ്പിക്കാൻ കഴിയും.

സ്റ്റാറ്റിനുകൾ ഹൃദയ രോഗങ്ങൾ തടയാനോ നയിച്ചേക്കാം. ഇരുമ്പ്, കാൽസ്യം എന്നിവയുടെ അളവിൽ പ്രധാന പങ്കാണ് എൻആർഎഫ്എക്സ്എൻഎക്സ്എക്സ്. മനുഷ്യ ശരീരത്തെ സംരക്ഷിക്കുക, ഇരുമ്പ് ഉയർന്ന അളവിൽ ഉണ്ടായിരിക്കരുത്. ഉദാഹരണത്തിന്, Sirtuin 2, അല്ലെങ്കിൽ SIRT2, ഇരുമ്പ് ആരോഗ്യകരമായ അളവുകൾ ആവശ്യമാണ് വിശ്വസിക്കപ്പെടുന്നു NRF2 സജീവമാക്കുന്നതിലൂടെ സെല്ലുകളിൽ ഇരുമ്പ് ഹോമിയോസ്റ്റാസിസ് നിയന്ത്രിക്കാൻ കഴിയും. NRF2 സിക്കിൾ സെൽ ഡിസീസ്, അല്ലെങ്കിൽ എസ്സിഡി എന്നിവയ്ക്കൊപ്പം സഹായിക്കും. NRF2 ഡിസ്ഫൈനക്ഷൻ ഡിസ്ബിയ്യോസിസ് അല്ലെങ്കിൽ ലക്ചൈനുകളിൽ ഉണ്ടാകുന്ന ഹൈപ്പർടെൻഷനെപ്പോലെ എൻഡോഡോക്സിമിയയ്ക്ക് പിന്നിൽ ഒരു കാരണമായിരിക്കാം. രക്തക്കുഴലുകളിൽ സിസ്റ്റത്തിൽ ഉണ്ടാകുന്ന അൻപത്റമിനെതിരായി മനുഷ്യ ശരീരത്തെ സംരക്ഷിക്കാൻ Nrf2 കഴിയും.

പോരാട്ടങ്ങൾ ന്യൂറോഫിഫാമേഷൻ

NRF2 മസ്തിഷ്കത്തിന്റെ വീക്കം സഹായിക്കും, സാധാരണയായി neuroinflammation വിളിക്കുന്നത്. കൂടാതെ, NRF2, സെൻട്രൽ നാർവോസ് സിസ്റ്റം, അല്ലെങ്കിൽ സിഎൻഎസ്, ഡിസോർഡേഴ്സ് എന്നിവ ഉൾപ്പെടെ,

  • അൽഷിമേഴ്സ് രോഗം (എ.ഡി.) - മൈറ്റോകോണ്ട്രിയയിൽ അമോയ്ഡ് ബീറ്റാ സ്ട്രെസ് കുറയ്ക്കുന്നു
  • അമോട്രോപിക് ലാറ്ററൽ സ്ക്ലിറോസിസ് (ALS)
  • ഹണ്ടിങ്ടൺസ് രോഗം (എച്ച്ഡി)
  • മൾട്ടിപ്പിൾ സ്ക്ലിറോസിസ് (എംഎസ്)
  • നാഡി പുനരുജ്ജീനം
  • പാർക്കിൻസൺസ് രോഗം (പിഡി) - ഡോപ്പാമിൻ സംരക്ഷിക്കുന്നു
  • സുഷുൻകോർഡ് ഇൻജറി (SCI)
  • സ്ട്രോക്ക് (രോഗചികിത്സ, ഹെമറാജിക്) - ഹൈപ്പോക്സിയയെ സഹായിക്കുന്നു
  • ട്രോമൂമാറ്റിക് ബ്രെയിൻ ഇൻജറി

NRF2 ഓട്ടിസം സ്പെക്ട്രം ഡിസോർഡേഴ്സ് അല്ലെങ്കിൽ എഎസ്ഡി ഉള്ള കൗമാരക്കാരിൽ ന്യൂറോയ്ഫാംമാറ്റിങ് കുറയുന്നു. ന്യൂറോഫിഫോമേഷനുമായുള്ള എൻആർഎഫ്എക്സ്എൻഎക്സ്എക്സ് ആക്ടിവിറ്ററുകൾ കൊണ്ട് ഐഡീബേനോ ജോഡി ശരിയായി പ്രവർത്തിക്കുന്നു. NRF2 ബ്ലഡ് ബ്രെയിൻ ബാരിയർ, അല്ലെങ്കിൽ BBB എന്നിവയും മെച്ചപ്പെടുത്താം. ഉദാഹരണമായി, റോസ്മേരിയിലും മുനിയിലും നിന്നും ലഭിച്ച കാർനോസിക് ആസിഡിനാൽ എൻആർഎഫ്എക്സ്എൻഎക്സ്എക്സ് ആക്ടിവേഷൻ ബിബിബി ക്രോസ് ചെയ്ത് ന്യൂറോജനിസത്തിന് കാരണമാകും. ബ്രെയിൻ ഡിറൈവ്ഡ് ന്യൂറോട്രോപിക് ഫാക്ടർ, അല്ലെങ്കിൽ ബി.ഡി.എൻ.എഫ് (NDF2) എന്നിവയും തെളിയിച്ചിട്ടുണ്ട്.

എൻആർഎൽഎൻഎൻഎൻഎക്സ്എക്സ്, എൻ ആർ മെടൈൽ ഡി-ആസ്പാറേറ്റും എൻഎംഡിഎ റിസപ്റ്ററുകളും ഉപയോഗിച്ച് മസ്തിഷ്കസൂക്ഷ്മവും ഗ്ലൂട്ടാമേറ്റ് ഇന്ധനവുമുളള പ്രശ്നങ്ങൾക്ക് സഹായകമാവുന്നതിനേക്കാൾ ചില പോഷകാഹാര ശേഷി സംവിധാനങ്ങളെ നാഡീ വളർച്ചാ ഘടകത്തിനോ അല്ലെങ്കിൽ എൻജിഎഫിനെയോ കാരണമാക്കും. ക്വിനോളിൻ ആസിഡിൽ നിന്നും ഓക്സിഡയന്റ് സ്ട്രെസ്സ് കുറയ്ക്കുകയും ക്വിൻ എന്നറിയപ്പെടുകയും ചെയ്യും. NRF2 സജീവമാക്കൽ പിടികൂടുന്നത് തടയാനും വലിയ അളവിൽ തോക്കെടുക്കും. ഉത്തേജക സ്ഥിരമായ അളവിൽ NRF2 തലച്ചോറിലെ എക്സ്ട്രൊല്യൂലർ ഗ്ലൂട്ടാമേറ്റ് കുറയ്ക്കുകയും ഗ്ലൂറ്റാമാറ്റിൽ നിന്നും ഗ്ലൂത്തോത്തോയിനിൽ നിന്നും സിസെയിൻ വരാനുള്ള കഴിവിലൂടെയും മനസിലാക്കാൻ ശേഷിയുള്ള കഴിവുകൾ വർദ്ധിപ്പിക്കുകയും ചെയ്യും.

വിഷാദത്തെ തുടച്ചുനീക്കുന്നു

വിഷാദരോഗം, മസ്തിഷ്കത്തിൽ വീക്കം, പ്രത്യേകിച്ച് prefrontal കോർട്ടക്സ്, ഹിപ്പോകാമ്പസ് എന്നിവയിൽ നിന്ന്, അതുപോലെ തന്നെ BDNF കുറയ്ക്കും സാധാരണമാണ്. വിഷാദത്തിൻറെ ചില പതിപ്പുകളിൽ എൻആർഎക്സ്എക്സ്എക്സ്എക്സ്, മസ്തിഷ്കത്തിൽ വീക്കം കുറയ്ക്കുന്നതിലൂടെയും ബി.ഡി.എൻ.എഫ് അളവ് വർദ്ധിക്കുന്നതിലൂടെയും വിഷാദരോഗ ലക്ഷണങ്ങൾ മെച്ചപ്പെടുത്താൻ കഴിയും. നാഡ്രെനറിൻ, ഡോപ്പാമിൻ, സെറോടോണിൻ, ബിഡിഎൻഎഫ് തുടങ്ങിയവ ഹൈപ്പോകോപസ് ഉദ്ധരിക്കിക്കൊണ്ട് വിഷാദരോഗം കുറയ്ക്കാനുള്ള കഴിവ് ആഗസ്തിയുടെ കഴിവാണ് എൻആർഎഫ്എക്സ്എൻഎക്സ്എക്സ് സജീവമാക്കുന്നത്.

ക്യാൻസർ ഗുണവിശേഷങ്ങൾ അടങ്ങിയിരിക്കുന്നു

NRF2 ഒരു ട്യൂമർ സൂപ്പർസർക്കറാണ്. ഇത് മാനേജ് ചെയ്യപ്പെടുന്നില്ലെങ്കിൽ ട്യൂമർ പ്രൊമോട്ടറാണ്. ഫ്രീ റാഡിക്കലുകളും ഓക്സീറ്റീവ് സ്ട്രെസും മൂലം ക്യാൻസർ ഉണ്ടാകാൻ NRF2 സഹായിക്കും. എന്നിരുന്നാലും, ക്യാൻസർ കോശങ്ങളിലും എൻആർഎഫ്എക്സ്എക്സ്എക്സ്എക്സ്എക്സ്എക്സ്എക്സ്എക്സ്എക്സ് കൂടുതലാണ്. NRF2 ന്റെ തീവ്രമായ സജീവമാക്കൽ നിരവധി ക്യാൻസർമാർക്ക് സഹായിക്കും. ഉദാഹരണത്തിന്, പ്രൊപ്പാന്ഡിമിനോട് അനുബന്ധിച്ച് എൻആർഎഫ്എക്സ്എൻഎക്സ്എക്സ് ആക്ടിവേഷൻ മുഖേന ത്വക് ക്യാൻസർ കുറയ്ക്കാൻ കഴിയും.

വേദന തുടച്ചുനീക്കുന്നു

Gulf Gulf War Illness, അല്ലെങ്കിൽ GWI, ഗൾഫ് വാർ വൈദഗ്ധികളെ ബാധിക്കുന്ന ശ്രദ്ധേയമായ രോഗം, അബോധാവസ്ഥയിലല്ലാത്ത, വിട്ടുമാറാത്ത ലക്ഷണങ്ങളുടെ ഒരു ശേഖരമാണ്, അത് മടുപ്പ്, തലവേദന, സന്ധിവേദന, ദഹനക്കേട്, ഉറക്കമില്ലായ്മ, തലകറക്കം, ശ്വാസകോശ സംബന്ധിയായ രോഗങ്ങൾ, മെമ്മറി പ്രശ്നങ്ങൾ എന്നിവ ഉൾപ്പെടാം. വേദന കുറയ്ക്കുന്നതിന് പുറമേ, ഹിപ്പികപാലിന്റെയും ജനറൽ വീമ്പിൻറെയും കുറച്ചുകൊണ്ട് NRF2 ഗ്ലോബൽ പ്രതിരോധത്തിന്റെ ഗുണങ്ങൾ മെച്ചപ്പെടുത്തുന്നു. NRF2 നാരക പരുക്കനിൽ നിന്ന് വേദനയോടെ സഹായിക്കുകയും പ്രമേഹരോഗ ചികിത്സാ നാശനഷ്ടം മെച്ചപ്പെടുത്തുകയും ചെയ്യുന്നു.

പ്രമേഹത്തെ മെച്ചപ്പെടുത്തുന്നു

ഹൈപ്പർ ഗ്ലൈസീമിയ എന്ന് വിളിക്കപ്പെടുന്ന ഉയർന്ന ഗ്ലൂക്കോസ് അളവ് മൈകോക് ഓണ്ടോർറിയൽ പ്രവർത്തനം തടസ്സപ്പെട്ടതിനാൽ കോശങ്ങൾക്ക് ഓക്സിഡേറ്റീവ് കേടുപാടുകൾ സൃഷ്ടിക്കുന്നു. കോശങ്ങളിലെ ഹൈപ്പർ ഗ്ലൈസീമിയയെ ദോഷകരമായി ബാധിക്കുന്ന മനുഷ്യശരീരത്തെ NRF2 സജീവമാക്കുകയും, അങ്ങനെ സെൽ മരണം തടയുന്നു. ഇൻസുലിൻ പ്രതിരോധം കുറയ്ക്കുന്നതിനിടയിൽ എൻആർഎഫ്എക്സ്എൻഎക്സ്എക്സ് ആക്റ്റിവേഷൻ കൂടാതെ പാൻക്രിയാറ്റിക് ബീറ്റാ സെൽ ഫംഗ്ഷനെ കൂടുതൽ സംരക്ഷിക്കുകയും പുനഃസ്ഥാപിക്കുകയും, വർദ്ധിപ്പിക്കുകയും ചെയ്യും.

വിഷൻ ആൻറ് ഹിയറിംഗ് സംരക്ഷിക്കുന്നു

NRF2 പ്രമേഹരോഗ വിദഗ്ധനിൽ നിന്നുള്ള കണ്ണിന് ദോഷം ചെയ്യുന്നതിൽ നിന്നും സംരക്ഷിക്കാൻ കഴിയും. ഇത് തിമിരത്തിൻറെ രൂപവത്കരണത്തെ ഒഴിവാക്കുകയും പ്രകാശപ്രശ്നങ്ങളിൽ നിന്ന് ഫോട്ടോയെടുക്കുന്നവരെ സംരക്ഷിക്കുകയും ചെയ്യും. NRF2 പുറമേ സമ്മർദം, കേൾവി നഷ്ടത്തിൽ നിന്ന് ചെവി, അല്ലെങ്കിൽ കോക്ലിയ എന്നിവയെ സംരക്ഷിക്കുന്നു.

അമിത വണ്ണം സഹായിക്കും

മനുഷ്യശരീരത്തിൽ കൊഴുപ്പ് അടിഞ്ഞുകൂടിയുള്ള ചരങ്ങളെ നിയന്ത്രിക്കുന്നതിനുള്ള കഴിവ് എൻആർഎഫ്എക്സ്എൻഎക്സ്എക്സിൽ പ്രാഥമികമായി പൊണ്ണത്തടി സഹായിച്ചേക്കാം. സൾഫോറഫാനുമായി NRF2 സജീവമാക്കൽ ഫാറ്റി ആസിഡ് സിന്തസിസ്, അല്ലെങ്കിൽ FAS, പ്രോട്ടീനുകൾ, അല്ലെങ്കിൽ യുസിപി എന്നിവയെ പ്രതിരോധിക്കാൻ കഴിയും, ഇത് കൊഴുപ്പ് കൂടുന്നതും കൂടുതൽ ബ്രൌൺ കൊഴുപ്പും കാരണമാവുകയും, ഇത് കൂടുതൽ മൈറ്റോകോണ്ട്രിയ ഉൾക്കൊള്ളുന്ന കൊഴുപ്പ് ആയിരിക്കുകയും ചെയ്യും.

ഗട്ട് സംരക്ഷിക്കുന്നു

കുടലിൽ മൈക്രോബയോമോ ഹോമിയോസ്റ്റാസിസ് സംരക്ഷിക്കുന്നതിലൂടെ ഗ്യാസ് സംരക്ഷിക്കാൻ NRF2 സഹായിക്കുന്നു. ഉദാഹരണത്തിന്, ഓക്സിഡയന്റ് സ്ട്രെസ് മുതൽ ഗട്ട് സംരക്ഷിക്കാൻ നഖം NPF2 ലാപൊബോബിലില്ലസ് പ്രോബയോട്ടിക്സ് ഉദ്ദീപിപ്പിക്കും. എൻഎൽഎഫ്എക്സ്എൻഎക്സ്എക്സ് എലസറേറ്റീവ് കൊളിറ്റീസ്, യുസി എന്നിവയും തടയാൻ സഹായിക്കും.

സെക്സ് ഓർഗൻസ് സംരക്ഷിക്കുന്നു

പ്രമേഹരോഗികളിലെ NRF2 വൃഷണങ്ങളെ സംരക്ഷിക്കുകയും ബീജങ്ങളുടെ എണ്ണത്തിൽ നിന്ന് ദോഷം വരുത്തുകയും ചെയ്യും. ഇത് Erectile Dysfunction, അല്ലെങ്കിൽ ED ൽ സഹായിക്കാം. മുകുന, ട്രൈബുലസ്, അശ്വാഗാന്ദ എന്നിവ പോലുള്ള ചില ലിബിവോ അപ്രോഗുകൾ എൻആർഎഫ്എക്സ്എൻഎക്സ്എക്സ് ആക്ടിവേഷൻ വഴി ലൈംഗിക പ്രവർത്തനം മെച്ചപ്പെടുത്തും. സൂര്യപ്രകാശം അല്ലെങ്കിൽ ബ്രോക്കോളി മുളപ്പിച്ച പോലുള്ള NRF2 വർദ്ധിപ്പിക്കുന്ന മറ്റ് ഘടകങ്ങളും ലിബീഡോ മെച്ചപ്പെടുത്താനും സഹായിക്കും.

അസ്ഥികളും പേശികളും നിയന്ത്രിക്കുന്നു

ഓക്സിഡേറ്റീവ് സ്ട്രെസ് ബോസ് സന്ധികളുടെയും ബോൾഡ് റിഡക്ഷന്റേയും ഫലമായി ഉണ്ടാകാം. ഇത് ഓസ്റ്റിയോപൊറോസിസിൽ സാധാരണമാണ്. അസ്ഥികളുടെ ആൻറി ഓക്സിഡൻറുകൾ മെച്ചപ്പെടുത്താനും അസ്ഥി വളർത്തലിന് സംരക്ഷണം നൽകാനും NRF2 സജീവമാക്കും. NRF2 മസിലുകൾ നഷ്ടപ്പെടുകയും, ഡുക്ക്ഹെൻ മസ്കുലർ ഡിസ്ട്രോഫി അല്ലെങ്കിൽ ഡി.എം.ഡി വർദ്ധിപ്പിക്കുകയും ചെയ്യും.

ആൻറി വൈറൽ പ്രോപ്പർട്ടികൾ

കുറഞ്ഞത് ഒടുവിലെങ്കിലും, എൻആർഎഫ്എക്സ്എൻഎക്സ്എക്സ് ആക്ടിവേഷൻ മനുഷ്യനേരത്തെ പല വൈറസുകളിൽനിന്നും പ്രതിരോധിക്കാൻ സഹായിക്കുന്നു. ഡെങ്കിപ്പനി വൈറസ് രോഗികളിൽ, NRF2 കുറവ് ഡിഗ്രി ഉള്ളവരെ അപേക്ഷിച്ച് NRF2 ഉയർന്ന അളവിലുള്ള വ്യക്തികളിൽ ലക്ഷണങ്ങൾ ആയിരുന്നില്ല. ഹ്യൂമൻ ഇമ്യൂണോ ഡിഫിഷ്യൻസി- 2 വൈറസ് അല്ലെങ്കിൽ എച്ച്ഐവി ഉള്ളവർക്ക് NRF2 സഹായിക്കും. NRF1 Adeno അസോസിയേറ്റഡ് വൈറസ്, അല്ലെങ്കിൽ AAV, എച്ച് പിലോറിയിൽ നിന്ന് ഓക്സിഡേഷൻ സമ്മർദ്ദത്തെ പ്രതിരോധിക്കാൻ കഴിയും. അന്തിമമായി, LREREX റൂട്ട് NRF2 സജീവമാക്കൽ ഉപയോഗിച്ച് ഹെപ്പറ്റൈറ്റിസ് സി വൈറസിനെ അടിച്ചമർത്തുക.

ഡോ ജിമനെസ് വൈറ്റ് കോട്ട്
NFF2, അല്ലെങ്കിൽ NF-E2- ബന്ധപ്പെട്ട ഘടകം 2, മനുഷ്യരിൽ കാണപ്പെടുന്ന ഒരു ട്രാൻസ്ക്രിപ്ഷൻ ഘടകം, ഇത് ഒരു പ്രത്യേക ആൻറിഓക്സിഡൻറിന്റെയും വിഷവസ്തുക്കളിൽ നിന്നുമുള്ള ജീനുകളുടെയും രൂപം വ്യക്തമാക്കുന്നു. മനുഷ്യശരീരത്തിൽ ഹോമിയോസ്റ്റാസിസ് പുനരുജ്ജീവിപ്പിക്കാൻ നിരവധി ആൻറി ഓക്സിഡൻറുകളും ഘട്ടം II കരൾ വിഷാംശവും എൻസൈമുകൾ വർദ്ധിപ്പിക്കും എന്നതിനാൽ ഓക്സിഡീവ് സ്ട്രെസ്സ് കാരണം ഈ സിഗ്നലിങ് പാത്ത് സജീവമാക്കിയിട്ടുണ്ട്. ഹോമിയോസ്റ്റാസി അഥവാ സംതുലനാവസ്ഥയിലുടനീളം മനുഷ്യർ പ്രവർത്തിക്കപ്പെടുന്നു. ശരീരം ഓക്സിഡയന്റ് സമ്മർദ്ദം അഭിമുഖീകരിക്കുമ്പോൾ, Nrf2 ഓക്സിഡേഷൻ നിയന്ത്രിക്കുന്നതിനും സമ്മർദ്ദം നിയന്ത്രിക്കുന്നതിനും സജീവമാക്കുന്നു. ഓക്സിഡേറ്റീവ് സമ്മർദവുമായി ബന്ധപ്പെട്ട ആരോഗ്യപ്രശ്നങ്ങൾ തടയുന്നതിന് Nrf2 അത്യാവശ്യമാണ്. ഡോ. അലക്സ് ജിമനേസ് DC, CCST ഇൻസൈറ്റ്

ക്യാൻസർ, മോർട്ടാലിറ്റി, ഏജിംഗ്, ബ്രെയിൻ ആന്റ് ബിഹേവിയർ, ഹൃദ്രോഗം എന്നിവയെല്ലാം സുൽഫോപ്പഫണും അതിന്റെ പ്രഭാവവും

ഐസോത്തിയോസയനങ്ങൾ ഭക്ഷണത്തിൽ നിങ്ങൾക്ക് ലഭിക്കുന്ന ഏറ്റവും പ്രധാനപ്പെട്ട പ്ലാന്റ് സംയുക്തങ്ങളാണ്. ഈ വീഡിയോയിൽ ഞാൻ നിർമ്മിച്ചതിൽ ഏറ്റവും സമഗ്രമായ കേസ് ഞാൻ ഉണ്ടാക്കുന്നു. ചെറിയ ശ്രദ്ധാകേന്ദ്രം? ചുവടെയുള്ള സമയ പോയിന്റുകളിൽ ഒന്ന് ക്ലിക്കുചെയ്ത് നിങ്ങളുടെ പ്രിയപ്പെട്ട വിഷയത്തിലേക്ക് പോകുക. പൂർണ്ണ ടൈംലൈൻ താഴെ.

കീ വിഭാഗങ്ങൾ:

  • വ്യായാമം, മരണ നിരക്ക്
  • ചൊവ്വ: 83 - 83 - ഏജിംഗ്
  • XXX: 00: 26 - ബ്രെയിൻ ആൻഡ് പെരുമാറ്റം
  • 00: 38: 06 - അവസാനത്തെ റീക്യാപ്പ്
  • XXX: 00: 40 - ഡോസ്

പൂർണ്ണ ടൈംലൈൻ:

  • 00: 00 - 34 - വീഡിയോയുടെ പ്രധാന ശ്രദ്ധ പിടിച്ചുപറ്റിയ സൾഫൊർഫാനെ എന്ന ആമുഖം.
  • 83 - 83 - ക്രസ്കീരിയസ് പച്ചക്കറി ഉപഭോഗം, എല്ലാ കാരണങ്ങളാലും മരണനിരക്ക് കുറയ്ക്കുക.
  • 83 - 83 - പ്രോസ്റ്റേറ്റ് കാൻസർ റിസ്ക്.
  • 83: 83 - ക്ഷയിക്കുന്ന അർബുദം.
  • പുകവലി റിസ്കിൽ ശ്വാസകോശ കാൻസർ.
  • വ്യായാമം: സ്തനാർബുദം.
  • 00: 03: 13 - Hypothesical: നിങ്ങൾ ഇതിനകം ക്യാൻസറുണ്ടെങ്കിൽ എന്താണ്? (ഇടപെടൽ)
  • 00: 03 - 35 - കാൻസർ, മരണസംബന്ധമായ ബന്ധിത വിവരങ്ങളിൽ ഡ്രൈവിംഗ് സംവിധാനം.
  • 83: 83 - സുൽഫോപ്പഫനും അർബുദവും.
  • 83 - 83 - എലികളിലെ കോശവളർച്ച വികസനത്തിൽ ബ്രോക്കോളി മുളക്കുന്നതിന്റെ ശക്തമായ പ്രഭാവം കാണിക്കുന്നു.
  • 83 - 83 - പ്രോസ്റ്റേറ്റ് കാൻസർ രോഗികളിലെ സൾഫോറഫായെ നേരിട്ട് നൽകുക.
  • 83 - 83 - യഥാർത്ഥ ബ്രെസ്റ്റ് ടിഷ്യസിൽ ഐസോതോയോസൈനറ്റ് മെറ്റബോളിറ്റുകളുടെ ജൈവകചലനം.
  • NSS: XX: XXL - സ്തനാർബുദം സ്റ്റെം സെല്ലുകൾ തടഞ്ഞത്.
  • പുരാതന റോമിൽപോലും ഹെൽത്ത് പ്രോപ്പർട്ടികളായി ബ്രസികകൾ സ്ഥാപിക്കപ്പെട്ടു.
  • 83-83 - കാൻസറിൻ വിസർജ്ജനം വർദ്ധിപ്പിക്കുന്നതിനുള്ള സൾഫൊർഫാന്റെ കഴിവ് (ബെൻസീൻ, അൾരോലിൻ).
  • 00: 09 - NRF51 ആൻറിഓക്സിഡന്റ് പ്രതികരണ ഘടകങ്ങൾ വഴി ജനിതകമാറ്റം പോലെ.
  • 00: 10 - NRF10 ആക്റ്റിവേഷൻ ഗ്ലൂത്തോതർ-എസ്-കോഞ്ഞഗേറ്റുകൾ വഴി കാർസിനോജൻ വിസർജ്ജനം എങ്ങനെ മെച്ചപ്പെടുത്തുന്നു.
  • ബ്രസൽസ് മുളകൾ ഗ്ലൂട്ടാട്യൺ-എസ്-ട്രാൻസ്ഫസർ വർദ്ധിപ്പിക്കുകയും ഡി.എൻ.എ നാശനഷ്ടം കുറയ്ക്കുകയും ചെയ്യുന്നു.
  • 83-83 - ബ്രോക്കോളി മുളപ്പിച്ച പാനീയം ബെൻസീൻ വിസർജ്ജനം 00% വർദ്ധിപ്പിക്കും.
  • ബ്രോക്കോളി മുട്ട പൊരിഞ്ഞത്, വായു ശ്വസനത്തിലെ ആന്റിഓക്സിഡന്റ് എൻസൈമുകൾ വർദ്ധിപ്പിക്കും.
  • 83 - 83 - ക്രസ്റ്റീരിയസ് പച്ചക്കറി ഉപഭോഗം, ഹൃദ്രോഗ മരണനിരക്ക്.
  • വ്യായാമം: ബ്രോക്കോളി മുളക് പൊടി രക്തത്തിലെ ലിപിഡുകളുടെയും ഹൃദ്രോഗബാധകളുടെയും അളവ് X ടൈപ്പ് ഡയബെറ്റിക്സിന്റെ അളവിൽ വർദ്ധിപ്പിക്കുന്നു.
  • 83: 83 - പ്രായപൂർത്തിയായവർക്കുള്ള ഭാഗം ആരംഭിക്കുക.
  • 83-83 - സുൽഫോപ്പഫൻ സമ്പുഷ്ടമായ ആഹാരം വെൻഡിൻറെ ആയുസ്സ് വർദ്ധിപ്പിക്കും 00 മുതൽ XNUM% വരെ (ചില സാഹചര്യങ്ങളിൽ).
  • XXX: 00 - XXX - ആയുർദൈർഘ്യം കുറഞ്ഞ പ്രാധാന്യം.
  • ഞരമ്പുകളായ പച്ചക്കറികളും ബ്രോക്കലിയും മുളപ്പിച്ച പൗഡർ മനുഷ്യരിൽ പലതരം വീക്കം ഉദ്ദീപിപ്പിക്കുകയും ചെയ്യുന്നു.
  • വ്യായാമം: പ്രായപൂർത്തിയാകാത്ത ഒരാൾ
  • സൾഫർഫെയ്നിലെ മൗസ് സർവ്വേകൾ പഴക്കമുള്ള രോഗപ്രതിരോധ പ്രവർത്തനം മെച്ചപ്പെടുത്തും എന്നാണ് മൗസ് പഠനങ്ങൾ സൂചിപ്പിക്കുന്നത്.
  • എൺപത് മിനിറ്റുകൾക്കുള്ളിൽ സുൽഫോപ്പഫീൻ മൗസ് മോഡൽ മുടി ഉയർത്തി. ചിത്രത്തിലെ ചിത്രം: 00: 25: 18.
  • 83 - 83 - 83 - മസ്തിഷ്ക്കം, സ്വഭാവം ഭാഗം ആരംഭിക്കുക.
  • വ്യായാമം: ബ്രോക്കോളി മുട്ടയുടെ പ്രാധാന്യം ഓട്ടിസം
  • സ്കെസോഫ്രെനിയയിലെ ഗ്ലൂക്കോറാഫാനിൻറെ പ്രഭാവം.
  • 83 - 83 - മാനസിക വിഭ്രാന്തിയുടെ ആരംഭം (വിശ്വസനീയമായ സംവിധാനവും പഠനവും).
  • 83 - 83 - സ്ട്രെസ്-ഇൻഡുഡഡ് ഡിപ്രഷൻ ഷോയുടെ വിവിധ മോഡലുകൾ ഉപയോഗിച്ച് മൗസ് പഠനം ഫ്ലൂക്സെറ്റിൻ (പ്രോസക്) പോലെ സൾഫൊർഫാഹനെപ്പോലെ ഫലപ്രദമാണ്.
  • എലികളിൽ ഗ്ലൂക്കോറാപാനിനെ നേരിട്ട് ഉൾപ്പെടുത്തുന്നുവെന്ന് പഠിക്കുന്നത് സാമൂഹ്യ പരാജയങ്ങളുടെ സ്ട്രെസ് മോഡലിൽ വിഷാദരോഗം തടയുന്നതിന് സമാനമാണ്.
  • ഞാനിത്: ന്യൂറോഡെഗനേഷൻ വിഭാഗം ആരംഭിക്കുന്നു.
  • 83: 83 - സുൽഫോപ്പഫനും അൽസിമേഴ്സും രോഗം.
  • 83 - 83 - സുൽഫോപ്പഫേൻ പാർക്കിൻസൺസ് രോഗം.
  • 83: 83 - സുൽഫോപ്പഫൻ, ഹംഗിങ്ടൺസ് രോഗം.
  • 83: 83 - സുൽഫോപ്പഫേൻ ചൂട് ഷോക്ക് പ്രോട്ടീനുകൾ വർദ്ധിപ്പിക്കുന്നു.
  • വ്യായാമം: ബ്രോങ്കോ ന്യൂട്രീഷൻ തലച്ചോറ്ക്കുള്ള വ്യായാമം ആരംഭിക്കുക.
  • 83 - 83 - ടിബിഐ മെമ്മറി മെച്ചപ്പെടുത്തുന്നതിന് ശേഷം സുൽഫോപ്പഫീൻ കുത്തിവച്ച് (മൗസ് പഠനം).
  • 83 - 83 - സൾഫൊറാഫാനയും ന്യൂറോണൽ പ്ലാസ്റ്റിവും.
  • 83-83 - സോൾഫോപാപീൻ എലികളുടെ ടൈപ്പ് II ഡയബറ്റിസ് മാതൃകയിൽ പഠന മെച്ചപ്പെടുത്തുന്നു.
  • ഞരമ്പുകൾ, ഡുക്ക്ഹെൻ പേശീ നീർപ്പം.
  • 00: 37 - മയോസ്ടാടിൻ പേശികളുടെ ഉപഗ്രഹ സെല്ലുകളിൽ (in vitro) നിരോധനം.
  • മസ്തിഷ്ക, അർബുദം, ഡി.എൻ.എ നാശം, ഓക്സിഡേറ്റീവ് സ്ട്രെസ്, വീക്കം, ബെൻസെൻ വിസർജ്യങ്ങൾ, ഹൃദയ രോഗങ്ങൾ, ടൈപ്പ് II ഡയബറ്റിസ്, മസ്തിഷ്കത്തിലെ പ്രഭാവം (വിഷാദം, ഓട്ടിസം, സ്കീസോഫ്രേനിയ, ന്യൂറോഡെഗനേഷൻ), NRF00 പാത.
  • നഴ്സറികൾ, സൾഫൊർഫാപെണിന്റെ അളവ് നിർണ്ണയിക്കുന്നതിനുള്ള ചിന്തകൾ.
  • 83: 83 - 83 - വീട്ടിൽ മുളയ്ക്കുന്നമേൽ anecdotes.
  • 83: 83 - പാചകം താപനിലയും സൾഫൊർഫാനെ പ്രവർത്തനവും.
  • 83 - 83 - ഗ്ലൂക്കോറാപാഹിനിൽ നിന്ന് സൾഫർഫാപാനെ ഗുഡ് ബാക്ടീരിയയുടെ പരിവർത്തനം.
  • ഞാൺ: പച്ചക്കറികളിൽ സക്രിയ മൈറോസിനസിനൊപ്പം സപ്ലൈമുകൾ നന്നായി പ്രവർത്തിക്കുന്നു.
  • ഞാ 9: XX: XXX - പാചകം ടെക്നിക്കുകളും cruciferous പച്ചക്കറി.
  • 00: 46: 06 - ഐസോത്തിയോസയറ്റേറ്റുകൾ ഗായത്രി ആയി.

മനുഷ്യ ശരീരം വിഷാംശമുള്ള ആന്തരികവും ബാഹ്യവുമായ ഘടകങ്ങളുമായി അഭിമുഖീകരിക്കുമ്പോൾ, ഓക്സീജന്യ സമ്മർദ്ദത്തെ പ്രതിരോധിക്കാനായി കോശങ്ങൾ അവരുടെ ആന്റിഓക്സിഡൻറ്റുകളുടെ കഴിവുകൾ വേഗത്തിലാക്കണം. ഉയർന്ന അളവ് ഓക്സിഡേറ്റീവ് സമ്മർദ്ദം പലതരം ആരോഗ്യ പ്രശ്നങ്ങളുണ്ടാക്കാൻ നിശ്ചയിച്ചിട്ടുള്ളതിനാൽ, അതിന്റെ പ്രയോജനങ്ങളെ പ്രയോജനപ്പെടുത്തുന്നതിന് Nrf2 ആക്റ്റിവേഷൻ ഉപയോഗിക്കേണ്ടത് പ്രധാനമാണ്. ഞങ്ങളുടെ വിവരങ്ങളുടെ പരിധി ചിതറായും അസാധാരണമായ ആരോഗ്യ പ്രശ്നങ്ങളിലേക്കും പരിമിതപ്പെടുത്തിയിരിക്കുന്നു. വിഷയം ചർച്ച ചെയ്യാൻ, ഡോക്ടർ ജിമെനെസ് ചോദിക്കാൻ മടിക്കരുത് അല്ലെങ്കിൽ ഞങ്ങളെ ബന്ധപ്പെടുക 915-850-0900 .

ഡോ. അലക്സ് ജിമെനെസ് ക്യൂറാണ്

പച്ച കോൾ ഇപ്പോൾ ബട്ടൺ എച്ച് .png

കൂടുതൽ വിഷയം ചർച്ച: അക്യുട്ട് ബാക്ക് വേദന

പുറം വേദന ലോകവ്യാപകമായി തൊഴിലാളിയുടെ വൈകല്യവും നഷ്ടപ്പെടാത്ത ദിവസങ്ങളും ഏറ്റവും കൂടുതലായ കാരണങ്ങൾ. ഡോക്ടർ ഓഫീസ് സന്ദർശനങ്ങൾക്കുള്ള രണ്ടാമത്തെ ഏറ്റവും സാധാരണ കാരണം ചൂണ്ടിക്കാട്ടുന്നു, ഉയർന്ന ശ്വാസകോശബാധയുള്ള അണുബാധകൾ മാത്രം. ജനസംഖ്യയിൽ ഏതാണ്ട് എൺപതു ശതമാനം പേർക്ക് അവരുടെ ജീവിതകാലം മുഴുവൻ ഒരു വേദന ഒരിക്കൽ അനുഭവപ്പെടും. നട്ടെല്ല്, സന്ധികൾ, കട്ടിലുകൾ, പേശികൾ തുടങ്ങി മൃദുവായ ടിഷ്യൂകൾ കൊണ്ട് നിർമ്മിച്ച സങ്കീർണമായ ഘടനയാണ് നട്ടെല്ല്. ഇതുമൂലം, ഗുരുതരമായ പരുക്കുകളോ അല്ലെങ്കിൽ അല്ലെങ്കിൽ മോശപ്പെട്ടതോ ആയ അവസ്ഥകൾ ഹാർനിയേറ്റഡ് ഡിസ്ക്കുകൾ, ഒടുവിൽ മുടി വേദനയുടെ ലക്ഷണങ്ങളായി മാറുന്നു. സ്പോർട്സ് പരിക്കുകൾ അല്ലെങ്കിൽ വാഹനാപകടങ്ങൾ പലപ്പോഴും മുടി വേദനയ്ക്ക് ഇടയാക്കുന്നു, ചിലപ്പോൾ ചലനങ്ങളുടെ ലളിതമായ വേദനയ്ക്ക് വേദനയേറിയ ഫലങ്ങൾ ഉണ്ടാകാം. ഭാഗ്യവശാൽ, ചികിൽസാകൃതിയിലുള്ള സംരക്ഷണം പോലെയുള്ള ബദൽ ചികിൽസാരീതികൾ, നട്ടെല്ലിൽ മാറ്റം വരുത്താനും നട്ടെല്ലിൽ മാറ്റം വരുത്താനും സഹായകരമാകും, ഇത് ആത്യന്തികമായി വേദനയുടെ ആശ്വാസം വർദ്ധിപ്പിക്കും.

കാർട്ടൂൺ പേപ്പർ ബോയുടെ ബ്ലോഗ് ചിത്രം

EXTRA EXTRA | പ്രധാന വിഷയം: ശുപാർശ എൽ പാസോ, TX ച്യൂയിപോർട്ട് സ്ട്രക്ചർ

***

സുൽഫോരോഫാനെ എന്താണ്?

സുൽഫോരോഫാനെ എന്താണ്?

സുൽഫോപ്രഫെയ്ൻ ബ്രോക്കോളി, കാബേജ്, കോളിഫ്ളവർ, ബ്രസ്സൽസ് മുളപ്പിക്കൽ തുടങ്ങിയ cruciferous പച്ചക്കറികളിൽ അടങ്ങിയിരിക്കുന്ന അർനോസോൾഫർ സംയുക്തങ്ങളുടെ ഇസോഷ്യിയോസൈന്യേറ്റ് ഗ്രൂപ്പിലുള്ള ഒരു ഫൈറ്റോകെക്കമെമിക്കൽ ആണ്. ഇത് ബോക്ക് ചോയി, കാൾ, കോൾഡ്സ്, കടുക് പച്ചിലകൾ, വാട്ടർ ക്രെസ് എന്നിവയിലും കാണാവുന്നതാണ്. വിവിധ തരത്തിലുള്ള ക്യാൻസർ തടയാൻ സൾഫോഫോഫീൻ സഹായിക്കുമെന്ന് ഗവേഷണ പഠനങ്ങൾ തെളിയിച്ചിട്ടുണ്ട് Nrf2 ഉൽപ്പാദനം സജീവമാക്കുന്നു, അല്ലെങ്കിൽ ആണവ വസ്തുത erythroid 2- ബന്ധപ്പെട്ട ഘടകം, ഓക്സിഡൻറുകൾ ലേക്കുള്ള സെൽ പ്രതികരണം നിയന്ത്രിക്കുന്ന സംരക്ഷണ ആന്റിഓക്സിഡന്റ് സംവിധാനങ്ങൾ നിയന്ത്രിക്കുന്ന ഒരു ട്രാൻസ്ക്രിപ്ഷൻ ഘടകം. സുൽഫോപ്പാപാനിന്റെ പ്രവർത്തനത്തെ വിവരിക്കുക എന്നതാണ് അടുത്ത ലേഖനത്തിന്റെ ഉദ്ദേശ്യം.

വേര്പെട്ടുനില്ക്കുന്ന

KEAP1-Nrf2 -A ആന്റിഓക്സിഡന്റ് സിസ്റ്റമാണ് ഓക്സീഡിറ്റീവ് ആൻഡ് xenobiotic സമ്മർദ്ദങ്ങൾക്ക് കോശങ്ങളോട് പ്രതികരിക്കുന്ന ഒരു പ്രധാന മാർഗ്ഗമാണ്. Cruciferous പച്ചക്കറികളിൽ നിന്നും ഒരു ഇലക്ട്രോഫിലിക് ഐസോഷ്യിയോസൈന്യത്തിന്റെ സൾഫോരോഫാനീൻ (SFN), കെഇഎക്സ്എക്സ്എക്സ്എക്സ്എക്സ്എക്സ്എക്സ്എക്സ്എക്സ് -എ-പാത്ത്വേ പ്രവർത്തനത്തെ പ്രോത്സാഹിപ്പിക്കുകയും ദീർഘനാളത്തെ ഓക്സിഡേഷൻ സമ്മർദ്ദം ഒരു പ്രധാന ഊർജ്ജപരമായ പങ്ക് വഹിക്കുന്ന രോഗങ്ങളുടെ ചികിത്സയിൽ ഒരു തന്മാത്രയുടെ താൽപര്യം വളർത്തുകയും ചെയ്യുന്നു. SFN നടുത്ത് സംസ്ക്കരിച്ച സംസ്ക്കരിച്ച, മനുഷ്യ റെറ്റിനൽ പിഗ്മെന്റ് എപിടെഹിലിയൽ (RPE-1) സെല്ലുകളുടെ മൈമോൺക്രൊണ്ഡം NFF2, അതിന്റെ സൈറ്റോപ്ലാസ്മസ് ഇൻഹെബിറ്റർ KEAP1 എന്നിവയിൽ നിന്നും സ്വതന്ത്രമായി ഹൈഫർഫ്യൂഷനുമായി ചേർന്ന് ഞങ്ങൾ തെളിയിക്കുന്നു. അയോപോപ്റ്റസിസ് സമയത്ത് മൈറ്റോകോണ്ട്രിയയിലെ പോർ രൂപമെടുത്തുകൊണ്ട് മിത്തോകോണ്ട്രിയൽ ഫ്യൂഷൻ സൈറ്റോപ്രൊറ്ററ്റീവ് ആണെന്ന് റിപ്പോർട്ടു ചെയ്യപ്പെട്ടിരിക്കുന്നു. കൂടാതെ, അപ്പോപ്പോസിസ്-ഇൻുഡീഷ്യർ, സ്റ്റോർരോസ്പോരിൻ എന്നിവയ്ക്ക് വിധേയമാക്കിയ എസ്.എഫ്.എൻ-ചികിത്സിച്ച സെല്ലുകളുടെ സ്രോതസ്സായ NRF2- സ്വതന്ത്രവും ഞങ്ങൾ കാണിക്കുന്നു. മെറ്റീരിയലിസമായി എസ്എഫ്എൻ, മിശ്ചോൻഡിയ, മയോകോർന്ഡ്രിയ തുടങ്ങിയ മലിനീകരണ അഴിച്ചുവിടൽ വസ്തുക്കളുടെ റിക്രൂട്ട്മെന്റ് / അല്ലെങ്കിൽ നിലനിർത്തൽ ലഘൂകരിക്കപ്പെടുന്നു. ഈ ഡാറ്റ തെളിയിക്കുന്നത് SFN ന്റെ ഗുണം, KEAP1-Nrf2-AR സിസ്റ്റം സജീവമാക്കുന്നതിന് അപ്പുറം, വിവിധ ഏജന്റുമാരുടെ പരീക്ഷകളിൽ ഈ ഏജന്റെ നിലവിലെ ഉപയോഗം കണക്കിലെടുത്ത് കൂടുതൽ ചോദ്യം ചെയ്യൽ വാറൻറ് നൽകുന്നു.

അടയാളവാക്കുകൾ: സുൽഫോപ്പാപേൻ, Nrf2, Drp1, മൈറ്റോകോണ്ട്രിയ, ഫിക്ഷൻ, ഫ്യൂഷൻ, അപ്പോപ്പോനോസിസ്

അവതാരിക

മിതോചോൻട്രിറിയൽ വിഭജനത്തിന്റെ Nrf2- ഇൻഡിപെൻഡൻറ് ഇൻഹെബിറ്റർ ആണ് സുൾഫോഫോഫെയ്ൻ

സുൽഫോപ്പാപാനെ (എസ്.എഫ്.എൻ) എന്നറിയപ്പെടുന്ന ഒരു ഐസോത്തോസിയോനറ്റ് സംയുക്തം. ഇത് സാധാരണയായി cruciferous പച്ചക്കറികളിൽ നിന്നുള്ളതാണ്. നശിച്ച സെല്ലുകളിൽ നിന്നുള്ള ഹൈഡ്രോലിറ്റിക് എൻസൈം മൈറോസിനാസിസിന്റെ വെസ്റ്റ്യൂക്കറുകളുടെ പ്രകാശനം മുഖേന ഉത്തേജനം ഒരു സീനബോട്ടിക് പ്രതികരണമായി സസ്യങ്ങളിൽ ഉൽപാദിപ്പിക്കപ്പെടുന്നു. ഈ എൻസൈം ഗ്ലൂക്കോസിനോളേറ്റുകളെ ഐസോതോയോസൈറ്റന്റ്സ് (56) ആയി പരിവർത്തനം ചെയ്യുന്നു. കഴിഞ്ഞ രണ്ട് ദശാബ്ദങ്ങളിൽ, SFN ന്റെ റിപ്പോർട്ട്, ആൻറിഓക്സിഡൻറും, ആൻറിഓക്സിഡൻറും, ആൻറിക് ക്രോബിയൽ വസ്തുക്കളും റിപ്പോർട്ട് ചെയ്തിട്ടുണ്ട്. ഈ ഫലപ്രാപ്തി വളരെ കൂടുതലായതിനാൽ SIPN ന്റെ ശേഷിക്ക് KEAP42-Nrf57-ആന്റിഓക്സിഡന്റ് പ്രതികരണ ഘടകം (ARE) സിഗ്നലിങ് പാത്ത്വേ മോഡുലാർഡിനെ ആധാരമാക്കിയുള്ളതായിരുന്നു, എന്നിരുന്നാലും കൂടുതൽ പ്രവർത്തനങ്ങൾ ഹിസ്റ്റോൺ ഡീസെറ്റിലൈസ് പ്രവർത്തനം, സെൽ സൈക്കിൾ പുരോഗമനത്തിനിടയാക്കൽ എന്നിവ ഉൾപ്പെടെയുള്ള പ്രവർത്തനങ്ങൾ കണ്ടെത്തുകയുണ്ടായി [ 1]. Nrf2 മാസ്റ്റര് ആന്റിഓക്സിഡന്റ് ട്രാന്സ്ക്രിപ്ഷന് കോര്പ്പറേറ്റും ഹോംസ്റ്റാസിസിനുണ്ടാകുന്ന അവസ്ഥകളുമാണ്, Culin29KEAP2 ubiquitin ലിഗേയ്സ് കോംപ്ലക്സില് [3] സൈറ്റിപ്ലാസ്മാസിക് പ്രവര്ത്തനത്തിലൂടെ അതിന്റെ സുസ്ഥിരത നിരുത്സാഹപ്പെടുത്തുന്നു. വ്യക്തമായും, ഡീമർഡിക് ഉപരിതല അഡാപ്റ്ററായ KEAP1 ലേക്ക് ബന്ധിപ്പിച്ചുകൊണ്ട് Nrf20, Cullin2KEAP3 ligase- ലേക്ക് റിക്രൂട്ട് ചെയ്യുന്നു, കൂടാതെ പ്രോട്ടോമാമിയം-മധ്യേയുള്ള ഡഗ്റാഡേഷനായുള്ള ട്രാൻസ്ക്രിപ്ഷൻ ഘടകം ലക്ഷ്യമാക്കിയുള്ള polyUb chains ഉപയോഗിച്ച് പരിഷ്കരിക്കപ്പെടുന്നു. ഈ കോൺട്രിബ്യൂട്ടിലെ വിറ്റുവരവ്, അൺസ്ട്റേഡഡ് സെല്ലുകളിലെ NRF1 ന്റെ അർദ്ധായുസ്സ് ~ 1 മിനിറ്റ് [2], [15], [30], [33] ആയി പരിമിതപ്പെടുത്തുന്നു. സമ്മർദ്ദം, ഏറ്റവും പ്രധാനപ്പെട്ടത് ഒക്സിദതിവെ സമ്മർദ്ദം നിരവധി തരം പ്രതികരണമായി, കെഅപ്ക്സനുമ്ക്സ, ഒരു മെത്തിയോണിൻ-സമ്പന്നമായ പ്രോട്ടീൻ, ഒരു രെദൊക്സ സെൻസർ പ്രവർത്തിക്കുന്നു, ഗുരുതരമായ ച്യ്സ്തെഇനെസ് എന്ന ഒക്സിദതിവെ പരിഷ്കരണത്തിന്, പ്രത്യേകിച്ച് ച്ക്സനുമ്ക്സ, കെഅപ്ക്സനുമ്ക്സ മൂലം ംര്ഫ്ക്സനുമ്ക്സ ശോഷണ തടയുന്നു ചുല്ക്സനുമ്ക്സ നിന്നും ംര്ഫ്ക്സനുമ്ക്സ-കെഅപ്ക്സനുമ്ക്സ ദിഷൊചിഅതെസ് [ 46], [55], [1]. പ്രത്യേകിച്ച്, SFN, കൂടാതെ മറ്റ് NFF151 ആക്റ്റിവേറ്റർമാർ, ഉദാഹരണത്തിന് KXAPXMLXXXXXXXX [1] മാറ്റുന്നതിലൂടെ ഓക്സിഡേറ്റീവ് സ്ട്രെസ്സ് അനുകരിക്കുകയാണ്. Nrf2- ന്റെ സ്ഥിരത അതിന്റെ അഡ്രസ്സിനെ ന്യൂക്ലിയസിന് സഹായിക്കുന്നു, ഇത് ഘട്ടം II ആന്റിഓക്സിഡന്റ്, ഡീലോക്സിഫിക്കേഷൻ ജീനുകളുടെ ഒരു ബാറ്ററി വെളിപ്പെടുത്തുന്നു. NFF1 ചെറിയ MAF പ്രോട്ടീനുകളുമായി heterodimerization വഴി അതിന്റെ തിരിച്ചറിഞ്ഞ ടാർഗെറ്റ് ജീൻസിന്റെ ആന്റിഓക്സിഡന്റ് പ്രതികരണ പ്രൊമോട്ടർ ഘടകങ്ങൾ (എആർ) ബന്ധിപ്പിക്കുന്നു. ഈ സിസ്റ്റം SFN പോലെയുള്ള പരോക്ഷമായ ആന്റിഓക്സിഡന്റുകൾ, മൈറ്റോകോണ്ട്രിയ (3), അല്ലെങ്കിൽ ഓക്സിഡേറ്റീവ് സമ്മർദ്ദത്തിന്റെ മറ്റ് ഫിസിയോളജിക്കൽ സ്രോതസ്സുകൾ [2] എന്നിവ നിർമ്മിച്ച ഫ്രീ റാഡിക്കലുകളെ ഒരു ചലനാത്മകവും സെൻസിറ്റീവ് പ്രതികരണവും നൽകുന്നു.

എപിപി ഉൽപ്പാദനം, ഇൻട്രാസെല്യൂലർ കാത്സ്യം ബഫറിങ്, റെഡോക്സ് റെഗുലേഷൻ, അപ്പോപ്പോസിസ് [13], [49] എന്നിവയിലെ സെല്ലുലാർ പ്രവർത്തനങ്ങൾ നിയന്ത്രിക്കുന്ന ഡൈനാമിക്, ഉപസൗലാർ ഓർഗൻസുകളാണ് മൈറ്റോകോണ്ട്രിയ. കോശത്തിനുള്ളിൽ പ്രതിപ്രവർത്തക ഓക്സിജൻ (റോസ്) ന്റെ മുഖ്യ ഉറവിടവും മിറ്റോക്രൊൻഡ്യയെ പ്രതിനിധാനം ചെയ്യുന്നു. അമിതമായ ഫ്രീ റാഡിക്കൽ ഉൽപാദനത്തിന്റെ ദോഷകരമായ പ്രത്യാഘാതങ്ങളെ ലഘൂകരിക്കുന്നതിനിടയിൽ തന്നെ സെല്ലുലാർ ആവശ്യങ്ങൾ നിറവേറ്റുന്നതിനായി എ.ടി.പി. ഉൽപ്പാദനം മെച്ചപ്പെടുത്തുന്നതിന് മൈറ്റോകോണ്ട്രിയൽ പ്രവർത്തനത്തിന്റെ ശരിയായ നിയന്ത്രണം ആവശ്യമാണ്. മൈറ്റോകോണ്ട്രിയയുടെ മികച്ച മോഡുലേഷനു വേണ്ടി ഒരു നിർണ്ണായക ഘടകം മൈറ്റോകോണ്ട്രിയയ്ക്ക് സ്വതന്ത്രമാവുക, ബയോകെമിക്കൽ മെഷീനുകൾ പോലെ വിശാലവും പ്രതികരിക്കുന്നതുമായ ഒരു നെറ്റ് വർക്കിന്റെ ഭാഗമാണ്.

മിറ്റനോചോണ്ട്രൽ ശൃംഖലയുടെ രൂപവത്കരണവും പ്രവർത്തനവും അണുവിഭജനവും കൂടിച്ചേരലും തമ്മിലുള്ള ഒരു നിയന്ത്രിത ബാലൻസാണ്. സെൽ ഡിവിഷൻ [28] സമയത്ത് മൈറ്റോകോണ്ട്രിയ മകളുടെ സെല്ലിൽ മൈറ്റോകോണ്ട്രൈരിയൽ വിച്ഛേദനം നടത്തുന്നു. അതുപോലെ തന്നെ മൈടോപ്പൊണ്ടരിയയുടെ അവശിഷ്ടവസ്തുക്കളോ, നശിച്ചതോ ആയ മൈറ്റോകോണ്ട്രിയയുടെ തിരഞ്ഞെടുത്ത, സ്വയംഭ്രമ തകരാറുമൂലം, മൈമോഫോഗി [1] എന്നാണ് വിളിക്കുന്നത്. അതുപോലെ, mitochondrial genomes നിറയ്ക്കുകയും അയൺ മെക്കോൺഡ്ഡ്രറിയ [54] തമ്മിൽ ഇലക്ട്രോൺ ട്രാൻസ്പോർട്ട് ശൃംഖല ഘടകങ്ങൾ പങ്കുവയ്ക്കുകയും വേണം. തന്മാത്രയിൽ, mitochondrial fission, കൂടിച്ചേരലുകളെ വലിയ, ഡൈനാമിൻ പോലുള്ള GTPases നിയന്ത്രിക്കുന്നു. മൂന്ന് എൻസൈമുകൾ പ്രാഥമികമായി ഫ്യൂഷൻ നിയന്ത്രിക്കുന്ന: മിതൊഫുസിംസ് ക്സനുമ്ക്സ ആൻഡ് ക്സനുമ്ക്സ (മ്ഫ്ന്ക്സനുമ്ക്സ / ക്സനുമ്ക്സ) പുറം സ്തര ഫ്യൂഷൻ ഹെതെരൊത്യ്പിച് ഇടപെടലുകൾ വഴി,,, സമീപമുള്ള മൈറ്റോകോണ്ട്രിയകളില്ലാതെ തമ്മിലുള്ള മധ്യസ്ഥത വഹിക്കാൻ ആ [ക്സനുമ്ക്സ] [ക്സനുമ്ക്സ] ഒപക്സനുമ്ക്സ ഒരു ആന്തരിക തന്നെ [ക്സനുമ്ക്സ] രണ്ട്-പാസ് പുറത്തെ സ്തര പ്രോട്ടീൻ ആകുന്നു മെംബ്രെൻ പ്രോട്ടീൻ ആന്തരിക ചക്രത്തിന്റെ melding നിയന്ത്രിക്കുന്നതിലൂടെ മാട്രിക്സ് കണക്റ്റിവിറ്റി ഉറപ്പാക്കുന്നു [1]. പ്രോട്ടീനുകൾ OMA2 [1], PARL [2], YME15 [25] എന്നിവ ഉപയോഗിച്ച് mitochondrial inner membrane ൽ സങ്കീർണ്ണ പ്രോട്ടൊളിസിക്കും കൂടുതൽ പ്രോട്ടീനുകൾക്കായി മൂന്ന് പ്രോട്ടീനുകളുടെ GTPase പ്രവർത്തനം ആവശ്യമാണ്. ]. നാശമുണ്ടാക്കുന്നതും ആരോഗ്യമുള്ളതുമായ മൈറ്റോകോണ്ട്രിയ [37] സംയോജിപ്പിച്ച് അടച്ചുപൂട്ടുന്നതിനായി കാര്യക്ഷമമായ മിനുട്ടുകൾക്ക് പ്രധാനമായും മൈറ്റോകോണ്ട്രിയൽ മെംബ്രൻ സാധ്യത ആവശ്യമാണ്.

ഡൈമിയം സംബന്ധിയായ പ്രോട്ടീൻ 1 (Drp1 / DNM1L) എന്ന സൈടോസോളിക് പ്രോട്ടീന്റെ മിറ്റോചോൻട്രിറിയൽ വിഘടനം പ്രധാനമായും ഉൽപ്രേരകമായിരിക്കുന്നു. സൈറ്റോസോൾ മുതൽ മൈറ്റോകോണ്ട്രിയൽ സ്പ്രേ മെംബറേൻ [1] ന് വിഘടിപ്പിക്കാനുള്ള സാധ്യതയുള്ള സൈറ്റുകളിലേക്ക് Drp43 റിക്രൂട്ട് ചെയ്യുന്നു. പുറം പാളികളിൽ ഡോക്സ്.എക്സ്.എൻ.എൻ.എക്സ്.എസിന്റെ പ്രധാന വാതകം മൈറ്റോകോണ്ട്രിയൽ വിഘടകം ഘടകം (MFF) [1], ഒരു പരിധി വരെ, ഫിക്ഷൻ 32 (Fis1) [1]. കൂടാതെ, ഒരു ഡ്രോയ്ലോ റിസപ്റ്റർ, MIEF51 / MiD1, സാധ്യതയുള്ള വിള്ളൽ സൈറ്റുകളിൽ Drp51 പ്രോട്ടീൻ പ്രവർത്തനം കൂടുതൽ പരിമിതപ്പെടുത്താൻ പ്രവർത്തിക്കുന്നു [1]. Mitochondrial extern membrane ൽ വലിച്ചെടുത്തു കഴിഞ്ഞാൽ, mitochondrion ശരീരത്തിനു ചുറ്റുമുള്ള സർപ്പിളാകൃതിയുള്ള ഘടനകളിലേക്ക് Drp58 ഒളിഗോ നൽകി, തുടർന്ന് Mitochondrial exterior and inner membranes [1] ന്റെ ശാരീരിക വിസർജ്ജനം മധ്യസ്ഥമാക്കാൻ ജിടിപി ജലവൈദ്യുതത്തിൽ നിന്ന് ഊർജ്ജം പ്രയോജനപ്പെടുത്തുന്നു. Endoplasmic reticulum-derived tubules Drp17 oligomerization മുൻപ് mitochondria ഒരു പ്രാരംഭ കോൺട്രാക്ടറായി പ്രവർത്തിക്കുന്നു, ഒരു പൂർണ്ണമായ Drp1 സർപ്പിളാകൃതിയിലുള്ള [1] എന്ന പെർസിസീവ് ചുറ്റളവിൽ കൂടുതൽ സങ്കീർണ്ണമല്ലാത്ത മൈറ്റോകോണ്ട്രിയ വെളിപാടിനെ അടിവരയിടുന്നു. മൈക്കോൺ ഓണ്ടോർറിയൽ വിച്ഛേദത്തിനു മുമ്പുള്ള ER-mitochondria പരസ്പര പ്രവർത്തനങ്ങൾക്ക് ആക്ടിൻ ഡൈനാമിക്സും പ്രാധാന്യമുണ്ട്. മൈറ്റോകോണ്ട്രിയൽ വിഘടത്തിൽ ഇതിന് പുറമേ, Drx12 പെറോക്സിസോമുകളുടെ അണുവിഭജനം [24] ഉത്തേജിപ്പിക്കുന്നു.

ഡിപ്പാർഎൻഎൻഎൻഎക്സ്എക്സ് വളരെ നന്നായി അറിയപ്പെടുന്ന ഡൈനാമിൻ പ്രോട്ടീനിനോട് വളരെ സാമ്യമുള്ളതാണ്. പ്രോട്ടീനുകളിൽ ഒരു എൻ-ടെർമിനൽ GTPase ഡൊമെയിൻ, സ്വയം-ഒളിഗോമേസറൈസേഷൻ നിർണയിക്കുന്ന ഒരു മധ്യ ഡൊമെയിൻ, ഒരു C- ടെർമിനൽ GTPase ഫലപ്രാപ്തി ഡൊമെയ്ൻ [1] എന്നിവ അടങ്ങിയിട്ടുണ്ട്. മരുന്നുകണ്ട് പ്രോട്ടീൻ Mff, FXXXX എന്നിവയുമായുള്ള ആശയവിനിമയത്തിലൂടെയും മൈറ്റോകോണ്ട്രിയ-പ്രത്യേക ഫോസ്ഫോലൈപ്പിഡ് കാർഡിലൈപിപിന് പ്രത്യേകതയായ Drp31 [1] ന്റെ ബി-ഇൻസൈറ്റ് ഡൊമൈൻസിലൂടെയും മൈറ്റോകോണ്ട്രിയൽ ചർമ്മത്തിന് മിശ്രണം ചെയ്യാൻ സാധിക്കുന്നു. സൈലപ്പൊലിമത്തിൽ ഹോർമോട്രേമറായും സാധാരണയായി Drp1 നിലവിലുണ്ട്. മിറ്റോക്രൊഡിയൽ വിള്ളൽ സൈറ്റുകളിൽ ഉയർന്ന ഓർഡർ സമ്മേളനം മധ്യസ്ഥത വഹിക്കുന്നത് Drp1 [2].

Mitochondrial ഫംഗ്ഷനും KEAP1-Nrf2-path pathway- ഉം തമ്മിലുള്ള ഊഷ്മള ബന്ധം ഞങ്ങൾ mitochondrial ഘടനയിലും പ്രവർത്തനത്തിലും Nrf2 സജീവമാക്കൽ ഫലങ്ങൾ അന്വേഷിച്ചു. SFN mtrchondrial hyperfusion പ്രോത്സാഹിപ്പിക്കുന്നതായി ഞങ്ങൾ ഇവിടെ തെളിയിക്കുന്നു, അത് അപ്രതീക്ഷിതമായി, NRF2, KEAP1 എന്നിവയിൽ നിന്ന് സ്വതന്ത്രമാണ്. SFN ന്റെ ഈ പ്രഭാവം, Drp1 ഫംഗ്ഷന്റെ ഒരു തടസ്സം ആണ്. ഞങ്ങൾ കൂടുതൽ SFN Nrf2- സ്വതന്ത്ര അപ്പോളോടോസിസ് പ്രതിരോധം നൽകുന്നു തെളിയിക്കുന്നു Drp1 ന്റെ ചോർന്നു സെല്ലുകളിൽ നിരീക്ഷിച്ച അനുയായികളും. Nrf2 സ്ഥിരപ്പെടുത്തുന്നതിനും ആക്ടിവേറ്റ് ചെയ്യുന്നതിനും പുറമെ, SFN mitochondrial dynamics മോഡുലേറ്റ് ചെയ്യുന്നു, ഒപ്പം സെല്ലുലാർ ഫിറ്റ്നസും നിലനിൽപ്പിനെ സംരക്ഷിക്കുന്നുവെന്നും ഈ ഡാറ്റ കൂട്ടിച്ചേർക്കുന്നു.

ഫലം

മൗണ്ട്ചോണ്ട്രറിയയുടെ സുൽഫോ പോപ്പാന ഇൻസുഷ്യൻസ് Nrf2 / KEAP1- സ്വതന്ത്ര-ഹൈപ്പർഫ്യൂഷൻ

Mitochondrial network dynamics ന് Nrf2 ആക്റ്റിവേഷന്റെ പ്രഭാവം പഠിക്കുന്ന കാലത്ത്, സൾഫോറഫാൻ (എസ്എഫ്എൻ) ഉപയോഗിച്ച് അനശ്വരമായ മനുഷ്യ റെറ്റിനൽ പിഗ്മെന്റ് എപിടെൽഹൽ (ആർപിഎഫ്എൻഎൻഎക്സ്) സെല്ലുകളുടെ ചികിത്സ, Nrf1 സിഗ്നലിംഗിന്റെ ശക്തമായ ഒരു ആക്റ്റേറ്റർ, വാഹന ചികിത്സ നിയന്ത്രിക്കുന്ന സെല്ലുകളുമായി താരതമ്യം ചെയ്യുമ്പോൾ മൈറ്റോകോണ്ട്രിയൽ ശൃംഖല (ചിത്രം, 2A, B). ഈ കോശങ്ങളിലെ മൈറ്റോകോണ്ട്രിയയുടെ രൂപവൽക്കരണം, മൈറ്റോകോണ്ട്രിയയിലെ മൈറ്റോകോണ്ട്രിയയിൽ നിന്നുണ്ടായ ആകർഷണീയതയാണ്. മൈറ്റോകോൺട്രിറിയൽ വിഘടകം മൂലകമാണ് (ചിത്രം ചിത്രം). ഈ ഫലകം mitochondrial fission ആൻഡ് fusion നില നേരിട്ട് സെല്ലിൽ Nrf1 നിലകളോട് പ്രതികരിക്കുന്നതെന്ന് മനസിലാക്കുന്ന ആശയം ഉയർത്തി. എന്നിരുന്നാലും, മറ്റ് Nrf1 സ്റ്റെബിലൈസറുകൾക്കും സെല്ലുകൾ പ്രോമിസോം ഇൻഹൈടൈറ്റർ MG1, പ്രോ-ഓക്സീഡിന്റ് TBHQ, അല്ലെങ്കിൽ Nrf2 ഇൻഹിനിറ്റർ കെഎപിഎക്സ്എക്സ്എക്സ്എക്സ് എന്ന നോക്ക്ഡൗണും മൈറ്റോകോണ്ട്രിയൽ ഫ്യൂഷൻ (ചിത്രം, 2A, B) ഉൾപ്പെടുത്തിയില്ല. എൻറോഫ്എൻഎൻഎൻഎക്സ്എക്സ്എക്സ്എക്സ്എക്സ്എക്സ്എൻഎക്സ്എക്സ്എക്സ് പാശ്ചാത്യപ്രയോഗത്തിലൂടെ ഈ എൻക്രിപ്ഷനുകൾ വഴി Nrf132 എന്ന സ്ഥിരത ഉറപ്പിക്കപ്പെട്ടു. Nrf2 (ചിത്രം 1C). ഇതിനുപുറമെ, SFN- ഇന്ധന മൈറ്റോകോണ്ട്റാരിയൽ ഫ്യൂഷൻ (NFF1) ഉപയോഗിച്ച് എൻറോഫ്നസ് എൻർഫ്എക്സ്എൻഎക്സ്എക്സ് എന്ന എൻക്യാഡൻഡിനെ siRNA ഉപയോഗിച്ച് പരാജയപ്പെടുത്തിയതിനാൽ Nrf2 എന്ന പ്രയോഗം അനുവദിക്കാതിരുന്നത് (ചിത്രം 2D-F). SFN കെഅപ്ക്സനുമ്ക്സ [ക്സനുമ്ക്സ] എന്ന മെത്തിയോണിൻ ശേഷിപ്പുകൾ ചൊവലെംത്ല്യ് മാറ്റം കെഅപ്ക്സനുമ്ക്സ-ംര്ഫ്ക്സനുമ്ക്സ-ആകുന്നു പാതയോരങ്ങൾ ഉത്തേജിപ്പിക്കുന്നു, ഞങ്ങൾ SFN വ്യതിയാനം മൈറ്റോകോൺട്രിയൽ ഹ്യ്പെര്ഫുസിഒന് ഒരു കെഅപ്ക്സനുമ്ക്സ-ആശ്രിത വഴി ഉത്തേജിതനായി എന്ന് അഭിസംബോധന കെഅപ്ക്സനുമ്ക്സ മറിഞ്ഞ് എന്നാൽ ംര്ഫ്ക്സനുമ്ക്സ സ്വതന്ത്ര ശിഷ്യത്വത്തിന്റെ. എന്നിരുന്നാലും, കെഎഎപിഎക്സ്എൻഎക്സ്എക്സിൻറെ അപദ്രവും എസ്.എഫ്.ഇ.-ഉദ്വമന മൈറ്റോകോണ്ട്രിയൽ ഫ്യൂഷൻ (ചിത്രം. 1G-I) റദ്ദാക്കാൻ പരാജയപ്പെട്ടു. വാസ്തവത്തിൽ, SFN, KEAP2 ന്റെ തകരാറിലായ പ്രോ-ഫൈഷൻ പദാർത്ഥത്തെ തിരുത്തി (ചിത്രം, 2G, പാനൽ ബ്യൂട്ട് പാനൽ ഡി). ഈ ഫലങ്ങൾ സൂചിപ്പിക്കുന്നത് SFN ചികിത്സ കാനോനിക്കൽ KEAP1-Nrf1- ന്റെ പാതയിലൂടെ സ്വതന്ത്രമായി മൈറ്റോകോണ്ട്രിയൽ ഫ്യൂഷൻ ഉണ്ടാക്കുന്നു എന്ന് മാത്രമല്ല, mitochondrial fission അല്ലെങ്കിൽ fusion യന്ത്രങ്ങളുടെ ഘടകങ്ങളെ SFN നേരിട്ട് ബാധിക്കുമോ എന്ന് ചോദ്യം ചെയ്യാൻ നമ്മെ പ്രേരിപ്പിച്ചു.

ചിത്രം 1 SFN Nrf2 / KEAP1- സ്വതന്ത്ര മൈറ്റോകോണ്ട്റാരിയൽ സംയോജനം നൽകുന്നു. (എ) RPE-1 സെല്ലുകൾ സൂചിപ്പിച്ച siRNA- കൾ ഉപയോഗിച്ച് ട്രാൻസ്ഫോർൺ ചെയ്തു, കൂടാതെ DNSO അല്ലെങ്കിൽ NFF3 ആക്റ്റേറ്റർമാർ SFN (2 μM), MG50 (132 മമ്മീ), അല്ലെങ്കിൽ TBHQ (10 μM) 100 മണിക്കൂറിനുള്ളിൽ ചികിത്സിക്കുകയും ചെയ്തു. മൈറ്റോകോണ്ട്രിയ (ചുവപ്പ്) ഒരു ടോം ആന്റി-വൈൻ ആന്റിബോഡി ലേബൽ ചെയ്തിരിക്കുന്നു, അണുകേന്ദ്രം (നീല) DAPI മായി പ്രതിബന്ധം ഉള്ളവയാണ്. (ബി) (എ) ൽ നിന്ന് മൈറ്റോകോൺഡിയൽ മോർഫോളജി സ്കോറിന്റെ അളവ് കാണിക്കുന്ന ഗ്രാഫ്. > ഒരു അവസ്ഥയായുള്ള 4 സെല്ലുകൾ അന്ധമായ ഒരു ഫാഷനിൽ വിലയിരുത്തപ്പെട്ടു. (സി) പ്രതിനിധിയുടെ പടിഞ്ഞാറൻ ബ്ലോക്കുകൾ (എ). (ഡി) RPE-20 സെല്ലുകൾ 50 nM siRNA നും 1 ദിവസങ്ങൾക്കു ശേഷം (എ) ഉള്ളിടത്തോളം ഫിക്സഡ് ചെയ്യപ്പെടുന്നതിന് മുമ്പും 10 മണിക്കൂർ SFN- നുമായി ചികിത്സിക്കുകയും ചെയ്തു. (ഇ) (എം) ൽ നിന്ന് മൈോമോൺ ഫോണ്ടൈറ്റ് സ്കോററിൻറെ അളവ് കാണിക്കുന്ന ഗ്രാഫ്. > ഒരു അവസ്ഥയായുള്ള 3 സെല്ലുകൾ അന്ധമായ ഒരു ഫാഷനിൽ വിലയിരുത്തപ്പെട്ടു. (ഡി) ൽ നിന്നുള്ള പ്രതിനിധിയുടെ പടിഞ്ഞാറൻ ഭാഗങ്ങൾ. (ജി) സെല്ലുകൾ ട്രാൻസ്ഫിക്കേറ്റ് ചെയ്തു (ഡി) siCON അല്ലെങ്കിൽ siKEAP4 ഉപയോഗിച്ച് കൈകാര്യം ചെയ്തു. (ജി) സെൽ (ജി) മുതൽ സെൽ (ബി), (ഇ) മുതലായവ മൈറ്റ് ടോണ്ടിയൽ മോർഫോളജി അടിസ്ഥാനമാക്കി. (I) പ്രതിനിധി പടിഞ്ഞാറൻ ബ്ലോക്കുകൾ (ജി). 100 സ്വതന്ത്ര പരീക്ഷണങ്ങളിൽ നിന്ന് (ബി), (ഇ), (എച്ച്) എന്നിവയിലെ ഡാറ്റ ഓരോന്നും രണ്ടു-ടെയിൽ വിദ്യാർത്ഥിയുടെ ടി-ടെസ്റ്റ് നിർണ്ണയിച്ചിട്ടുണ്ട്. പിശക് ബാറുകൾ പ്രതിഫലിപ്പിക്കുന്നത് +/- SD (ഈ ചിത്രം ലെജൻഡിൽ വർണ്ണത്തെ പരാമർശിക്കുന്നതിന്റെ വ്യാഖ്യാനത്തിനായി വായനക്കാരനെ ഈ ലേഖനത്തിന്റെ വെബ് വേർഷനായി പരാമർശിക്കുന്നു).

സുൽഫോരോഫെയ്ൻ അപകടം കാരണം മൈറ്റോകോണ്ട്രിയൽ അസോസിയേഷൻ Drp1

SFN- ചികിത്സ മൈറ്റ് ടോണ്ടിയൽ ഹൈപ്പർഫ്യൂഷനെ ഉദ്ദീപിപ്പിക്കുമെന്ന് കണ്ടെത്തിയതിനെ അടിസ്ഥാനപ്പെടുത്തിയുള്ളതിനാൽ, ഈ പ്രകടനം ഒന്നുകിൽ അമിതമായ ഫ്യൂഷൻ പ്രവർത്തനത്തിന്റെ ഫലമോ അല്ലെങ്കിൽ ഉത്തേജക പ്രവർത്തനങ്ങളുടെ തടസ്സമോ ആയിരുന്നെന്ന് ഞങ്ങൾ വിശദീകരിച്ചു. ഈ രണ്ടു സാധ്യതകൾ തമ്മിലുള്ള വിവേചനത്തിന്, SFN ന്റെ സാന്നിധ്യത്തിലും അഭാവത്തിലും പെറോക്സിസ്മോമുകളുടെ രൂപവത്കരണത്തെ ഞങ്ങൾ താരതമ്യപ്പെടുത്തി. മൈറ്റോകോണ്ട്രിയയ്ക്ക് സമാനമാണ് പെറോക്സിസോമുകൾ. ചലനാത്മക അവയവങ്ങളുടെ ആകൃതിയും നീളവും നിരന്തരം [JNUMX] ആയിരിക്കും. പെക്പോസിസോമുകളിൽ FIS44 ഉം MFF ഉം അവയുടെ പുറം പാളികളിൽ അടങ്ങിയിട്ടുണ്ട്, അതിന്റെ ഫലമായി, Drp1- മധ്യസ്ഥിത വലയത്തിനുള്ള [1], [22] ലക്ഷ്യം. എന്നിരുന്നാലും, പെറോക്സിസോம்கள் മൈറ്റ്ചോണ്ട്രൽ ശൃംഖലയുടെ ഫ്യൂഷൻ യന്ത്രത്തെ പ്രയോജനപ്പെടുത്തുന്നുമില്ല, അതിനാൽ, കോശങ്ങൾ നശിക്കുന്നു [23]. പകരം, പെറോക്സിസോമോസിന്റെ ദീർഘവീക്ഷണത്തോടൊപ്പം സ്കോറോസ് പ്രോട്ടീനുകൾക്കും പ്രോട്ടീനുകൾക്കും പുറമേ, പെറോക്സൈസോമൽ വിഘടനം എതിർക്കുന്നു. പെൻസോസോമുകളിൽ Mfn39 / 44 ഉം OPAXNUM ഉം കുറവുള്ളതിനാൽ, FF യന്ത്രത്തെ തടയുന്നതിനേക്കാൾ SFN ഫ്യൂഷൻ യന്ത്രത്തെ സജീവമാക്കുന്നുവെങ്കിൽ, പെറോക്സിസോം ദൈർഘ്യം ബാധിക്കില്ല. വാഹകരെ ചികിത്സിക്കുന്ന സെല്ലുകളിൽ പെറോക്സിസോമുകൾ ഹ്രസ്വ, റൗണ്ട്, പാൻഡിഫോം ഓർഗെനുകൾ (ചിത്രം 1, പാനലുകൾ ബി, ഡി) ആയി സൂക്ഷിക്കുന്നു. എന്നിരുന്നാലും SFN ചികിത്സ നിയന്ത്രിക്കുന്ന സെല്ലുകളെ അപേക്ഷിച്ച് ~ 2- മടങ്ങ് പെരോക്സിസോം ദൈർഘ്യം വർദ്ധിപ്പിച്ചു (ചിത്രം, 1, പാനലുകൾ എഫ്, എച്ച്). കൂടാതെ, നിരവധി പെറോക്സിസോമുകൾ കേന്ദ്രത്തിനു സമീപം നുണഞ്ഞിരുന്നു, ഇത് സാധ്യതയുള്ള സ്പിഷൻ ഡിസ്പ്ലേ (ചിത്രം 2, പാനൽ എച്ച്, അമ്പടയാളങ്ങൾ) സൂചിപ്പിക്കുന്നു. അതുപോലെതന്നെ, കോശങ്ങളിലെ പെറോക്സിസോമുകൾ അപര്യാപ്തമായി നീണ്ടുനിൽക്കുന്നതാണ് (ചിത്രം 2, പാനലുകൾ ജെ, എൽ), പെറോക്സൈസോമൽ വിഘടനത്തിന് Drp2 ആവശ്യമാണ്, എസ്.എഫ്.എൻ-ചികിത്സ മൈറ്റോകോൺട്രിറിയൽ ആൻഡ് പെറോക്സിസ്മോമൽ ഫിനോട്ടിപ്പുകൾക്ക് അണുവിഭജന സംവിധാനത്തെ തടസപ്പെടുത്തുന്നുവെന്നും നിർദേശിക്കുന്നു.

ചിത്രം 2 SFN, പെലോക്സൈസോമൽ നീണ്ട് നിർത്തുന്നു. (എ) RPE- 1 സെല്ലുകൾ സൂചിപ്പിക്കപ്പെട്ട siRNA ന്റെ 10 nM- നും 3 ദിവസങ്ങൾക്കു ശേഷം DMSO അല്ലെങ്കിൽ 50 μM SFN നും 4 h നും ചികിത്സിക്കാം. പെറോക്സിസോമുകൾ (പച്ച) ഒരു പിഎംഎക്സ്എക്സ്എക്സ്എക്സ്എക്സ് ആൻറിബോഡി, മൈറ്റോകോണ്ട്രിയ മൈടോ ട്രാക്കർ (ചുവപ്പ്), ഡി.എൻ.എ. SFN, Drp70 ഡിപ്രെഷൻ എന്നിവയിൽ ഉണ്ടാകുന്ന രൂപമാറ്റങ്ങളുടെ ദൃശ്യവൽക്കരണം സുഗമമാക്കുന്നതിനായി വലതുഭാഗത്ത് (പാനലുകൾ d, h, l) പെറോക്സിസോമെസിന്റെ വിപുലീകൃത ഇൻസെറ്റുകൾ കാണിക്കുന്നു. അമ്പടയാളങ്ങൾ ഹൈലൈറ്റ് കൺസ്ട്രക്ഷൻ പോയിന്റുകൾ ഹൈലൈറ്റ് ചെയ്യുന്നു. (ഈ ഐതിഹാസത്തിൽ നിറം സൂചിപ്പിക്കുന്ന വ്യാഖ്യാനങ്ങളുടെ വ്യാഖ്യാനത്തിനായി വായനക്കാരനെ ഈ ലേഖനത്തിന്റെ വെബ് വേർഷനായി പരാമർശിക്കുന്നു).

SFN എങ്ങനെയാണ് Drp1 ഫംഗ്ഷൻ നിയന്ത്രിക്കുന്നത് എന്ന് ഞങ്ങൾ അടുത്തതായി നിശ്ചയിച്ചു. സാധ്യതകൾ സൂചികയിൽ കുറവുണ്ടാകൽ, മൈറ്റോകോണ്ട്രിയയിലെ റിക്രൂട്ട്മെന്റ് / നിലനിർത്തൽ, ഒളിഗോമറൈസേഷൻ അല്ലെങ്കിൽ ജിടിപിസിയുടെ എൻസൈം പ്രവർത്തനം തുടങ്ങിയവ ഉൾപ്പെടുന്നു. ഇവയിൽ ഒരെണ്ണത്തിലോ ഉണ്ടാകുന്ന കുറവ് മൈറ്റോകോണ്ട്രിയൽ പിളിക്കലും ഹൈപ്പർഫ്യൂഷനും കുറയ്ക്കും. SFN ചികിത്സ (അത്തിപ്പഴം, 1C, 1A) ശേഷം DrpxNUMX പ്രോട്ടീൻ തലങ്ങളിൽ പുനരുൽപാദിപ്പിക്കുന്ന മാറ്റങ്ങൾ കണ്ടെത്താനായില്ല, അതിനാൽ SFN, Drp3 സ്ഥിരത അല്ലെങ്കിൽ എക്സ്പ്രഷനെ മാറ്റാൻ തയ്യാറായില്ല, ഞങ്ങളുടെ എസ്എഫ്എൻ ചികിത്സാരീതികൾ ചെറിയ കാലദൈർഘ്യമുള്ളതാണ്. അടുത്തതായി, എസ്.എഫ്.എൻ. എംപ്ലോൻട്രിയയിലേക്കുള്ള ഡ്രാഫ്റ്റ് 1 ന്റെ റിക്രൂട്ട്മെന്റ് അല്ലെങ്കിൽ നിലനിർത്തൽ ബാധിച്ചോ എന്ന് ഞങ്ങൾ അന്വേഷിച്ചു. Fractionation studies SFN mitochondrial അംശം (ചിത്രം, 1A, പാതകൾ, 10- 50, ചിത്രം, 1B) മുതൽ Drp1 നഷ്ടം ഉണ്ടാക്കി. മുൻപ് [3] റിപ്പോർട്ട് ചെയ്ത സൈറ്റോപ്ലാസ്മിലെ മിക്ക എൻസൈമുകളോടും സ്ഥിരസ്ഥിതി അവസ്ഥയിൽ മൈറ്റോകോണ്ട്രിയൽ നെറ്റ്വർക്കിന് (~ 7%) ഒരു ചെറിയ ഭാഗം മാത്രം ബന്ധപ്പെട്ടിരിക്കുന്നു. (ചിത്രം, ചൊവ്വാഴ്ച്ച, 8- 3 ). ഈ ഫ്രാബേസേഷൻ ഡാറ്റകൾ സഹ-ലോക്കലൈസേഷൻ വിശകലനം ഉപയോഗിച്ച് സ്ഥിരീകരിച്ചു, ഇത് എസ്.ടി.എൻ-ചികിത്സയ്ക്കു ശേഷം മൈടോൺചോണ്ട്ര-ലോക്കലൈസേഷൻ, പിങ്ക്റ്റേറ്റ് Drp43 foci (~ 1C, D) ശേഷം ~ 3% കുറവ് കാണിക്കുന്നു. ഈ കണക്കുകൾ സൂചിപ്പിക്കുന്നത് SFN പ്രേരണയായ mitochondrial ഫ്യൂഷൻ കുറഞ്ഞത് ഭാഗികമായെങ്കിലും, മൈറ്റോകോണ്ട്രിയയിലെ Drp3 ന്റെ attenuated association കാരണം. തൽസമയ സെൽ മൈക്രോസ്കോപി വഴി GTPase ദൃശ്യവത്ക്കരിക്കാനുള്ള എക്സോഗൻസസ് DRP5 അപര്യാപ്തമായതിനാൽ, SFN മൈറ്റോകോണ്ട്രൽ റിക്രൂട്ട്മെന്റും മൈറ്റോകോണ്ട്രിയൽ റിക്രൂട്ട്മെന്റിനും മൈറ്റോകോണ്ട്രൽ റിക്രൂട്ട്മെന്റിനും മൈറ്റോകോൺഡിരിയൽ നിലനിർത്തണോ എന്നതിനെക്കുറിച്ചും ഞങ്ങളുടെ ഡാറ്റ തിരിച്ചറിയുന്നില്ല.

ചിത്രം 3 SFN mitochondria നിന്ന് Drp1 ഒരു നഷ്ടം കാരണമാകുന്നു. (എ) DMSO അല്ലെങ്കിൽ SFN ന്റെ 1 h താഴെ പറയുന്ന RPE-4 സെല്ലുകളുടെ സബ്സില്ലൂൾ ശൃംഖല. പൂർണ്ണ-സെൽ lysates (WCL), ആണവ (Nuc), സൈറ്റോസോളിക് (സൈറ്റോ), ഒപ്പം ക്രൂഡ് മൈറ്റോക്രൊൻഡ്യൽ (മിറ്റോ) ഘടകങ്ങൾ SDS-PAGE വഴി പരിഹരിച്ചിരിക്കുന്നു, കൂടാതെ സൂചിപ്പിക്കപ്പെട്ട ആന്റിബോഡികളുമായി പാശ്ചാത്യ blotting പ്രോസസ്സ് ചെയ്തു. മോളിക്യുലാർ വെയ്റ്റ് മാർക്കറുകളുടെ മൈഗ്രേഷൻ ഇടതുവശത്ത് സൂചിപ്പിക്കുന്നു. (ബി) (എ) നിന്നുള്ള നിർദിഷ്ട ഘടകങ്ങളിൽ Drp1 densitometric അളവ് കാണിക്കുന്ന ഗ്രാഫുകൾ. (സി) RPE-1 സെല്ലുകൾ 10 nM siCON അല്ലെങ്കിൽ siDrp1, 3 ദിവസങ്ങൾക്ക് ശേഷം DMSO അല്ലെങ്കിൽ SFN ഉപയോഗിച്ച് 4 h വരെ ചികിത്സിച്ചു. Drp1 (പച്ച) ഒരു anti-Drp1 ആൻറിബോഡി, മൈടോട്രാക്കർ ഉപയോഗിച്ച് മൈറ്റോകോണ്ട്രിയ (ചുവപ്പ്), ഒപ്പം DAPI (നീല) ഉള്ള അണുകേന്ദ്രങ്ങളോടൊത്ത് ദൃശ്യമായിരുന്നു. (ഡി) (D) മുതൽ Drp1, MitoTracker സിഗ്നലിന്റെ ഓട്ടോമാറ്റിക് കോ-ലോക്കൽ വ്യാഖ്യാന വിശകലനം. (ബി), (ഡി) എന്നിവയിലെ ഡാറ്റ യഥാക്രമം, 3, 5 സ്വതന്ത്ര പരീക്ഷണങ്ങളിൽ നിന്നും സമാഹരിച്ചതാണ്, കൂടാതെ രണ്ട് തരത്തിലുള്ള വിദ്യാർത്ഥികളുടെ ടി-ടെസ്റ്റ് കണക്കുകൂട്ടുന്നു. പിശക് ബാറുകൾ +/- എസ്ഡികളും ആസ്റ്ററിക്സുകളും പ്രതിഫലിപ്പിക്കുന്നത് സ്റ്റാറ്റിസ്റ്റിക്കൽ പ്രാധാന്യത്തെ സൂചിപ്പിക്കുന്നു. (ഈ ഐതിഹാസത്തിൽ നിറം സൂചിപ്പിക്കുന്ന വ്യാഖ്യാനങ്ങളുടെ വ്യാഖ്യാനത്തിനായി വായനക്കാരനെ ഈ ലേഖനത്തിന്റെ വെബ് വേർഷനായി പരാമർശിക്കുന്നു).

സുൽഫോരോപ്പനെ കോൺഫെൻസ് പ്രൊട്ടക്ഷൻ എസ്റ്റാത്ത് സ്റ്റെറോസ്പോർടിൻ-ഇൻഡുഡ് അപ്പോപ്പോട്ടസിസ് ഇൻഡിപെൻഡന്റ് ഓഫ് എൻഫ്രക്സ്എക്സ്എക്സ്എക്സ്

അപ്പൂപ്പൊസിസ് [11] സമയത്ത് ബക്സസ് / ബാകിന്റെ ഉൽപാദിപ്പിക്കുന്ന പുറം മൈറ്റോകോണ്ട്രൽ മെംബറേൻസിലെ സോർ രൂപീകരണത്തിൽ മൈറ്റോകോണ്ട്രിയൽ പിളർപ്പ് അനുവദനീയമാണെന്ന് മുൻപ് പറഞ്ഞിരുന്നു. അപ്പ്റ്റോസിസ് [1] സമയത്ത് മൈറ്റോകോണ്ട്രിയയിലേക്ക് തിരഞ്ഞെടുക്കാനായി Drp11 കണ്ടെത്തിയിട്ടുണ്ട്, കൂടാതെ, ഇതുമായി പൊരുത്തപ്പെടുന്ന മൈമോൺഡോണ്ടരിയ പ്രക്രിയയുടെ ആരംഭത്തിൽ [27] നിരീക്ഷിക്കപ്പെട്ടിട്ടുണ്ട്. വിപരീതമായി, സൈനോക്രോം സി റിലീസിന് [53] അനുവദിക്കുന്ന പുറം മെംബ്രെൻ പോറകളുടെ രൂപീകരണം തടഞ്ഞുകൊണ്ട് അയോപോട്ടോസിസിനെ തടയുകയെന്നത് മൈറ്റ് ടോണ്ടിയൽ വിഘേഷണത്തെ തടയുന്നു എന്നാണ്. അതനുസരിച്ച്, മൈോട്ടൊകോണ്ട്രൽ ഫ്യൂഷൻ ഉത്തേജിപ്പിക്കൽ അപ്പാർട്ടൊസിസിന്റെ പുരോഗതിയിൽ സ്റ്റോറസ്പോർൻ (STS) [14] ഉൾപ്പെടെയുള്ള സംയുക്തങ്ങളിലൂടെ ഉണ്ടാകുന്നതാണ്. എസ്.റ്റി.എൻ.-മധ്യേയുള്ള അപ്പോപ്പോസിസിൻറെ SFN RPE-1 സെല്ലുകളെ സംരക്ഷിക്കണമോ എന്ന് നിർണ്ണയിക്കണമെങ്കിൽ, ഇത് Nrf2 ആവശ്യമാണോ എന്ന് വ്യക്തമാക്കുന്നത്, പോളി എ.ഡി.പി. ആർഗോ പോളിഷ്മെയ്സ് (PARP) cleavage, സജീവമായ caspase-3 ന്റെ അടിവര അപ്പോത്തോസിസ്. 1 μM ക്ക് 1 μM STS ഉള്ള RPE-6 സെല്ലുകളുടെ ചികിത്സ മാത്രമേ PARP- ന്റെ വളരെ ലളിതമായ വിടവുകൾക്ക് കാരണമാകുകയുള്ളൂ, ഇതു SFN കോ-ട്രീറ്റ്മെന്റ് വഴി തടഞ്ഞു (ഉദാഹരണത്തിന്, ചിത്രം, 4A, LINE 3, 4). ഈ ഘടനയുടെ കരുത്തുറ്റത വർദ്ധിപ്പിക്കുന്നതിനായി, എസ്.റ്റി.എസ്.ഡബ്ല്യുഡി അപ്പോപ്പോസിസിനു കൂടുതൽ സെല്ലുകൾ കോർണറൈസ് ചെയ്തു, അക്പ്പോട്ടോട്ടിക് ഘടകം, Bcl-XL ലക്ഷ്യം വച്ചുകൊണ്ടുള്ള siRNA കൊണ്ട് അവരെ ചികിത്സിക്കുന്നതിനു മുൻപ്. ഈ പ്രീട്രീറ്റ് Bcl-XL എന്ന പ്രക്രീയ കുറച്ചു, കൂടാതെ എസ്.റ്റി.സുമായി പരിചിതമായ സമയമായി PARP cleavage എന്നതിനെ പ്രോത്സാഹിപ്പിക്കുകയും ചെയ്തു (ചിത്രം, 4B, 2 പാത വരെ 4 മുതൽ 10 വരെ). പ്രധാനമായും, എസ്.എഫ്.എൻ. വിഘടിപ്പിച്ച സെല്ലുകളിലെ എസ്.എഫ്.എൻ. അതുപോലെ, CRISPR / Cas2 ൻറെ NFf4 ൻറെ കോശങ്ങൾ, SFN പ്രി- ചികിത്സയിലൂടെ എസ്.റ്റി.എൻ. നൈട്രേറ്റിൽ നിന്നും താരതമ്യേന പരിരക്ഷിക്കപ്പെട്ടിരിക്കുന്നു (ചിത്രം, 3, Lane 4, 5, Lane XXX, 6, ചിത്രം, 2D). ഈ സംരക്ഷണം പാരാപ് ക്ളേവേജും (ചിത്രം 9C ഉം D ഉം) സെല്ലുലാർ മോർഫോളജി (ചിത്രം 4E) ഉപയോഗിച്ച് വായനങ്ങളായി ഉപയോഗിച്ചു. CRISPR / Cas11 ഉപയോഗിച്ച് Nrf12 depletion ഫലപ്രാപ്തി പടിഞ്ഞാറൻ ചിരട്ടകൊണ്ട് (ചിത്രം 13C, Nrf14 blot) സ്ഥിരീകരിച്ചു. മുൻകൂട്ടിപ്പറഞ്ഞതുപോലെ, DRP4 ന്റെ സെല്ലുകൾ കുറയുന്നു, ഇത് ഒരു ഹൈപ്പർഫ്യൂഷൻ ഫൈനാറ്റെൈപ്പ് (ചിത്രം. 4A), കൂടാതെ എസ്.റ്റി.എൻ. (എസ്എക്സ്എൻഎഫ്, ജി തുടങ്ങിയവ) ഇൻകുബേറ്റഡ് നിയന്ത്രണ സെല്ലുകളെ അപേക്ഷിച്ച് എസ്.റ്റി.എസ്. ഈ കണ്ടെത്തലുകൾ, SFN- യുടെ അപര്യാപ്തതയിൽ, NRF4- ന്റെ സ്ഥിരതയ്ക്കും സജീവമാക്കുന്നതിനുമായി, അപര്യാപ്തതയായ Drp2 ഫംഗ്ഷൻ നിയന്ത്രിക്കാനുള്ള ശേഷി നൽകിക്കൊണ്ട് നിലകൊള്ളുന്നു.

വേണ്ടി ദ്മ്സൊ, ക്സനുമ്ക്സ ധൂളികൾ സ്തൌരൊസ്പൊരിനെ (എസ്.റ്റി.എസ്), അല്ലെങ്കിൽ ക്സനുമ്ക്സ ധൂളികൾ എതൊപൊസിദെ കൂടെ ചിത്രം ക്സനുമ്ക്സ SFN എന്ന ച്യ്തൊപ്രൊതെച്തിവെ ഇഫക്റ്റുകൾ ംര്ഫ്ക്സനുമ്ക്സ പദപ്രയോഗം വിഭിന്നമാണ് (എ) ര്പെ-ക്സനുമ്ക്സ കോശങ്ങൾ ചെയ്തു ദ്മ്സൊ അല്ലെങ്കിൽ ക്സനുമ്ക്സ ധൂളികൾ SFN കൂടെ ക്സനുമ്ക്സ പ്രതി പ്രീ-ചികിത്സ മുൻകൂർ ചികിത്സ എൺപതുകളിലെ എച്ച്. ആന്റി PARP പി.ഡബ്ല്യു.പി പാശ്ചാത്യ തട്ടിപ്പിന് വേണ്ടി പ്രോസസ് ചെയ്തു. (ബി) RPE-1 കളങ്ങൾ 2.5 nM siCON, 1 nM siBcl-XL, അല്ലെങ്കിൽ 2.5 nM siBcl-XL, കൂടാതെ 3, 1, അല്ലെങ്കിൽ 2 നും DMSO അല്ലെങ്കിൽ 4 μM STS മായി ചികിത്സിച്ചു. സംയുക്ത പാശ്ചാത്യ ചേരുവകൾ കാണിക്കുന്നു, കൂടാതെ മോളിക്യുലാർ വെയ്റ്റ് മാർക്കറുകളുടെ മൈഗ്രേഷൻ ഇടതുവശത്ത് സൂചിപ്പിക്കുന്നു. (സി) ച്രിസ്പ്ര് / ചസ്ക്സനുമ്ക്സ-സൃഷ്ടിച്ച കാട്ടു-തരം (ംര്ഫ്ക്സനുമ്ക്സവ്ത്) ഉം ംര്ഫ്ക്സനുമ്ക്സ നോക്കൗട്ട് (ംര്ഫ്ക്സനുമ്ക്സകൊ) ര്പെ-ക്സനുമ്ക്സ കോശങ്ങൾ ക്സനുമ്ക്സ NM സിബ്ച്ല്-എക്സ് ആൻഡ് ക്സനുമ്ക്സ ദിവസങ്ങൾക്ക് ശേഷം ക്സനുമ്ക്സ പ്രതി ദ്മ്സൊ അല്ലെങ്കിൽ ക്സനുമ്ക്സ ധൂളികൾ SFN പ്രീ-ചികിത്സ ചെയ്തു ത്രംസ്ഫെച്തെദ് ചെയ്തു. പിന്നീട്, കോശങ്ങൾ 6, 9, അല്ലെങ്കിൽ 2 ക്കായി 2 μM STS ഉപയോഗിച്ച് പരിഗണിച്ചിരുന്നു. സൂചിപ്പിക്കപ്പെട്ട ആന്റിബോഡികളുടെ പ്രതിനിധി പടിഞ്ഞാറൻ ഭാഗങ്ങൾ കാണിക്കുന്നു. (D) 2 സ്വതന്ത്ര പരീക്ഷണങ്ങളിൽ നിന്നുള്ള മൊത്തം PARP (ക്ലെയിം + മാൻവെവേഡ്) ഒരു ശതമാനമായി പിരിപി കുറഞ്ഞ അളവ്. പ്രധാനമായും, ക്ലോവ്ഡ് PARP ന്റെ അളവ് സെല്ലുകൾ Nrf1 സൂചിപ്പിച്ചിട്ടുണ്ടോ ഇല്ലയോ, STS ൽ നിന്നും SFN സംരക്ഷണം ട്രാൻസ്ക്രിപ്ഷൻ ഘടകം സ്വതന്ത്രമാണെന്ന് സൂചിപ്പിക്കുന്നു. (ഇ) X (C) ൽ നിന്നുള്ള ലൈസറുകളുടെ വിളവെടുപ്പിനു മുമ്പായി 1 ഘട്ടം ദൃശ്യതീവ്രത എടുക്കുന്നു. സ്കെയിൽ ബാർ = 3 μm. (എഫ്) SFN ചികിത്സയായി എസ്.റ്റി.എസിൽ നിന്നും അടുത്തു-താരതമ്യപ്പെടുത്താവുന്ന സംരക്ഷണത്തെ Drp50 കുറയ്ക്കുന്നതിന് പ്രതിനിധി ചെയ്യുന്ന പടിഞ്ഞാറൻ ഭാഗിക്കലുകൾ. RPE-2 സെല്ലുകൾ 1 nM siBcl-XL ഉപയോഗിച്ച് ട്രാൻസ്ഫോർഡുചെയ്യുന്നു, കൂടാതെ ഇത് 2 nM siCON അല്ലെങ്കിൽ 4 nM siDrp6 ഉപയോഗിച്ച് ട്രാൻസ്ഫോർഡുചെയ്യുന്നു. എൺപത് ദിവസം കഴിഞ്ഞ്, സികോൺ സെല്ലുകൾ (എ), (സി) എന്നിവയിൽ എസ്.എഫ്.നിക്കുള്ള മുൻകരുതലുകൾ നൽകി, അതിനുശേഷം ആൻറിബോഡികളുമായി പാശ്ചാത്യപ്രസരണത്തിന് വിളവെടുക്കാനും പ്രോസസ്സ് ചെയ്യാനും എസ്ടിഎസ്എൻഎൻ എസ്ടിഎസിന് വിധേയമായി. (ജി) 3 സ്വതന്ത്ര പരീക്ഷണങ്ങളിൽ നിന്ന് സമാഹരിച്ച ഡാറ്റ (ഡി) പോലെ (ഡി) പോലെ. പിശക് ബാറുകൾ +/- SEM പ്രതിഫലിപ്പിക്കുന്നു

സംവാദം

KEAP1-Nrf2-Pathway- ൽ ഫലങ്ങളിൽ നിന്നും സ്വതന്ത്രമായി mitochondrial fission / fusion dynamics- നെ SFN മോഡുലേറ്റ് ചെയ്യിക്കുന്നുവെന്ന് ഞങ്ങൾ കണ്ടെത്തി. Mitochondrial Dysfunction and ROS ഉൽപ്പാദനം എന്നിവ തമ്മിലുള്ള ഒരു നിശ്ചിത ബന്ധവും മൈറ്റോചോണ്ട്രയിൽ നിന്നുണ്ടായ ഫ്രീ റാഡിക്കലുകളെ Nrf2 വഴി സജീവമാക്കുന്നതിലൂടെയും ഇത് സങ്കീർണ്ണമായതാണ്. പ്രോസ്റ്റേറ്റ് ക്യാൻസർ, അൾട്രാസ്റ്റീവ് പൾമണറി രോഗം, അരിവാൾ കോശ രോഗം [30], [7], [10], [47], എന്നിവ ഉൾപ്പെടെ വിവിധ തരത്തിലുള്ള രോഗങ്ങളുടെ ചികിത്സയ്ക്കായി നിലവിൽ SFN- യുടെ പരീക്ഷണഫലമായ XNUMX ക്ലിനിക്കൽ പരീക്ഷണങ്ങൾക്ക് SFN- ന്റെ ഈ അധിക പ്രവർത്തന ഫലപ്രാപ്തി പ്രധാന ഘടകമാണ്. XNUMX].

SFN [ക്സനുമ്ക്സ] ഒരു ഇസൊഥിഒച്യനതെ അത് [ക്സനുമ്ക്സ] ംര്ഫ്ക്സനുമ്ക്സ ശോഷണ അടിച്ചമർത്താൻ നേരിട്ട് നിർണ്ണായക കെഅപ്ക്സനുമ്ക്സ ച്യ്സ്തെഇനെസ് അച്യ്ലതിന്ഗ് വഴി ംര്ഫ്ക്സനുമ്ക്സ സിഗ്നലിങ് സജീവമാക്കുന്നു കാരണം, അത് SFN മെത്തിയോണിൻ പരിഷ്കരണത്തിന് വഴി ഒരു വിഘടനം അല്ലെങ്കിൽ ഫ്യൂഷൻ ഘടകത്തിന്റെ പ്രവർത്തനം മൊദുലതിന്ഗ് അതിന്റെ ഫ്യൂഷൻ അനുകൂല ഇഫക്റ്റുകൾ ചെലുത്തുന്നു എന്ന് ഇതിൽനിന്ന് . GTPase അലിലിനിയുടെ ഒരു ലക്ഷ്യം വ്യക്തമാക്കപ്പെടാൻ പാടില്ലെങ്കിലും ഞങ്ങളുടെ ഡാറ്റ ശക്തമായി എസ്എഫ്എൻ കണ്ട് നിയന്ത്രിക്കുന്നതിനെ പിന്തുണയ്ക്കുന്നു. ഈ വിജ്ഞാന വിടവുകൾക്കപ്പുറം, SFN ചികിത്സയ്ക്കായി മൈറ്റോകോണ്ട്രിയയും പെറോക്സിസോമുകളും ഹൈപ്പർഫുഷ്യൻ ആയിത്തീരുന്നതിനൊപ്പം SFN- ന്റെ പ്രവർത്തനവും വ്യക്തമായി തെളിയുന്നു. ഈ ഘടകങ്ങൾ തങ്ങളുടെ ഉത്തേജനം പരിപാടികൾക്കായി Drp1 [1] നൽകുന്നു. കൂടാതെ, SFN mitochondria (ചിത്രം.) ലെ പ്രാദേശികവൽക്കരിക്കുകയും സഞ്ചരിക്കുകയും ചെയ്യുന്ന Drp1 ന്റെ അളവ് കുറയ്ക്കുന്നു. 3). നമ്മുടെ എല്ലാ പരീക്ഷണങ്ങളും എൻഡോജനസ് പ്രോട്ടീനുകളുമായി ചെയ്തതുകൊണ്ട്, മൈറ്റോകോണ്ട്രിയൽ പിളർപ്പ് സൈറ്റുകളിലെ Drp1- ന്റെ ഗൌരവമേറിയ സ്ഥിരമായ അവസ്ഥകൾക്കനുസൃതമായി, SFN ഉളവാക്കുന്ന എൻസൈം നിലനിർത്തുന്നതിന് പകരം റിക്രൂട്ട്മെൻറ് തമ്മിലുള്ള വേർതിരിച്ചെടുക്കാൻ കഴിയില്ല. കൂടാതെ, SFN ഇതുവരെ Mitochondria (Fis1 അല്ലെങ്കിൽ Mff) ൽ ഒരു റിസപ്റ്ററാണ് acylates ഞങ്ങൾ Drp1 റിക്രൂട്ട്മെന്റ് തടയാൻ ഇതുവരെ കഴിയില്ല, ഞങ്ങൾ Drp1 നേരിട്ട് പുതുക്കപ്പെട്ടത് സംശയിക്കുന്നു. Drp1 ഒൻപത് സിസ്ടൈൻസികളാണ്, എട്ട് വീടുകളിൽ ഒളിഗോമെരിസലിനായി [3] ആവശ്യമുണ്ട്, അതിൽ ഒരെണ്ണം ജിടിസിഎൽ ഫലപ്രദവുമായ ഡൊമെയിനിൽ (GED) Dr-TXXX- ന്റെ C- ടെർമിനസിൽ അടങ്ങിയിരിക്കുന്നു. ഈ സിറ്റിനുകളിൽ നേരിട്ടുള്ള അലൈലേഷൻ Drp1 ൽ പ്രവർത്തനം കുറയ്ക്കുന്നതിന് കാരണമാകാം. അതുകൊണ്ട് mitochondrial dynamics ന് SFN ന്റെ ഫലത്തിന് അടിവരയിടുന്നു. ഒളിഗൊമേറൈസേഷന്റെയും ഉത്കണ്ഠയുടേയും പ്രവർത്തനങ്ങളിൽ ഉള്ള വൈകല്യങ്ങൾ mitochondria [1] ൽ DRP52 സൂക്ഷിക്കുന്നത് അസാധുവാക്കുമെന്ന് മുൻകാല പ്രവൃത്തി സൂചിപ്പിക്കുന്നു. CST644 GTPase പ്രവർത്തനം [1] തടസ്സപ്പെടുത്തുന്ന ഈ സിസ്ടൈൻ ഫിനൊകോപ്പിസ് മ്യൂട്ടേഷനുകളുടെ മ്യൂട്ടേഷനെ സൂചിപ്പിക്കുന്ന മുൻകാല സൃഷ്ടിയുടെ അടിസ്ഥാനത്തിൽ പ്രത്യേകിച്ച് ആകർഷണീയമായ ലക്ഷ്യം സിഎസ്എൻഎക്സ്എൻഎസിലുള്ള CX4 ആണ്. ഈ പ്രത്യേക സിസ്ടീൻ thiol-reactive ഇലക്ട്രോഫുകൾ [9] വഴി പരിഷ്ക്കരിക്കപ്പെടുന്നു. ഈ സുപ്രധാന ചോദ്യത്തിന്റെ പ്രമേയം പിണ്ഡം സ്പെക്ട്രോമെട്രിക് സാധൂകരണം ആവശ്യമാണ്. ചുരുക്കത്തിൽ, clinical- ഉചിതമായ സംയുക്ത എസ്.എഫ്.നിക്കു വേണ്ടിയുള്ള ഒരു നോവൽ സൈറ്റോട്രൊടക്ടീവ് പ്രവർത്തനം ഞങ്ങൾ കണ്ടെത്തി. മാസ്റ്റർ ആൻറി ഓക്സിഡൻറ് ട്രാൻസ്ക്രിപ്ഷൻ ഫാക്റ്റർ എൻആർഎഫ്എക്സ്എൻഎക്സ്എക്സ് ആക്റ്റിവേറ്റ് കൂടാതെ, എസ്എഫ്എൻ മൈറ്റോകോൺട്രിറിയൽ ആൻഡ് പെറോക്സിസ്മോമൽ ഫ്യൂഷൻ പ്രോത്സാഹിപ്പിക്കുന്നു, കൂടാതെ ഈ പ്രഭാവം Nrf2 ൽ നിന്നും സ്വതന്ത്രമാവുകയും ചെയ്യുന്നു. ഈ പ്രതിഭാസത്തിന് അടിത്തറയുള്ള മെക്കാനിസം മൈറ്റോകോൺട്രിറിയൽ ആൻഡ് പെറോക്സിസ്മോമൽ വിഘടത്തിന്റെ പ്രാഥമിക മധ്യസ്ഥൻ ആയ GTPase DRP1 ന്റെ പ്രവർത്തനത്തിൽ ഒരു കുറവാണ്. SFN- മധ്യത്തോടെയുള്ള മൈറ്റോകോണ്ട്രൽ ഫ്യൂഷൻ എന്ന ഒരു പ്രധാന പരിണാമം അപ്പോപെറ്റോസ് ഇൻസൈഡർ സ്റ്റോറസ്പോരിൻസിന്റെ വിഷബാധമൂലുകൾക്ക് പ്രതിരോധശേഷി വർദ്ധിപ്പിക്കുന്നു എന്നതാണ്. SFN ന്റെ ഈ അധിക സൈറ്റോട്രാക്ടിക്കേറ്റീവ് പ്രവർത്തനം പല ന്യൂറോഡെഗെനറിക് രോഗങ്ങളിൽ, പ്രത്യേകിച്ച് പ്രായത്തിന്റെ പ്രധാന അപകടസാധ്യതയുള്ള ഘടകം (ഉദാഹരണത്തിന്, പാർക്കിൻസൺസ് രോഗം, അൽഷിമേഴ്സ് ഡിസീസ്, പ്രായവുമായി ബന്ധപ്പെട്ട മാക്വലാർ ഡിജെനനേഷൻ) ഈ അപദ്രവ്യങ്ങൾ അപ്പോപെറ്റൊസിസുമായി ബന്ധപ്പെട്ടിരിക്കുന്നു. NRF2 [35], [36], [48] എന്നിവയുടെ അളവുകൾ അല്ലെങ്കിൽ / അല്ലെങ്കിൽ ഡിസ്റർലേഷൻ. SFN- ന്റെ സൈറ്റോട്രൊടക്ടീവ് ഘടകങ്ങൾ KEAP1-Nrf2-A സിസ്റ്റം സജീവമാക്കാതെ, വിവിധ ഏജന്റുമാരുടെ പരീക്ഷകളിൽ ഈ ഏജന്റെ നിലവിലെ ഉപയോഗം കണക്കിലെടുത്ത് കൂടുതൽ പഠനങ്ങൾ നടത്തുമെന്ന് ഈ ഡാറ്റ തെളിയിക്കുന്നു.

വസ്തുക്കളും രീതികളും

അപ്പോപ്പോനോസിസ് അസൈസ്

താഴെ കാണിച്ചിരിക്കുന്നത് പോലെ കളങ്ങൾ സീഡ്എന്നിനൊപ്പം വിത്തുപോയിരുന്നു. മൈലോൺചോണ്ട്രൽ ഫ്യൂഷൻ കൊണ്ടുവരുന്നതിന് 50 μM സൾഫോഫോപനേനുമായി ഈ സെല്ലുകൾ മുന്കാല ചികിത്സ നൽകിയിരുന്നു, പിന്നീട് അപ്പോപോസിസിനെ പ്രോത്സാഹിപ്പിക്കാൻ 2 μM സ്റ്റോറൂറോപോരിൻ ഉപയോഗിച്ചു. വിളവെടുപ്പിനുശേഷം വ്യക്തിഗത ട്യൂബുകളിൽ ശേഖരിക്കപ്പെട്ടു. അപ്പൂപ്പൊട്ടിക് സെല്ലുകൾ പെല്ലറ്റുണ്ടാക്കാൻ ഹൈ സ്പീഡ് സെന്റ്രുഫിഗേഷൻ വിധേയമായി. ഈ സെൽ പെല്ലറ്റ് സഹജമായ സെല്ലുകളുമായി കൂടിച്ചേർന്ന് 1 തവണ കേന്ദ്രീകൃത Laemmli ബഫറിൽ സോല്യൂബിൽ ചെയ്തു. സാമ്പിളുകൾ PARP വിരുദ്ധ പാശ്ചാത്യപ്രയോഗത്തിന് വിധേയമാക്കി.

CRISPR / Cas9 കൺസ്ട്രക്ട് ജനറേഷൻ

LentiCRISPR / eCas9 സൃഷ്ടിക്കാൻ, LentiCRISPR V1.1 (ആഡ്ജെൻ #2) ആദ്യത്തേത് AXXXX ഉം BAMH52961 ഉം ആയിരുന്നു. അടുത്തതായി, താഴെപ്പറയുന്ന പ്രൈമറുകൾ (മുൻപത്തെ AGCGCACCGGTTCTAGAGCGCTGCCACCATGGACTATAAGGACCACGAC, റിവേഴ്സ് AAGCGCGGATCCCTTTTTCTTTTTTGCCTGGCCGG) എന്നിവയുപയോഗിച്ച് പിസിആർ, എക്സ്എക്സ്എക്സ്എക്സ്എക്സ്, ബിംഎക്സ്എക്സ്എക്സ്എക്സുകൾ എന്നിവ ഉപയോഗിച്ച് പിസിആർ കൂട്ടിച്ചേർത്തു, മുകളിലുള്ള കട്ട് വെക്റ്ററിലേക്ക് തരംതാഴ്ത്തുകയായിരുന്നു ഇ.എസ്.പി.സി. XXX (ADDGEN #1) മുതൽ SPCAS1. Benchling.com ഉപയോഗിച്ച് sgRNA ശ്രേണികളെ നിശ്ചയിച്ചിരുന്നു. കോഡിംഗ് സീക്വൻസിനു മുകളിലുള്ള ടാർഗെറ്റ് ഏറ്റവും കുറഞ്ഞ ടാർജറ്റ് സ്കോറുകളും, കുറഞ്ഞ സ്കോർ നേടിയ ടാർജറ്റുകളും കണക്കാക്കാനായി പരാമീറ്ററുകൾ സജ്ജമാക്കി. താഴെ സീക്വൻസുകൾ (അനുക്രമം ടാർഗെറ്റുചെയ്യൽ അണ്ടർലൈൻ എച്ച്എസ് സ്ഗ്ന്ഫെക്സനുമ്ക്സല്ക്സനുമ്ക്സ # ക്സനുമ്ക്സ അർത്ഥത്തിൽ ചച്ച്ഗ്ച്ഗച്ഗ്ഗഅഅഗഗ്തത്ഗഗ്ച്, അംതിസെംസെ അഅഅച്ഗ്ച്ത്ചതച്ത്ച്ത്ത്ത്ച്ച്ഗ്ത്ച്ഗ്ച്; എച്ച് സ്ഗ്ന്ഫെക്സനുമ്ക്സല്ക്സനുമ്ക്സ # ക്സനുമ്ക്സ അർത്ഥത്തിൽ ചച്ച്ഗ്ഗ്ത്ത്ത്ച്ത്ഗച്ത്ഗ്ഗത്ഗ്ത്ഗ്ച്ത്, അംതിസെംസെ അഅഅചഗ്ചചത്ച്ചഗ്ത്ചഗഅഅച്ച്; എച്ച് സ്ഗ്ന്ഫെക്സനുമ്ക്സല്ക്സനുമ്ക്സ # ക്സനുമ്ക്സ അർത്ഥത്തിൽ ചച്ച്ഗ്ഗഗ്തഗ്ത്ത്ഗ്ഗ്ചഗത്ച്ചച്, അംതിസെംസെ അഅഅച്ഗ്ത്ഗ്ഗത്ച്ത്ഗ്ച്ചഅച്തച്ത്ച്ച്) കടന്നു ബ്സ്ംബ്ക്സനുമ്ക്സ അംനെഅലെദ് ചെയ്ത് ലിഗതെദ് ചെയ്തു ലെംതിച്രിസ്പ്ര് / എചസ്ക്സനുമ്ക്സ ക്സനുമ്ക്സ മുറിച്ചു. ശ്വാസകോശ രോഗബാധയുള്ള RPE-9 സെല്ലുകൾ പൂമോമീസിനോടൊപ്പം തിരഞ്ഞെടുത്തു. ഇംപോൺഫുലോസോഴ്സ്സെൻസ്, പാശ്ചാത്യപ്രകടനത്താൽ നോക്കൗട്ട് സ്ഥിരീകരിച്ചു.

സെൽ കൾച്ചർ ആൻഡ് ട്രാൻസ്ഫൻഷൻസ്

തെലൊമെരസെ (ര്പെ-ക്സനുമ്ക്സ) (അത്ച്ച്) പരിവർത്തനം മാനവ റെറ്റിനയിലെ ചായക്കൂട്ട് എപിഥെലിഅല് കോശങ്ങൾ പെൻസിലിൻ, സ്ട്രെപ്റ്റോമൈസിൻ, ക്സനുമ്ക്സക്സ നോൺ-അമിനോ ആസിഡ് കോക്ടെയ്ൽ (ലൈഫ് ടെക്നോളജീസ്) ഉപയോഗിച്ച് അനുബന്ധമായ ക്സനുമ്ക്സ ഗ്രാം / എൽ ഗ്ലൂക്കോസ് അടങ്ങുന്ന ഡൽബെക്കോ ന്റെ പരിഷ്കരിച്ച ഈഗിൾ മീഡിയം (ദ്മെമ്) ൽ സംസ്ക്കരിച്ച ആയിരുന്നു, കൂടാതെ 1% ഗർഭസ്ഥ ശിശുവിന് (ലൈഫ് ടെക്നോളജി). SiRNA- ട്രാൻസ്ഫക്ഷനുകൾക്കായി, 1- 1 കളങ്ങൾ / എം.എൽ. സെല്ലുകൾ സെറം-ഫ്രീ ഡിഎംഎമെയിൽ ലയിപ്പിച്ച 10 nM siRNA ഉം ഇന്റർപ്രിൻ ട്രാൻസ്ഫീഷൻ റെജന്റ് (പോളി പ്ലുസ്) ഉം സംയോജിപ്പിച്ചിരിക്കുന്നു. Apoptosis സെൻസിറ്റൈസസിനായി, കോശങ്ങൾ 30,000 nM Bcl-XL siRNA ലഭിച്ചു. സെല്ലുകൾ പോസ്റ്റ്-ട്രാൻസ്ഫക്ഷന്റെ 35,000-XNUM ദിവസം വിളവെടുത്തു.

രാസവസ്തുക്കൾ, ആന്റിബോഡികൾ, സിറൺ ഒലിഗോസ്

α-തുബുലിന് (സെൽ സിഗ്നൽ), β-തുബുലിന് (സിഗ്മ), ദ്ര്പ്ക്സനുമ്ക്സ (ബി.ഡി. ബിഒസ്ചിഎന്ചെസ്), കെഅപ്ക്സനുമ്ക്സ (പ്രൊതെഇംതെഛ്), ലമിന് ബ്ക്സനുമ്ക്സ (അബ്ചമ്), പര്പ് (സെൽ സിഗ്നൽ), പ്ംപ്ക്സനുമ്ക്സ (അബ്ചമ്), ഒപ്പം തൊമ്ക്സനുമ്ക്സ (ബി.ഡി. ബിഒസ്ചിഎന്ചെസ് നേരെ ആന്റിബോഡികളുടെ ) പാശ്ചാത്യതൈലമർദ്ദത്തിനും immunofluorescence നു വേണ്ടി 1: 1 വിത്തുകൾ ഉപയോഗിച്ചു. ഇൻ-ഹൌസ്, ആന്റി- Nrf1 മുയൽ ആൻറിബോഡി, പടിഞ്ഞാറൻ കളഞ്ഞുകുളിക്കുള്ള [70], 20: 1 ൽ ഉപയോഗിച്ചു. സുൽഫോഫോഫെയ്ൻ (സിഗ്മ), സ്റ്റോർറോസ്പോരിൻ (ടോക്രിസ്) എന്നിവ യഥാക്രമം 1000 മമ്മിക്കും XMX μM ക്കുമായിരുന്നു. സൂചിപ്പിച്ചിരിക്കുന്നത് കൂടാതെ XXX nM- ൽ Drp2 (ധർമ്മകോൺ), Nrf1 (ധർമകോൺ), KEAP2000 (സെൽ സിഗ്നലിംഗ്), Bcl-XL (സെൽ സിഗ്നലിംഗ്) എന്നിവയ്ക്കെതിരായി siRNAs ഉപയോഗിച്ചു.

ഇമോൻഫുലൂസൻസ് ആൻഡ് വിവോ ലേബലിംഗ്

18 മില്ലീമീറ്റർ ഗ്ലാസ് കവർസ്ലിപ്സിൽ വിത്ത് സെല്ലുകൾ കാർഡുടമയോ മരുന്ന് ഉപയോഗിച്ചോ കണക്കാക്കിയത്, 3.7% ഫോർമാൽഡിഹൈഡിൽ നിശ്ചലമാക്കിയത്, അതിനുശേഷം 0.2% മഞ്ഞിൽ 100% Triton X-10 / PBS- ൽ പെർസെബിലിറ്റി ചെയ്തു. പ്രാഥമിക പ്രതിരോധ വസ്തുക്കൾ PBS ൽ 3% ബോവീൻ സീറം ആൽബത്തിൽ (ബി.എസ്.ഇ) ചുരുങ്ങിയത്, രാത്രി 10 ഡിഗ്രി സെൽഷ്യസിൽ. ക്സനുമ്ക്സ% ബ്സ / പിബിഎസ് ലും ക്സനുമ്ക്സ μഗ് / മില്ലി ദപി (സിഗ്മ): പിബിഎസ് ആയമാർ അംഗിതന്നെ ദ്വിതീയ ആന്റിബോഡികളുടെ (ക്സനുമ്ക്സ ആണയിടുമ്പോഴും ക്സനുമ്ക്സ) തുടർന്ന്, സെല്ലുകൾ ഇനം-ഉചിതമായ ൽ ക്സനുമ്ക്സ പ്രതി വിരിയിച്ചെടുത്ത ചെയ്തു, അലെക്സഅക്സനുമ്ക്സ- അല്ലെങ്കിൽ അലെക്സഅക്സനുമ്ക്സ-. മൈറ്റോകോണ്ട്രിയകളില്ലാതെ-തൊമ്ക്സനുമ്ക്സ വിരുദ്ധ ഇംമുനൊഫ്ലുഒരെസ്ചെന്ചെ അല്ലെങ്കിൽ ഫിക്സേഷൻ മുൻപുള്ള ക്സനുമ്ക്സ ഡിഗ്രി ക്സനുമ്ക്സ മിനിറ്റ് സെറം-സ്വതന്ത്ര ദ്മെമ് ൽ ക്സനുമ്ക്സ NM മിതൊത്രച്കെര് റെഡ് ച്മ്ക്സരൊസ് (മോളിക്യുലർ പ്രോബ്സ്, ഇൻക്) സെല്ലുകൾ ഇന്ചുബതിന്ഗ് ഒന്നുകിൽ ദൃശ്യവൽക്കരിക്കുകയും ചെയ്തു.

മൈക്രോസ്കോപ്പിയും ഇമേജ് അനാലിസിസും

Immunofluorescence സാമ്പിളുകൾ ഒരു LSM710 കോൺഫ്രാക് സൂക്ഷ്മകോശത്തിൽ (കാൾ സീസ്) കണ്ടു. Adobe Photoshop CS63 ഉപയോഗിച്ച് അഡ്ജസ്റ്റ് ചെയ്തതും മെച്ചപ്പെട്ടതുമായ ചിത്രങ്ങൾ 100X അല്ലെങ്കിൽ 6 എണ്ണ ഇമ്പർഷൻ ലക്ഷ്യങ്ങളും ഇമേജുകളും ഉപയോഗിച്ചാണ് മൈക്രോഗ്രാം പകർത്തിയത്. സാമ്പിളുകളുടെ ഐഡന്റിറ്റിക്ക് അന്ധതയിറക്കുന്നതിനിടയിൽ സ്വയം സജ്ജീകരണങ്ങളോടെയുള്ള കാർൽ സെയ്സ് LSM710 സഹ-ലോക്കൽലൈസേഷൻ സവിശേഷത ഉപയോഗിച്ച് കോ-ലോക്കൽ വ്യാഴത്തിന്റെ വിശകലനം നടത്തി. സൂചിപ്പിക്കാത്ത പക്ഷം ബാറുകൾ സ്കെയിൽ ചെയ്യുക, 10 μm ആകുന്നു. മൈറ്റോചോണ്ട്രൽ മോർഫോളജി അന്ധമായ സ്കോറാണ് നൽകിയിരുന്നത്. ഒരു കോശത്തിന്റെ മൈറ്റോകോണ്ട്രിയ അനേകം, റൌണ്ട്, ഡിസ്ക്രിമിനേറ്റ് പങ്ക്സ് ആയി കൈകാര്യം ചെയ്തിരുന്നാൽ സെൽ 'ഫിഷൻ' എന്ന് രേഖപ്പെടുത്തുകയുണ്ടായി. വ്യക്തിഗത മൈറ്റോകോണ്ട്രിയ വേർതിരിക്കാനാവാത്തതായിരുന്നെങ്കിൽ എല്ലാ മെറ്റോക്രൊഡിയൽ ശൃംഖലയും തുടർച്ചയായി പ്രത്യക്ഷപ്പെട്ടിരുന്നുവെങ്കിൽ, കോശം 'ഫ്യൂഷൻ' എന്നാക്കി. മൈറ്റോകോണ്ട്രിയ ക്ലസ്റ്ററിങ് ഉൾപ്പെടെയുള്ള മറ്റ് എല്ലാ കോശങ്ങളും 'ഇന്റർമീഡിയറ്റ്' ആയി കണക്കാക്കപ്പെട്ടു.

ഉപസൗലിക സങ്കൽപ്പങ്ങൾ

RPE-1 കോശങ്ങൾ കൂടിച്ചേർന്ന് വളർന്നു. ഒരു പി.ബി.എസ് വാഷ് അനുസരിച്ച് കോശങ്ങൾ 600 × 10 മിനിറ്റിനുള്ളിൽ സെന്റീഫുഗേഷൻ ആക്റ്റിവേറ്റ് ചെയ്തു, 10 μL ലാൻഡിംഗ് ബഫറിൽ പുനർസന്ദർശിച്ചു (600 എംഎം മാനിറ്റോൾ, XM എം എം സുക്കോസ്, എംഎംഎസ് എംപോപ്സ്, എംഎംഎം എംഎടിഎ പിഎച്ച് X + 210 എംഎം പിഎംഎസ്എഫ്). ഒരു സസ്പെൻസ് homogenizer ൽ സസ്പെൻഷൻ 70 തവണ ലീസ് ചെയ്തു. "മുഴുവൻ സെൽ lysate" ആയി homogenate ഒരു ഭിന്നസംരക്ഷണമായിരുന്നു. ബാക്കി Nuclei pendlet ലേക്കുള്ള 5 × 10 മിനിറ്റ് centrifugation വിധേയമായിരുന്നു. സൂപ്പർനേറ്ററുകൾക്ക് 1 × 10 മിനിറ്റിനുള്ളിൽ ബാക്കിയുള്ള ന്യൂക്ലിയസും അൺലിസെസ് സെല്ലുകളും മായ്ക്കുന്നതിന് സെന്റ്രൂഫിഗേഷൻ വിധേയമായി. ഈ സൂപ്പർമർങ് 7.4 × 10 മിനിറ്റിനുള്ളിൽ മൈറ്റോകോണ്ട്രിയയിൽ pestlet to centrifugation വിധേയമായിരുന്നു. സൂപ്പർനോട്ടാലിറ്റി "സൈറ്റോസോളിക് ഫ്രീ" എന്ന് സൂക്ഷിച്ചു. പെഡ്രാറ്റ് പിബിഎസ് ഉപയോഗിച്ച് സൌമ്യമായി കഴുകുകയും ഒറ്റപ്പെടൽ ബഫറിൽ വീണ്ടും പുനർനിർമ്മിക്കുകയും ചെയ്തു. ബിപിൻചോണിക് ആസിഡ് (ബിസിഎ) ആസെയുടെ ഓരോ അംശം പ്രോട്ടീൻ കോൺസൺട്രേഷൻ അളക്കുകയും SDS-PAGE വഴി തുല്യ പ്രോട്ടീൻ പരിഹരിക്കപ്പെടുകയും ചെയ്തു.

വെസ്റ്റേൺ ബ്ലോട്ടിംഗ്

കളങ്ങൾ പിബിഎസ് ൽ കഴുകി ക്സനുമ്ക്സ തവണ സൊലുബിലിജെദ് ചെയ്തു ലെംമ്ലി സൊലുബിലിജിന്ഗ് ബഫർ (ക്സനുമ്ക്സ എം.എം. ത്രിസ് [അമ്ലത്വം ക്സനുമ്ക്സ], ക്സനുമ്ക്സ% സ്ദ്സ്, ക്സനുമ്ക്സ% ബ്രൊമൊഫെനൊല് നീല, ക്സനുമ്ക്സ% ക്സനുമ്ക്സ-മെര്ചപ്തൊഎഥനൊല്, ക്സനുമ്ക്സ% നൊസ്റ്റാള്ജിയ, ഒപ്പം ക്സനുമ്ക്സ% പ്യ്രിനിന് വൈ) കേന്ദ്രീകരിച്ചു. സോഡിയം dodecyl സൾഫേറ്റ് (SDS) പോളാകിരംമൈഡ് ജെല്ലുകൾക്ക് മുൻപ് കയറ്റുന്നതിനു മുമ്പ് LASATES 2 മിനിറ്റ് വേവിച്ചു. പ്രോട്ടീനുകൾ nitrocellulose membranes ലേക്ക് മാറ്റി, 100% പാൽ / TBST ൽ 6.8 മണിക്കൂർ തടഞ്ഞു. പ്രാഥമിക പ്രതിരോധ വസ്തുക്കൾ 2% Milk / TBST ൽ ലയിപ്പിച്ചശേഷം സ്ഫോടനത്തിൽ 0.008 ° C ൽ കുതിർന്നിരുന്നു. Horseradish peroxidase (HRP) - കോണ്ഗ്രസ്ഡ് ദ്വിതീയ ആന്റിബോഡുകള് 2% Milk / TBST ല് ലയിപ്പിച്ചതാണ്. മെച്ചപ്പെട്ട ചെമ്മിലിനംസിനുപയോഗിച്ച് ബ്ലാട്ടുകൾ പ്രോസസ് ചെയ്തു, ഇമേജസ് സോഫ്റ്റ് വെയർ ഉപയോഗിച്ച് ഡിസ്മിറ്റോമെട്രിക് അളവുകൾ നിർവ്വഹിച്ചു.

ഡോ ജിമനെസ് വൈറ്റ് കോട്ട്

ബ്രോക്കോളി, കാബേജ്, കോളിഫ്ളവർ, കാൾ, കോൾഡ്സ് തുടങ്ങിയവ ഉൾപ്പെടെ കുങ്കുമക്കഷണങ്ങൾ ശേഖരിച്ച ഓർഗാനോഫുലർ വസ്തുക്കളുടെ ഇസോഷ്യിയോസൈനിയറ്റ് ശേഖരത്തിൽ നിന്നും സൾഫോപ്രഫീൻ ഒരു രാസവസ്തുവാണ്. എൻറോം myrosinase ഗ്ലൂക്കോറാപാനിൻ, ഗ്ലൂക്കോസിനോളാറ്റ്, സൾഫോറഫാനിലേക്ക് പരിവർത്തനം ചെയ്യുമ്പോൾ സുൽഫോപ്പാപാനി ഗ്ലൂക്കോസിനോളേറ്റ് എന്നും അറിയപ്പെടുന്നു. ബ്രോക്കോളി മുട്ടകൾ, കോളിഫ്ളവർ എന്നിവയ്ക്ക് ഗ്ലൂക്കോറോപ്പണിയുടെ ഏറ്റവും ഉയർന്ന സാന്നിദ്ധ്യം അല്ലെങ്കിൽ സൾഫൊർഫാനിലേക്ക് മുൻഗാമികൾ ഉണ്ട്. വിവിധ ആരോഗ്യപ്രശ്നങ്ങൾ തടയുന്നതിനായി മനുഷ്യശരീരത്തിലെ ആൻറി ഓക്സിഡൻറുകളുടെ ശേഷി വർദ്ധിപ്പിക്കാൻ സൾഫോറാഫാനെ സഹായിക്കുമെന്ന് ഗവേഷണ പഠനങ്ങൾ തെളിയിച്ചിട്ടുണ്ട്. ഡോ. അലക്സ് ജിമനേസ് DC, CCST ഇൻസൈറ്റ്

ക്യാൻസർ, മോർട്ടാലിറ്റി, ഏജിംഗ്, ബ്രെയിൻ ആന്റ് ബിഹേവിയർ, ഹൃദ്രോഗം എന്നിവയെല്ലാം സുൽഫോപ്പഫണും അതിന്റെ പ്രഭാവവും

ഐസോത്തിയോസയനങ്ങൾ ഭക്ഷണത്തിൽ നിങ്ങൾക്ക് ലഭിക്കുന്ന ഏറ്റവും പ്രധാനപ്പെട്ട പ്ലാന്റ് സംയുക്തങ്ങളാണ്. ഈ വീഡിയോയിൽ ഞാൻ നിർമ്മിച്ചതിൽ ഏറ്റവും സമഗ്രമായ കേസ് ഞാൻ ഉണ്ടാക്കുന്നു. ചെറിയ ശ്രദ്ധാകേന്ദ്രം? ചുവടെയുള്ള സമയ പോയിന്റുകളിൽ ഒന്ന് ക്ലിക്കുചെയ്ത് നിങ്ങളുടെ പ്രിയപ്പെട്ട വിഷയത്തിലേക്ക് പോകുക. പൂർണ്ണ ടൈംലൈൻ താഴെ.

കീ വിഭാഗങ്ങൾ:

  • വ്യായാമം, മരണ നിരക്ക്
  • ചൊവ്വ: 83 - 83 - ഏജിംഗ്
  • XXX: 00: 26 - ബ്രെയിൻ ആൻഡ് പെരുമാറ്റം
  • 00: 38: 06 - അവസാനത്തെ റീക്യാപ്പ്
  • XXX: 00: 40 - ഡോസ്

പൂർണ്ണ ടൈംലൈൻ:

  • 00: 00 - 34 - വീഡിയോയുടെ പ്രധാന ശ്രദ്ധ പിടിച്ചുപറ്റിയ സൾഫൊർഫാനെ എന്ന ആമുഖം.
  • 83 - 83 - ക്രസ്കീരിയസ് പച്ചക്കറി ഉപഭോഗം, എല്ലാ കാരണങ്ങളാലും മരണനിരക്ക് കുറയ്ക്കുക.
  • 83 - 83 - പ്രോസ്റ്റേറ്റ് കാൻസർ റിസ്ക്.
  • 83: 83 - ക്ഷയിക്കുന്ന അർബുദം.
  • പുകവലി റിസ്കിൽ ശ്വാസകോശ കാൻസർ.
  • വ്യായാമം: സ്തനാർബുദം.
  • 00: 03: 13 - Hypothesical: നിങ്ങൾ ഇതിനകം ക്യാൻസറുണ്ടെങ്കിൽ എന്താണ്? (ഇടപെടൽ)
  • 00: 03 - 35 - കാൻസർ, മരണസംബന്ധമായ ബന്ധിത വിവരങ്ങളിൽ ഡ്രൈവിംഗ് സംവിധാനം.
  • 83: 83 - സുൽഫോപ്പഫനും അർബുദവും.
  • 83 - 83 - എലികളിലെ കോശവളർച്ച വികസനത്തിൽ ബ്രോക്കോളി മുളക്കുന്നതിന്റെ ശക്തമായ പ്രഭാവം കാണിക്കുന്നു.
  • 83 - 83 - പ്രോസ്റ്റേറ്റ് കാൻസർ രോഗികളിലെ സൾഫോറഫായെ നേരിട്ട് നൽകുക.
  • 83 - 83 - യഥാർത്ഥ ബ്രെസ്റ്റ് ടിഷ്യസിൽ ഐസോതോയോസൈനറ്റ് മെറ്റബോളിറ്റുകളുടെ ജൈവകചലനം.
  • NSS: XX: XXL - സ്തനാർബുദം സ്റ്റെം സെല്ലുകൾ തടഞ്ഞത്.
  • പുരാതന റോമിൽപോലും ഹെൽത്ത് പ്രോപ്പർട്ടികളായി ബ്രസികകൾ സ്ഥാപിക്കപ്പെട്ടു.
  • 83-83 - കാൻസറിൻ വിസർജ്ജനം വർദ്ധിപ്പിക്കുന്നതിനുള്ള സൾഫൊർഫാന്റെ കഴിവ് (ബെൻസീൻ, അൾരോലിൻ).
  • 00: 09 - NRF51 ആൻറിഓക്സിഡന്റ് പ്രതികരണ ഘടകങ്ങൾ വഴി ജനിതകമാറ്റം പോലെ.
  • 00: 10 - NRF10 ആക്റ്റിവേഷൻ ഗ്ലൂത്തോതർ-എസ്-കോഞ്ഞഗേറ്റുകൾ വഴി കാർസിനോജൻ വിസർജ്ജനം എങ്ങനെ മെച്ചപ്പെടുത്തുന്നു.
  • ബ്രസൽസ് മുളകൾ ഗ്ലൂട്ടാട്യൺ-എസ്-ട്രാൻസ്ഫസർ വർദ്ധിപ്പിക്കുകയും ഡി.എൻ.എ നാശനഷ്ടം കുറയ്ക്കുകയും ചെയ്യുന്നു.
  • 83-83 - ബ്രോക്കോളി മുളപ്പിച്ച പാനീയം ബെൻസീൻ വിസർജ്ജനം 00% വർദ്ധിപ്പിക്കും.
  • ബ്രോക്കോളി മുട്ട പൊരിഞ്ഞത്, വായു ശ്വസനത്തിലെ ആന്റിഓക്സിഡന്റ് എൻസൈമുകൾ വർദ്ധിപ്പിക്കും.
  • 83 - 83 - ക്രസ്റ്റീരിയസ് പച്ചക്കറി ഉപഭോഗം, ഹൃദ്രോഗ മരണനിരക്ക്.
  • വ്യായാമം: ബ്രോക്കോളി മുളക് പൊടി രക്തത്തിലെ ലിപിഡുകളുടെയും ഹൃദ്രോഗബാധകളുടെയും അളവ് X ടൈപ്പ് ഡയബെറ്റിക്സിന്റെ അളവിൽ വർദ്ധിപ്പിക്കുന്നു.
  • 83: 83 - പ്രായപൂർത്തിയായവർക്കുള്ള ഭാഗം ആരംഭിക്കുക.
  • 83-83 - സുൽഫോപ്പഫൻ സമ്പുഷ്ടമായ ആഹാരം വെൻഡിൻറെ ആയുസ്സ് വർദ്ധിപ്പിക്കും 00 മുതൽ XNUM% വരെ (ചില സാഹചര്യങ്ങളിൽ).
  • XXX: 00 - XXX - ആയുർദൈർഘ്യം കുറഞ്ഞ പ്രാധാന്യം.
  • ഞരമ്പുകളായ പച്ചക്കറികളും ബ്രോക്കലിയും മുളപ്പിച്ച പൗഡർ മനുഷ്യരിൽ പലതരം വീക്കം ഉദ്ദീപിപ്പിക്കുകയും ചെയ്യുന്നു.
  • വ്യായാമം: പ്രായപൂർത്തിയാകാത്ത ഒരാൾ
  • സൾഫർഫെയ്നിലെ മൗസ് സർവ്വേകൾ പഴക്കമുള്ള രോഗപ്രതിരോധ പ്രവർത്തനം മെച്ചപ്പെടുത്തും എന്നാണ് മൗസ് പഠനങ്ങൾ സൂചിപ്പിക്കുന്നത്.
  • എൺപത് മിനിറ്റുകൾക്കുള്ളിൽ സുൽഫോപ്പഫീൻ മൗസ് മോഡൽ മുടി ഉയർത്തി. ചിത്രത്തിലെ ചിത്രം: 00: 25: 18.
  • 83 - 83 - 83 - മസ്തിഷ്ക്കം, സ്വഭാവം ഭാഗം ആരംഭിക്കുക.
  • വ്യായാമം: ബ്രോക്കോളി മുട്ടയുടെ പ്രാധാന്യം ഓട്ടിസം
  • സ്കെസോഫ്രെനിയയിലെ ഗ്ലൂക്കോറാഫാനിൻറെ പ്രഭാവം.
  • 83 - 83 - മാനസിക വിഭ്രാന്തിയുടെ ആരംഭം (വിശ്വസനീയമായ സംവിധാനവും പഠനവും).
  • 83 - 83 - സ്ട്രെസ്-ഇൻഡുഡഡ് ഡിപ്രഷൻ ഷോയുടെ വിവിധ മോഡലുകൾ ഉപയോഗിച്ച് മൗസ് പഠനം ഫ്ലൂക്സെറ്റിൻ (പ്രോസക്) പോലെ സൾഫൊർഫാഹനെപ്പോലെ ഫലപ്രദമാണ്.
  • എലികളിൽ ഗ്ലൂക്കോറാപാനിനെ നേരിട്ട് ഉൾപ്പെടുത്തുന്നുവെന്ന് പഠിക്കുന്നത് സാമൂഹ്യ പരാജയങ്ങളുടെ സ്ട്രെസ് മോഡലിൽ വിഷാദരോഗം തടയുന്നതിന് സമാനമാണ്.
  • ഞാനിത്: ന്യൂറോഡെഗനേഷൻ വിഭാഗം ആരംഭിക്കുന്നു.
  • 83: 83 - സുൽഫോപ്പഫനും അൽസിമേഴ്സും രോഗം.
  • 83 - 83 - സുൽഫോപ്പഫേൻ പാർക്കിൻസൺസ് രോഗം.
  • 83: 83 - സുൽഫോപ്പഫൻ, ഹംഗിങ്ടൺസ് രോഗം.
  • 83: 83 - സുൽഫോപ്പഫേൻ ചൂട് ഷോക്ക് പ്രോട്ടീനുകൾ വർദ്ധിപ്പിക്കുന്നു.
  • വ്യായാമം: ബ്രോങ്കോ ന്യൂട്രീഷൻ തലച്ചോറ്ക്കുള്ള വ്യായാമം ആരംഭിക്കുക.
  • 83 - 83 - ടിബിഐ മെമ്മറി മെച്ചപ്പെടുത്തുന്നതിന് ശേഷം സുൽഫോപ്പഫീൻ കുത്തിവച്ച് (മൗസ് പഠനം).
  • 83 - 83 - സൾഫൊറാഫാനയും ന്യൂറോണൽ പ്ലാസ്റ്റിവും.
  • 83-83 - സോൾഫോപാപീൻ എലികളുടെ ടൈപ്പ് II ഡയബറ്റിസ് മാതൃകയിൽ പഠന മെച്ചപ്പെടുത്തുന്നു.
  • ഞരമ്പുകൾ, ഡുക്ക്ഹെൻ പേശീ നീർപ്പം.
  • 00: 37 - മയോസ്ടാടിൻ പേശികളുടെ ഉപഗ്രഹ സെല്ലുകളിൽ (in vitro) നിരോധനം.
  • മസ്തിഷ്ക, അർബുദം, ഡി.എൻ.എ നാശം, ഓക്സിഡേറ്റീവ് സ്ട്രെസ്, വീക്കം, ബെൻസെൻ വിസർജ്യങ്ങൾ, ഹൃദയ രോഗങ്ങൾ, ടൈപ്പ് II ഡയബറ്റിസ്, മസ്തിഷ്കത്തിലെ പ്രഭാവം (വിഷാദം, ഓട്ടിസം, സ്കീസോഫ്രേനിയ, ന്യൂറോഡെഗനേഷൻ), NRF00 പാത.
  • നഴ്സറികൾ, സൾഫൊർഫാപെണിന്റെ അളവ് നിർണ്ണയിക്കുന്നതിനുള്ള ചിന്തകൾ.
  • 83: 83 - 83 - വീട്ടിൽ മുളയ്ക്കുന്നമേൽ anecdotes.
  • 83: 83 - പാചകം താപനിലയും സൾഫൊർഫാനെ പ്രവർത്തനവും.
  • 83 - 83 - ഗ്ലൂക്കോറാപാഹിനിൽ നിന്ന് സൾഫർഫാപാനെ ഗുഡ് ബാക്ടീരിയയുടെ പരിവർത്തനം.
  • ഞാൺ: പച്ചക്കറികളിൽ സക്രിയ മൈറോസിനസിനൊപ്പം സപ്ലൈമുകൾ നന്നായി പ്രവർത്തിക്കുന്നു.
  • ഞാ 9: XX: XXX - പാചകം ടെക്നിക്കുകളും cruciferous പച്ചക്കറി.
  • 00: 46: 06 - ഐസോത്തിയോസയറ്റേറ്റുകൾ ഗായത്രി ആയി.

കടപ്പാടുകൾ

ശാസ്ത്രീയമായ / സയൻസ് / ഘടന / പോഷകാഹാരം

സുൽഫോരോഫീൻ നിർമ്മിക്കുന്നത് എങ്ങനെ?

പ്രോട്ടീൻ പ്രവർത്തനം, ബ്രോക്കോളിയിൽ സുൽഫോരോഫെയ്ൻ രൂപീകരണം വർദ്ധിപ്പിക്കൽ

വേര്പെട്ടുനില്ക്കുന്ന

ബ്രോക്കോളിയിൽ നിന്നുള്ള ഒരു ഐസോതോസിയാനേറ്റ് എന്ന സുൽഫോ പോഫാനെ, ശക്തമായ ഭക്ഷ്യധാന്യ ശേഖരമുള്ള ആന്റികർക്നോജെനുകളിൽ ഒന്നാണ്. ഈ സംയുക്തം പച്ചക്കറികളിൽ അടങ്ങിയിട്ടില്ല, മറിച്ച് ഗ്ലൂക്കോസിനോളേറ്റിൽ നിന്നുള്ള ഗ്ലോക്കോസിനോളേറ്റിൽ നിന്നും രൂപപ്പെട്ടതാണ് ഗ്ലോക്കോരാപാനിൻ, ബ്രൈക്കോളി കോശം തകർന്നാലോ ചവച്ചതോ ആയപ്പോൾ, തൈലോഗ്കൂസിഡസിസ് എൻസൈം എന്ന മരുന്നിന്റെ പ്രവർത്തനത്തിലൂടെ. എന്നാൽ, ഗ്ലൂക്കോപാപാനിനിൽ നിന്നുള്ള സൾഫോർഫാപ്പൻ വിളവ് വളരെ കുറവാണെന്നും അനിയന്ത്രിത നൈട്രലി അനലോഗ്, സൾഫോരോഫീൻ നൈട്രൈൽ, ഊഷ്മാവിൽ ടിഷ്യു തകർത്ത് തുടങ്ങിയപ്പോൾ പ്രൈമറി ഹൈഡ്രോളിസിസ് ഉത്പന്നമാണെന്നും നിരവധി പഠനങ്ങൾ തെളിയിച്ചിട്ടുണ്ട്. അറബിയോപ്രോസിസിൽ ഗ്ലൂക്കോസിനോളേറ്റുകളിൽ നിന്നുള്ള നൈട്രൽ രൂപവത്കരണം ചൂടിൽ സെൻസിറ്റീവ് പ്രോട്ടീൻ, എപിത്യോസ്പെസിഫയർ പ്രോട്ടീൻ (ഇപിഎസ്), മൈറോസിനാസിൻറെ രാസാഗ്നിയുടെ ഉത്തേജനം, നിയന്ത്രിക്കുന്നതായി പുതിയ തെളിവുകൾ സൂചിപ്പിക്കുന്നു. നമ്മുടെ ലക്ഷ്യങ്ങൾ സുല്ഫൊരഫനെ ആൻഡ് സുല്ഫൊരഫനെ നിത്രിലെ രൂപവത്കരണത്തിൽ താപനം ബ്രോക്കോളി ഫ്ലൊരെത്സ് ആൻഡ് മുളപ്പിച്ച ആഘാതവും, ബ്രോക്കോളി ഇഎസ്പി പ്രവർത്തനം അടങ്ങിയിരിക്കുന്നു, നിർണ്ണയിക്കുന്നതിന്, തുടർന്ന് ഇഎസ്പി പ്രവർത്തനത്തിൽ ചൂട്-ആശ്രിത മാറ്റങ്ങൾ, സുല്ഫൊരഫനെ ഉള്ളടക്കവും ബിഒഅച്തിവിത്യ് പരസ്പര വരെ, ഓൾട്ടർനേറ്റീവ് കണക്കാക്കിയത് പരിശോധിക്കുവാൻ ആയിരുന്നു കോശ സംസ്ക്കരണത്തിലെ ഘട്ടം II വിഷവസ്തുവാൽ ക്വിനോൺ റിഡക്ഷൻ (QR). ഹോമോജെസേഷനു മുൻപ് പൂരിപ്പിക്കൽ ബ്രൂക്കോലി ഫ്ലററ്റ് അല്ലെങ്കിൽ ബ്രോക്കോളി മുളപ്പിച്ച സസ്യങ്ങൾ 60 ° C ലേക്ക് ഒരേസമയം വർദ്ധിപ്പിച്ചത് സൾഫോറാഫാൻ രൂപീകരണവും സൾഫോറാപ്പനെ നൈട്രിലിൻറെ രൂപീകരണവും വർദ്ധിപ്പിച്ചു. ഇഎസ്പി പ്രവർത്തനങ്ങളുടെ ഭീമമായ നഷ്ടം സൾഫോറാഫാൻ നൈട്രൽ രൂപീകരണത്തിലെ കുറവുമായി സമാന്തരമായി. ബ്രൂക്കോളി ഫ്ലാരെറ്റുകളിൽ രണ്ട് ഉത്പന്നങ്ങളുടെ രൂപീകരണം കുറച്ചു, പക്ഷേ ബ്രോക്കോളി മുളകളിൽ ഇല്ലാത്തതും, ചൂടാക്കി 70 ° C ഉം താപനം. സംയുക്തമായ മൗസ് ഹെപ്പറ്റോമയിൽ QR ന്റെ ആഗിരണം ഹെൽറ്റാ Lclc7 കളങ്ങൾ സമാന്തരമായി സൾഫൊർപാണി രൂപത്തിൽ വർദ്ധിപ്പിക്കും.

പ്രീ-താപോർജ്ജം ബ്രോക്കോളി ഫ്ലാരെറ്റുകളും മുളപ്പിച്ച തണലും 60 ° C ലേക്ക് വർദ്ധിപ്പിച്ചത് പച്ചക്കറി ടിഷ്യു സാച്ചുറേഷനിലെ സോൾഫോപാപാനെ (എസ്എഫ്) എന്ന മിറൈനൈസിസ്-ഉത്കണ്ഠാജനകമായ രൂപവത്കരണം. സുൽഫോപ്പാപീൻ നൈട്രിലെ (SF Nitrile) രൂപീകരണവും എപിത്വോസ്പെസിഫയർ പ്രോട്ടീനും (ഇഎസ്പി) പ്രവർത്തനത്തിൽ കുറവുണ്ടായതാണ് ഇത്.

അടയാളവാക്കുകൾ: ബ്രോക്കോളി, ബ്രാസിക്ക ഓളാരേഷ്യ, ക്രൂസിഫെരാ, കാൻസർ, ആന്റികാർക്കോണിൻ, സൾഫോപ്രാപീൻ, സൾഫോപ്രഫാൻ നൈട്രൽ, എപിത്വോസ്പെസിഫയർ പ്രോട്ടീൻ, ക്വിനോൺ റിഡക്ഷൻ

ഉപസംഹാരമായി, സൾഫൊറഫാത്തിലെ ഒരു ഫൈറ്റോകെമണിക്കൽ ആണ് ബ്രോക്കോളിയിലും മറ്റ് cruciferous പച്ചക്കറികളിലും. ആന്തരികവും ബാഹ്യവുമായ ഘടകങ്ങളാൽ ഉണ്ടാകുന്ന അനിയന്ത്രിതമായ ഓക്സിഡൻറുകൾ മനുഷ്യ ശരീരത്തിലെ ഓക്സീറ്റീവ് സ്ട്രെസ് ഉണ്ടാക്കുന്നു, ഇത് ആത്യന്തികമായി ആരോഗ്യപ്രശ്നങ്ങൾക്ക് കാരണമാകാം. ഓക്സിഡൻറുകൾക്കുള്ള സെൽ പ്രതികരണത്തെ നിയന്ത്രിക്കുന്ന സംരക്ഷക ആന്റിഓക്സിഡന്റ് സംവിധാനങ്ങളെ നിയന്ത്രിക്കുന്ന ഒരു ട്രാൻസ്ക്രിപ്ഷൻ ഘടകം എൻആർഎഫ്എക്സ്എൻഎക്സ്എക്സ് എന്ന ഉൽപാദനത്തെ സുൽഫോ പോപ്പാനെ ഉത്പാദിപ്പിക്കാൻ കഴിയും. ഞങ്ങളുടെ വിവരങ്ങളുടെ വ്യാപ്തി ചിരപരിപാടി, നട്ടെല്ലിൽ ആരോഗ്യപ്രശ്നങ്ങൾക്ക് പരിമിതമാണ്. വിഷയം ചർച്ച ചെയ്യാൻ ഡോ. ജിമെനെസ് ചോദിക്കാൻ മടിക്കരുത് അല്ലെങ്കിൽ ഞങ്ങളെ ബന്ധപ്പെടുക 915-850-0900 .

ഡോ. അലക്സ് ജിമെനെസ് ക്യൂറാണ്

ഇതിൽ നിന്നും റെഫറൻസ്: Sciencedirect.com

പച്ച കോൾ ഇപ്പോൾ ബട്ടൺ എച്ച് .png

കൂടുതൽ വിഷയം ചർച്ച: അക്യുട്ട് ബാക്ക് വേദന

പുറം വേദന ലോകവ്യാപകമായി തൊഴിലാളിയുടെ വൈകല്യവും നഷ്ടപ്പെടാത്ത ദിവസങ്ങളും ഏറ്റവും കൂടുതലായ കാരണങ്ങൾ. ഡോക്ടർ ഓഫീസ് സന്ദർശനങ്ങൾക്കുള്ള രണ്ടാമത്തെ ഏറ്റവും സാധാരണ കാരണം ചൂണ്ടിക്കാട്ടുന്നു, ഉയർന്ന ശ്വാസകോശബാധയുള്ള അണുബാധകൾ മാത്രം. ജനസംഖ്യയിൽ ഏതാണ്ട് എൺപതു ശതമാനം പേർക്ക് അവരുടെ ജീവിതകാലം മുഴുവൻ ഒരു വേദന ഒരിക്കൽ അനുഭവപ്പെടും. നട്ടെല്ല്, സന്ധികൾ, കട്ടിലുകൾ, പേശികൾ തുടങ്ങി മൃദുവായ ടിഷ്യൂകൾ കൊണ്ട് നിർമ്മിച്ച സങ്കീർണമായ ഘടനയാണ് നട്ടെല്ല്. ഇതുമൂലം, ഗുരുതരമായ പരുക്കുകളോ അല്ലെങ്കിൽ അല്ലെങ്കിൽ മോശപ്പെട്ടതോ ആയ അവസ്ഥകൾ ഹാർനിയേറ്റഡ് ഡിസ്ക്കുകൾ, ഒടുവിൽ മുടി വേദനയുടെ ലക്ഷണങ്ങളായി മാറുന്നു. സ്പോർട്സ് പരിക്കുകൾ അല്ലെങ്കിൽ വാഹനാപകടങ്ങൾ പലപ്പോഴും മുടി വേദനയ്ക്ക് ഇടയാക്കുന്നു, ചിലപ്പോൾ ചലനങ്ങളുടെ ലളിതമായ വേദനയ്ക്ക് വേദനയേറിയ ഫലങ്ങൾ ഉണ്ടാകാം. ഭാഗ്യവശാൽ, ചികിൽസാകൃതിയിലുള്ള സംരക്ഷണം പോലെയുള്ള ബദൽ ചികിൽസാരീതികൾ, നട്ടെല്ലിൽ മാറ്റം വരുത്താനും നട്ടെല്ലിൽ മാറ്റം വരുത്താനും സഹായകരമാകും, ഇത് ആത്യന്തികമായി വേദനയുടെ ആശ്വാസം വർദ്ധിപ്പിക്കും.

കാർട്ടൂൺ പേപ്പർ ബോയുടെ ബ്ലോഗ് ചിത്രം

EXTRA EXTRA | പ്രധാന വിഷയം: ശുപാർശ എൽ പാസോ, TX ച്യൂയിപോർട്ട് സ്ട്രക്ചർ

***